FastQCFastQC Report
Mon 5 Dec 2016
JG53_3_CAGATC_L007_R1_001.fastq

Summary

[OK]Basic Statistics

MeasureValue
FilenameJG53_3_CAGATC_L007_R1_001.fastq
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences10446133
Sequences flagged as poor quality0
Sequence length50
%GC52

[OK]Per base sequence quality

Per base quality graph

[OK]Per tile sequence quality

Per base quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[FAIL]Per base sequence content

Per base sequence content

[FAIL]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[OK]Sequence Length Distribution

Sequence length distribution

[FAIL]Sequence Duplication Levels

Duplication level graph

[FAIL]Overrepresented sequences

SequenceCountPercentagePossible Source
TTGCGGCCCCGGGTTCCTCCCGGGGCTACGCCTGTCTGAGGGTCGCTTGG4669584.470151777696111No Hit
CCTGTCTGAGGGTCGCTTGGAATTCTCGGGTGCCAAGGAACTCCAGTCAC3546123.3946724591769986RNA PCR Primer, Index 1 (100% over 33bp)
ATGACCTATGAATTGACAGCCATGGAATTCTCGGGTGCCAAGGAACTCCA3155723.0209456456279082RNA PCR Primer, Index 1 (100% over 28bp)
ATGACCTATGAATTGACAGCCTGGAATTCTCGGGTGCCAAGGAACTCCAG2828222.707432501577378RNA PCR Primer, Index 1 (100% over 29bp)
TTCAAGTAATCCAGGATAGGCTTGGAATTCTCGGGTGCCAAGGAACTCCA2526662.4187515131197355RNA PCR Primer, Index 1 (100% over 28bp)
ACTGTATAAGGTACATATGGTTGAGTGTCGTATGGAATTCTCGGGTGCCA1957031.8734492467212507No Hit
TGAGGTAGTAGGTTGTATAGTTTGGAATTCTCGGGTGCCAAGGAACTCCA1629151.5595723316944174RNA PCR Primer, Index 1 (100% over 28bp)
AAGCTGCCAGCTGAAGAACTGTTGGAATTCTCGGGTGCCAAGGAACTCCA1530671.4652982113093909RNA PCR Primer, Index 1 (100% over 28bp)
AACATTCAACGCTGTCGGTGAGTTGGAATTCTCGGGTGCCAAGGAACTCC1172611.1225302224277633RNA PCR Primer, Index 1 (100% over 27bp)
CTACGCCTGTCTGAGGGTCGCTTGGAATTCTCGGGTGCCAAGGAACTCCA1158351.1088792378959755RNA PCR Primer, Index 1 (100% over 28bp)
AACATTCAACGCTGTCGGTGAGTGGAATTCTCGGGTGCCAAGGAACTCCA1147301.0983011608219042RNA PCR Primer, Index 1 (100% over 28bp)
TAGCTTATCAGACTGGTGTTGGCTGGAATTCTCGGGTGCCAAGGAACTCC942400.9021520212312059RNA PCR Primer, Index 1 (100% over 27bp)
TATTGCACTTGTCCCGGCCTGTTGGAATTCTCGGGTGCCAAGGAACTCCA876540.8391047672856549RNA PCR Primer, Index 1 (100% over 28bp)
CTGTCTGAGGGTCGCTTGGAATTCTCGGGTGCCAAGGAACTCCAGTCACC854720.818216654909525RNA PCR Primer, Index 2 (100% over 34bp)
GTGGGCTCTGGTAGTCCAGTGGCAAGATCGTCTGACTTACGTTTTGGAAT799440.7652975507778812No Hit
