FastQCFastQC Report
Mon 5 Dec 2016
JG55_3_ACTTGA_L006_R1_001.fastq

Summary

[OK]Basic Statistics

MeasureValue
FilenameJG55_3_ACTTGA_L006_R1_001.fastq
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences9550646
Sequences flagged as poor quality0
Sequence length50
%GC52

[OK]Per base sequence quality

Per base quality graph

[WARN]Per tile sequence quality

Per base quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[FAIL]Per base sequence content

Per base sequence content

[FAIL]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[OK]Sequence Length Distribution

Sequence length distribution

[FAIL]Sequence Duplication Levels

Duplication level graph

[FAIL]Overrepresented sequences

SequenceCountPercentagePossible Source
TTGCGGCCCCGGGTTCCTCCCGGGGCTACGCCTGTCTGAGGGTCGCTTGG4809735.0360258353204586No Hit
TTCAAGTAATCCAGGATAGGCTTGGAATTCTCGGGTGCCAAGGAACTCCA2674552.80038648694549RNA PCR Primer, Index 1 (100% over 28bp)
CCTGTCTGAGGGTCGCTTGGAATTCTCGGGTGCCAAGGAACTCCAGTCAC2614492.737500688435107RNA PCR Primer, Index 1 (100% over 33bp)
ATGACCTATGAATTGACAGCCTGGAATTCTCGGGTGCCAAGGAACTCCAG2470312.5865370782248656RNA PCR Primer, Index 1 (100% over 29bp)
ATGACCTATGAATTGACAGCCATGGAATTCTCGGGTGCCAAGGAACTCCA2308162.416757986841937RNA PCR Primer, Index 1 (100% over 28bp)
TAGCTTATCAGACTGGTGTTGGCTGGAATTCTCGGGTGCCAAGGAACTCC2069992.1673821854563555RNA PCR Primer, Index 1 (100% over 27bp)
TGAGGTAGTAGGTTGTATAGTTTGGAATTCTCGGGTGCCAAGGAACTCCA1388621.453954004786692RNA PCR Primer, Index 1 (100% over 28bp)
AAGCTGCCAGCTGAAGAACTGTTGGAATTCTCGGGTGCCAAGGAACTCCA1250061.3088748132848815RNA PCR Primer, Index 1 (100% over 28bp)
CTACGCCTGTCTGAGGGTCGCTTGGAATTCTCGGGTGCCAAGGAACTCCA942300.9866348307747979RNA PCR Primer, Index 1 (100% over 28bp)
AACATTCAACGCTGTCGGTGAGTGGAATTCTCGGGTGCCAAGGAACTCCA794410.8317866665773185RNA PCR Primer, Index 1 (100% over 28bp)
AACATTCAACGCTGTCGGTGAGTTGGAATTCTCGGGTGCCAAGGAACTCC765040.80103482005301RNA PCR Primer, Index 1 (100% over 27bp)
TGTAAACATCCTTGACTGGAAGCTTGGAATTCTCGGGTGCCAAGGAACTC721570.7555195742780122RNA PCR Primer, Index 1 (100% over 26bp)
TGAGGTAGTAGTTTGTATAGTTTGGAATTCTCGGGTGCCAAGGAACTCCA689470.7219092823668681RNA PCR Primer, Index 1 (100% over 28bp)
TATTGCACTTGTCCCGGCCTGTTGGAATTCTCGGGTGCCAAGGAACTCCA672370.7040047343394363RNA PCR Primer, Index 1 (100% over 28bp)
ACTGTATAAGGTACATATGGTTGAGTGTCGTATGGAATTCTCGGGTGCCA630490.660154297416112No Hit
GATCCATGATGACATTAAAACATAACGTGACTGTTGGATGAAGCTTGCGG621070.6502910902571407No Hit
CTGTCTGAGGGTCGCTTGGAATTCTCGGGTGCCAAGGAACTCCAGTCACA577390.6045559640677709RNA PCR Primer, Index 1 (100% over 34bp)