GATCCATGATGACATTAAAACATAACGTGACTGTTGGATGAAGCTTGCGG676280.6473974627740237No Hit
TGAGGTAGTAGTTTGTATAGTTTGGAATTCTCGGGTGCCAAGGAACTCCA666890.6384084904911703RNA PCR Primer, Index 1 (100% over 28bp)
TCAGTAACTGGAATCTGTCCCTTGGAATTCTCGGGTGCCAAGGAACTCCA636220.6090483435353542RNA PCR Primer, Index 1 (100% over 28bp)
GTTTCCGTAGTGTAGTGGTTATCACGTTCGCCTTGGAATTCTCGGGTGCC601990.5762802369068056No Hit
TGTCTGAGGGTCGCTTGGAATTCTCGGGTGCCAAGGAACTCCAGTCACCA595840.570392890842956RNA PCR Primer, Index 7 (100% over 35bp)
ATCCATGATGACATTAAAACATAACGTGACTGTTGGATGAAGCTTGCGGA580370.5555835829392561No Hit
CTTCGAACGCACCTTGCGGCCCCGGGTTCCTCCCGGGGCTACGCCTGTCT516800.4947285277719516No Hit
TGTAAACATCCTTGACTGGAAGCTTGGAATTCTCGGGTGCCAAGGAACTC481630.4610605666230748RNA PCR Primer, Index 1 (100% over 26bp)
TGGAGTGTGACAATGGTGTTTGTGGAATTCTCGGGTGCCAAGGAACTCCA479260.4587917844813961RNA PCR Primer, Index 1 (100% over 28bp)
GTTTCCGTAGTGTAGTGGTTATCACGTTCGCCTGGAATTCTCGGGTGCCA422170.40413998175209914No Hit
CTGTATAAGGTACATATGGTTGAGTGTCGTATGGAATTCTCGGGTGCCAA419230.4013255431459661No Hit
AGAGATGATGACTTCTGTTACCGCCCCAGTCTGAGAAGTCATGACTGATC413100.3954573429229745No Hit
TTCAGTGATGTTTGACAAATGTCTGACCTGAACTGCAATGTGGACAGATC410640.3931024044974346No Hit
TGAGATGAAGCACTGTAGCTCTGGAATTCTCGGGTGCCAAGGAACTCCAG408790.3913314142180652RNA PCR Primer, Index 1 (100% over 29bp)
GCATTGGTGGTTCAGTGGTAGAATTCTCGCCTGGAATTCTCGGGTGCCAA405410.38809576711305516No Hit
GGACAACTCTTAGCGGTGGAATTCTCGGGTGCCAAGGAACTCCAGTCACC391300.37458837638770254RNA PCR Primer, Index 2 (100% over 34bp)
CTGGACAACTCTTAGCGGTGGAATTCTCGGGTGCCAAGGAACTCCAGTCA374940.3589270785658195RNA PCR Primer, Index 1 (100% over 32bp)
ATTCGATCTTCTAAGGCTACTCTAGCTTGGCGGTTCTGGAATTCTCGGGT371690.35581587942638676No Hit
TTGCGGCCCCGGGTTCCTCCCGGGGCTACGCCTGTCTGAGGGTCGCTTTG366890.35122087762045534No Hit
TACGCCTGTCTGAGGGTCGCTTGGAATTCTCGGGTGCCAAGGAACTCCAG339800.3252878361782298RNA PCR Primer, Index 1 (100% over 29bp)
TTCAAGTAATCCAGGATAGGTTTGGAATTCTCGGGTGCCAAGGAACTCCA318330.3047347760171156RNA PCR Primer, Index 1 (100% over 28bp)
CCACGTTCCCGTGGTGGAATTCTCGGGTGCCAAGGAACTCCAGTCACCAG311390.29809116923937307RNA PCR Primer, Index 7 (100% over 36bp)
TGTAAACATCCTACACTCTCAGCTTGGAATTCTCGGGTGCCAAGGAACTC305170.29213681273252023RNA PCR Primer, Index 1 (100% over 26bp)
TCAGTAACTGGAATCTGTCCCTGCTGGAATTCTCGGGTGCCAAGGAACTC292140.2796632974135022RNA PCR Primer, Index 1 (100% over 26bp)
GTTACATGATGAAACATGTGTTGGTAGGGACATCTGAATGAATGTGATGA287630.2753459103000125No Hit
AACCCGTAGATCCGAACTTGTGTGGAATTCTCGGGTGCCAAGGAACTCCA285470.2732781594873433RNA PCR Primer, Index 1 (100% over 28bp)
CTTGCGGCCCCGGGTTCCTCCCGGGGCTACGCCTGTCTGAGGGTCGCTTG283760.2716411900939802No Hit
CCTGTCTGAGGGTCGCTTTGGAATTCTCGGGTGCCAAGGAACTCCAGTCA275800.2640211454324773RNA PCR Primer, Index 1 (100% over 32bp)
GTGGGCTCTGGTAGTCCAGTGGCAAGATCGTCTGACTTACGTTTTTGGAA274050.2623458843573981No Hit
TCGCTGCGATCCATTGAAAGTCAGCCCTCGATCCAAGTTTTTGTTGGAAT258070.247048357511818No Hit
GTTTCCGTAGTGTAGTGGTTATCACGTTCGCCTCTGGAATTCTCGGGTGC256210.2452677943120196No Hit
ACAGTAGTCTGCACATTGGTTTGGAATTCTCGGGTGCCAAGGAACTCCAG254000.24315217889720528RNA PCR Primer, Index 1 (100% over 29bp)
GCATTGTTGGTTCAGTGGTAGAATGTTCGCCTTGGAATTCTCGGGTGCCA244670.2342206441369261No Hit
ACTGGACAACTCTTAGCGGTGGAATTCTCGGGTGCCAAGGAACTCCAGTC242210.23186570571138623RNA PCR Primer, Index 1 (100% over 31bp)
TGAGATGAAGCACTGTAGCTCTTGGAATTCTCGGGTGCCAAGGAACTCCA237200.22706967257644528RNA PCR Primer, Index 1 (100% over 28bp)
AACATTCAACGCTGTCGGTGATGGAATTCTCGGGTGCCAAGGAACTCCAG232730.2227905771446716RNA PCR Primer, Index 1 (100% over 29bp)
GCCCGGCTAGCTCAGTCGGTAGAGCATGAGACTCTGGAATTCTCGGGTGC225600.2159650848787776No Hit
TGAGGTAGTAGTTTGTGCTGTTTGGAATTCTCGGGTGCCAAGGAACTCCA221280.21182958325343934RNA PCR Primer, Index 1 (100% over 28bp)
TGAGGTAGTAGATTGAATAGTTTGGAATTCTCGGGTGCCAAGGAACTCCA218560.20922574889674486RNA PCR Primer, Index 1 (100% over 28bp)
TAAGATGATGATTAACTCACCATCTTTCGGCTGAAGAATGATGTATACTC217980.20867051951186147No Hit
AACTGGACAACTCTTAGCGGTGGAATTCTCGGGTGCCAAGGAACTCCAGT206170.19736490048518435RNA PCR Primer, Index 1 (100% over 30bp)
CTCGCTGCGATCCATTGAAAGTCAGCCCTCGATCCAAGTTTTTGTTGGAA202420.1937750553243004No Hit
TGCCTGTGATGAGACTCTCGACGGGCGGACTGAATGGGTTTTCACCCTCC200370.1918126066363505No Hit
CCTTGCGGCCCCGGGTTCCTCCCGGGGCTACGCCTGTCTGAGGGTCGCTT196690.18828977191846974No Hit
TGTAAACATCCCCGACTGGAAGCTTGGAATTCTCGGGTGCCAAGGAACTC191850.1836564784308222RNA PCR Primer, Index 1 (100% over 26bp)
TTCACAGTGGCTAAGTTCTGCTGGAATTCTCGGGTGCCAAGGAACTCCAG184680.1767926944832121RNA PCR Primer, Index 1 (100% over 29bp)
TGGAATTCTCGGGTGCCAAGGAACTCCAGTCACCAGATCATCTCGTATGC174130.166693263430592RNA PCR Primer, Index 7 (100% over 50bp)
TCAGTAACTGGAATCTGTCCCTGTGGAATTCTCGGGTGCCAAGGAACTCC172480.16511373155980302RNA PCR Primer, Index 1 (100% over 27bp)
TACACTGATGACTTCTTAGGACACCTTTGGATTCTTGATGAAAACAAATT171270.16395540818789114No Hit