ATCCATGATGACATTAAAACATAACGTGACTGTTGGATGAAGCTTGCGGA548640.574453288290656No Hit
GTGGGCTCTGGTAGTCCAGTGGCAAGATCGTCTGACTTACGTTTTGGAAT545690.5713644919935259No Hit
TAACGGAACCCATAATGCAGCTGTGGAATTCTCGGGTGCCAAGGAACTCC529270.5541719376888223RNA PCR Primer, Index 1 (100% over 27bp)
TGTCTGAGGGTCGCTTGGAATTCTCGGGTGCCAAGGAACTCCAGTCACAC525500.5502245607260493RNA PCR Primer, Index 5 (100% over 35bp)
GCCCGGCTAGCTCAGTCGGTAGAGCATGAGACTCTTAATCTTGGAATTCT512310.536413976604305No Hit
AGAGATGATGACTTCTGTTACCGCCCCAGTCTGAGAAGTCATGACTGATC465830.4877471115566423No Hit
TGTAAACATCCTACACTCTCAGCTTGGAATTCTCGGGTGCCAAGGAACTC423990.44393855661700793RNA PCR Primer, Index 1 (100% over 26bp)
ATTCGATCTTCTAAGGCTACTCTAGCTTGGCGGTTCTGGAATTCTCGGGT399590.4183905465661695No Hit
TGAGATGAAGCACTGTAGCTCTGGAATTCTCGGGTGCCAAGGAACTCCAG394900.41347988397852875RNA PCR Primer, Index 1 (100% over 29bp)
TTCAAGTAATCCAGGATAGGTTTGGAATTCTCGGGTGCCAAGGAACTCCA363830.38094805314739966RNA PCR Primer, Index 1 (100% over 28bp)
TTCAGTGATGTTTGACAAATGTCTGACCTGAACTGCAATGTGGACAGATC357100.3739014093915741No Hit
TTGCGGCCCCGGGTTCCTCCCGGGGCTACGCCTGTCTGAGGGTCGCTTTG347630.36398584975299053No Hit
CTGGACAACTCTTAGCGGTGGAATTCTCGGGTGCCAAGGAACTCCAGTCA346200.36248856883607666RNA PCR Primer, Index 1 (100% over 32bp)
GGACAACTCTTAGCGGTGGAATTCTCGGGTGCCAAGGAACTCCAGTCACA343260.359410243034869RNA PCR Primer, Index 1 (100% over 34bp)
TGGAGTGTGACAATGGTGTTTGTGGAATTCTCGGGTGCCAAGGAACTCCA334100.3498192687698822RNA PCR Primer, Index 1 (100% over 28bp)
TCCCATATGGTCTAGCGGTTAGGATTCCTTGGAATTCTCGGGTGCCAAGG330990.3465629445379925Illumina Small RNA Adapter 2 (100% over 21bp)
AACCCGTAGATCCGAACTTGTGTGGAATTCTCGGGTGCCAAGGAACTCCA318940.33394599695141036RNA PCR Primer, Index 1 (100% over 28bp)
GCCCGGCTAGCTCAGTCGGTAGAGCATGAGACTCTGGAATTCTCGGGTGC317240.33216601264458967No Hit
GTTTCCGTAGTGTAGTGGTTATCACGTTCGCCTCTGGAATTCTCGGGTGC316830.3317367223117682No Hit
CTTGCGGCCCCGGGTTCCTCCCGGGGCTACGCCTGTCTGAGGGTCGCTTG302120.31633462280980784No Hit
TGAGATGAAGCACTGTAGCTCTTGGAATTCTCGGGTGCCAAGGAACTCCA301380.3155598061115447RNA PCR Primer, Index 1 (100% over 28bp)
GTTACATGATGAAACATGTGTTGGTAGGGACATCTGAATGAATGTGATGA298720.3127746541961664No Hit
TACGCCTGTCTGAGGGTCGCTTGGAATTCTCGGGTGCCAAGGAACTCCAG284420.2978018450270275RNA PCR Primer, Index 1 (100% over 29bp)
TTCACAGTGGCTAAGTTCTGCTGGAATTCTCGGGTGCCAAGGAACTCCAG265460.27794978475801535RNA PCR Primer, Index 1 (100% over 29bp)
TAAGATGATGATTAACTCACCATCTTTCGGCTGAAGAATGATGTATACTC255690.26772011024175746No Hit
GTTTCCGTAGTGTAGTGGTTATCACGTTCGCCTTGGAATTCTCGGGTGCC241140.2524855386745567No Hit