TTACATGATGAAACATGTGTTGGTAGGGACATCTGAATGAATGTGATGAA169040.16182064693221884No Hit
CATTATTACTTTTGGTACGCGTGGAATTCTCGGGTGCCAAGGAACTCCAG168070.1608920736506035RNA PCR Primer, Index 1 (100% over 29bp)
AACTCTTAGCGGTGGATCACTCGGCTCGTGCGTCGATGAAGAACGCAGCT167810.16064317771944892No Hit
CATTGCACTTGTCTCGGTCTGATGGAATTCTCGGGTGCCAAGGAACTCCA165110.15805848920361248RNA PCR Primer, Index 1 (100% over 28bp)
TTCACAGTGGCTAAGTTCTGTGGAATTCTCGGGTGCCAAGGAACTCCAGT163320.1563449364468172RNA PCR Primer, Index 1 (100% over 30bp)
GCATTGGTGGTTCAGTGGTAGAATTCTCGCCTTGGAATTCTCGGGTGCCA162610.1556652590963565No Hit
GCATGAGTGACTGGTTAATCTTTTGGAATTCTCGGGTGCCAAGGAACTCC160950.15407615430513857RNA PCR Primer, Index 1 (100% over 27bp)
TCGTACCGTGAGTAATAATGCATGGAATTCTCGGGTGCCAAGGAACTCCA153200.1466571409726451RNA PCR Primer, Index 1 (100% over 28bp)
ATGACCTATGAATTGACAGCCATTGGAATTCTCGGGTGCCAAGGAACTCC152850.14632208875762925RNA PCR Primer, Index 1 (100% over 27bp)
TTCACAGTGGTTAAGTTCTGTGGAATTCTCGGGTGCCAAGGAACTCCAGT147480.14118143048724346RNA PCR Primer, Index 1 (100% over 30bp)
GCATTGTGGTTCAGTGGTAGAATTCTCGCCTGGAATTCTCGGGTGCCAAG146270.14002310711533156No Hit
TACCGTGAAGAATATCACGTCTTTCGCTCCTATCTGATCTGGAATTCTCG145730.1395061694121643No Hit
TTCCAGTGATGACAGCCTATAATCTGACTTGGAATTCTCGGGTGCCAAGG143460.1373331164747759Illumina Small RNA Adapter 2 (100% over 21bp)
TGAGGTAGTAGGTTGTATAGTTTTGGAATTCTCGGGTGCCAAGGAACTCC137060.13120644740020063RNA PCR Primer, Index 1 (100% over 27bp)
TATTGCACTTGTCCCGGCCTGTTTGGAATTCTCGGGTGCCAAGGAACTCC132640.1269752165705721RNA PCR Primer, Index 1 (100% over 27bp)
CAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACT132280.12663059143512723No Hit
CGCCTGTCTGAGGGTCGCTTGGAATTCTCGGGTGCCAAGGAACTCCAGTC130490.12491703867833198RNA PCR Primer, Index 1 (100% over 31bp)
TCACAGTGAACCGGTCTCTTTTGGAATTCTCGGGTGCCAAGGAACTCCAG129970.12441924681602272RNA PCR Primer, Index 1 (100% over 29bp)
TGAGGTAGTAGGTTGTATAGTTGGAATTCTCGGGTGCCAAGGAACTCCAG124660.11933602606821107RNA PCR Primer, Index 1 (100% over 29bp)
TGGAGTGTGACAATGGTGTTTGTTGGAATTCTCGGGTGCCAAGGAACTCC124020.11872335916075355RNA PCR Primer, Index 1 (100% over 27bp)
TGAGGTAGTTGTTTGTACAGTTTGGAATTCTCGGGTGCCAAGGAACTCCA124020.11872335916075355RNA PCR Primer, Index 1 (100% over 28bp)
TGTCTGAGGGTCGCTTGGAATTCTCGGGTGCCCAGGAACTCCAGTCACCA122130.11691407719966805RNA PCR Primer, Index 7 (97% over 35bp)
GATGAATGAGGTACATGTTCTTGAGTGGCTATATGGAATTCTCGGGTGCC121070.11589934763419152No Hit