TGCCTGTGATGAGACTCTCGACGGGCGGACTGAATGGGTTTTCACCCTCC239140.2503914394900617No Hit
CTTCGAACGCACCTTGCGGCCCCGGGTTCCTCCCGGGGCTACGCCTGTCT233270.24424525838356903No Hit
TGGAATTCTCGGGTGCCAAGGAACTCCAGTCACACTTGAATCTCGTATGC231360.24224539366237635RNA PCR Primer, Index 8 (100% over 50bp)
CCACGTTCCCGTGGTGGAATTCTCGGGTGCCAAGGAACTCCAGTCACACT225580.23619344701918593RNA PCR Primer, Index 8 (100% over 36bp)
TCGCTGCGATCCATTGAAAGTCAGCCCTCGATCCAAGTTTTTGTTGGAAT223130.2336281755181796No Hit
ACTGGACAACTCTTAGCGGTGGAATTCTCGGGTGCCAAGGAACTCCAGTC216390.22657106126643162RNA PCR Primer, Index 1 (100% over 31bp)
TGAGGTAGTAGATTGAATAGTTTGGAATTCTCGGGTGCCAAGGAACTCCA212950.2229692106691003RNA PCR Primer, Index 1 (100% over 28bp)
TTACATGATGAAACATGTGTTGGTAGGGACATCTGAATGAATGTGATGAA212460.22245615636889904No Hit
TTCACAGTGGTTAAGTTCTGTGGAATTCTCGGGTGCCAAGGAACTCCAGT206920.216655501627848RNA PCR Primer, Index 1 (100% over 30bp)
ACAGTAGTCTGCACATTGGTTTGGAATTCTCGGGTGCCAAGGAACTCCAG206480.2161947998072591RNA PCR Primer, Index 1 (100% over 29bp)
TGTAAACATCCCCGACTGGAAGCTTGGAATTCTCGGGTGCCAAGGAACTC204280.21389129070431465RNA PCR Primer, Index 1 (100% over 26bp)
TCGTACCGTGAGTAATAATGCATGGAATTCTCGGGTGCCAAGGAACTCCA198120.20744146521607018RNA PCR Primer, Index 1 (100% over 28bp)
TTCACAGTGGCTAAGTTCTGTGGAATTCTCGGGTGCCAAGGAACTCCAGT194380.20352549974106465RNA PCR Primer, Index 1 (100% over 30bp)
TGAGAACTGAATTCCATAGATGGTGGAATTCTCGGGTGCCAAGGAACTCC193160.20224809923852272RNA PCR Primer, Index 1 (100% over 27bp)
CCTTGCGGCCCCGGGTTCCTCCCGGGGCTACGCCTGTCTGAGGGTCGCTT192690.20175598593016641No Hit
TGAGGTAGTAGTTTGTGCTGTTTGGAATTCTCGGGTGCCAAGGAACTCCA191700.20071940683384137RNA PCR Primer, Index 1 (100% over 28bp)
AACTGGACAACTCTTAGCGGTGGAATTCTCGGGTGCCAAGGAACTCCAGT189200.19810178285322272RNA PCR Primer, Index 1 (100% over 30bp)
GCATTGGTGGTTCAGTGGTAGAATTCTCGCCTGGAATTCTCGGGTGCCAA189000.1978923729347732No Hit
GCATTGGTGGTTCAGTGGTAGAATTCTCGCCTTGGAATTCTCGGGTGCCA184620.19330629572072924No Hit
CCTGTCTGAGGGTCGCTTTGGAATTCTCGGGTGCCAAGGAACTCCAGTCA183310.19193466075488505RNA PCR Primer, Index 1 (100% over 32bp)
TTCCAGTGATGACAGCCTATAATCTGACTTGGAATTCTCGGGTGCCAAGG182450.19103419810555222Illumina Small RNA Adapter 2 (100% over 21bp)
CATTATTACTTTTGGTACGCGTGGAATTCTCGGGTGCCAAGGAACTCCAG180800.1893065662783439RNA PCR Primer, Index 1 (100% over 29bp)
TCAGTAACTGGAATCTGTCCCTTGGAATTCTCGGGTGCCAAGGAACTCCA179410.1878511673451199RNA PCR Primer, Index 1 (100% over 28bp)
AGCCTGTGATGATACAAGTTATCCCTGTCTGAACTCTGGTGTGGAATTCT169200.17716079100827314No Hit
CTCGCTGCGATCCATTGAAAGTCAGCCCTCGATCCAAGTTTTTGTTGGAA166840.1746897539705691No Hit