TTTTGCAGAAACGTTTCAGATTTGGAATTCTCGGGTGCCAAGGAACTCCA117640.11261583592703633RNA PCR Primer, Index 1 (100% over 28bp)
CACCTTGCGGCCCCGGGTTCCTCCCGGGGCTACGCCTGTCTGAGGGTCGC117190.11218505450773027No Hit
CAACTCTTAGCGGTGGATCACTCGGCTCGTGCGTCGATGAAGAACGCAGC115430.11050022051222208No Hit
ATCCATGATGACATTAAAACATAACGTGCCTGTTGGATGAAGCTTGCGGA113920.10905470952743948No Hit
GCCCGGCTAGCTCAGTCGGTAGAGCATGAGACTCTTAATCTTGGAATTCT112850.10803040704153394No Hit
AACATTCATTGCTGTCGGTGGGTGGAATTCTCGGGTGCCAAGGAACTCCA111850.10707311499863156RNA PCR Primer, Index 1 (100% over 28bp)
GTTCCTGTAGTGTAGTGGTTATCACGTTCGCCTTGGAATTCTCGGGTGCC111750.10697738579434131No Hit
GGGGCTATAGCTCAGTGGTAGAGCATTCGACTTGGAATTCTCGGGTGCCA111340.10658489605675134No Hit
TCCCATATGGTCTAGCGGTTAGGATTCCTGGAATTCTCGGGTGCCAAGGA110370.10565632277513602RNA PCR Primer, Index 1 (100% over 22bp)
AGGGTCGCTTGGAATTCTCGGGTGCCAAGGAACTCCAGTCACCAGATCAT109470.10479475993652389RNA PCR Primer, Index 7 (100% over 41bp)
GAAGGATCATTATGGAATTCTCGGGTGCCAAGGAACTCCAGTCACCAGAT109280.10461287444837243RNA PCR Primer, Index 7 (100% over 38bp)
CACGTTCCCGTGGTGGAATTCTCGGGTGCCAAGGAACTCCAGTCACCAGA108500.10386618665490857RNA PCR Primer, Index 7 (100% over 37bp)
TCCCTGGTGGTCTAGTGGTTAGGATTTGGCGCTCTGGAATTCTCGGGTGC107910.10330138434959615No Hit
TGTAAACATCCCCGACTGGAAGCTGGAATTCTCGGGTGCCAAGGAACTCC107370.10278444664642888RNA PCR Primer, Index 1 (100% over 27bp)
GTGGGCTCTGGTAGTCCAGTGGCAAGATCGTCTGACTAACGTTTTGGAAT106760.10220049850025842No Hit
TGAGATGAAGCACTGTAGCTTGGAATTCTCGGGTGCCAAGGAACTCCAGT105520.10101345636705945RNA PCR Primer, Index 1 (100% over 30bp)
AACATTCATTGCTGTCGGTGGGTTGGAATTCTCGGGTGCCAAGGAACTCC105350.10085071671976605RNA PCR Primer, Index 1 (100% over 27bp)

[FAIL]Adapter Content

Adapter graph

[WARN]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
CGTTCTA254.4149347E-544.051161
CGCTAAA207.814564E-444.051161
CACTATC254.445246E-544.00012620
TCGTTAC207.86078E-443.99844414
ATATTAG408.3255145E-943.99844414
CTGCCTA408.3309715E-943.99612430
GATTCGC408.3309715E-943.995929
CGCCAAT408.3309715E-943.995923
ACGGTAT207.8630034E-443.995927
TATTGCC502.7284841E-1143.99591411
CCCATTA254.4477587E-543.9959143
AACATTC307650.043.979571
TCAGTAA129000.043.931641
TGACCTA669800.043.8955762
ACCTATG671200.043.8779344
CTATGAA671250.043.8746646
TCAACGC274000.043.8674626
CAACGCT273900.043.8674167
ACATTCA310650.043.8628462
CAGCCAT344850.043.84953717