GTTTCCGTAGTGTAGTGGTTATCACGTTCGCCTGGAATTCTCGGGTGCCA164290.17201977751033803No Hit
TTCACAGTGGTTAAGTTCTGCTGGAATTCTCGGGTGCCAAGGAACTCCAG158240.16568512747724082RNA PCR Primer, Index 1 (100% over 29bp)
TAGCTTATCAGACTGGTGTTGGTGGAATTCTCGGGTGCCAAGGAACTCCA158030.16546524706286883RNA PCR Primer, Index 1 (100% over 28bp)
GTGGGCTCTGGTAGTCCAGTGGCAAGATCGTCTGACTTACGTTTTTGGAA154350.16161210456339814No Hit
TGAGGTAGTAGGTTGTATAGTTTTGGAATTCTCGGGTGCCAAGGAACTCC138750.14527813092433747RNA PCR Primer, Index 1 (100% over 27bp)
TTCACAGTGGTTAAGTTCTGCCTGGAATTCTCGGGTGCCAAGGAACTCCA137190.14364473356043142RNA PCR Primer, Index 1 (100% over 28bp)
TACACTGATGACTTCTTAGGACACCTTTGGATTCTTGATGAAAACAAATT127630.13363493945854554No Hit
TCCCTGGTGGTCTAGTGGTTAGGATTTGGCGCTCTGGAATTCTCGGGTGC126850.1328182407765925No Hit
TCCAGTGATGACAGCCTATAATCTGACTTGGAATTCTCGGGTGCCAAGGA124540.13039955621850083RNA PCR Primer, Index 1 (100% over 22bp)
TGTAAACATCCTACACTCAGCTTGGAATTCTCGGGTGCCAAGGAACTCCA123400.1292059196833387RNA PCR Primer, Index 1 (100% over 28bp)
ATGACCTATGAATTGACAGCCATTGGAATTCTCGGGTGCCAAGGAACTCC122470.12823216356254855RNA PCR Primer, Index 1 (100% over 27bp)
TCCGAATGATGAAATGTTGTTGATCTCTGTAGTAACCACGGTTACAGTGA122330.1280855766196339No Hit
TCTGACACCATGGAATTCTCGGGTGCCAAGGAACTCCAGTCACACTTGAA121330.1270385270273864RNA PCR Primer, Index 8 (100% over 40bp)
TCCCTGGTGGTCTAGTGGTTAGGATTCGGCGCTCTGGAATTCTCGGGTGC117630.12316444353607076No Hit
CATTGCACTTGTCTCGGTCTGATGGAATTCTCGGGTGCCAAGGAACTCCA116290.12176139708245913RNA PCR Primer, Index 1 (100% over 28bp)
TGTAAACATCCTTGACTGGAAGCTGGAATTCTCGGGTGCCAAGGAACTCC115200.12062011302690938RNA PCR Primer, Index 1 (100% over 27bp)
CATGGCTGATGACCTTTGATGCGTTAGACTTCTGATTTAAAAATGAAGTC112940.11825378094843007No Hit
TGTAAACATCCCCGACTGGAAGCTGGAATTCTCGGGTGCCAAGGAACTCC112640.11793966607075584RNA PCR Primer, Index 1 (100% over 27bp)
CACCTTGCGGCCCCGGGTTCCTCCCGGGGCTACGCCTGTCTGAGGGTCGC111420.11666226556821392No Hit
AACATTCAACGCTGTCGGTGATGGAATTCTCGGGTGCCAAGGAACTCCAG110710.11591886035771821RNA PCR Primer, Index 1 (100% over 29bp)
TGGAGTGTGACAATGGTGTTTGTTGGAATTCTCGGGTGCCAAGGAACTCC109690.11485086977362578RNA PCR Primer, Index 1 (100% over 27bp)
TTCAAGTAATCCAGGATAGGCTGGAATTCTCGGGTGCCAAGGAACTCCAG108690.1138038201813783RNA PCR Primer, Index 1 (100% over 29bp)
GTAGTTCAGCCTGAGCAATACAGCGAGACACAGTCTTTTGGAATTCTCGG108410.11351064629554902No Hit
TCACAGTGAACCGGTCTCTTTTGGAATTCTCGGGTGCCAAGGAACTCCAG108250.11334311836078942RNA PCR Primer, Index 1 (100% over 29bp)
AAGCTGCCAGCTGAAGAACTTGGAATTCTCGGGTGCCAAGGAACTCCAGT105280.1102333810718144RNA PCR Primer, Index 1 (100% over 30bp)
GTCGCTTGGAATTCTCGGGTGCCAAGGAACTCCAGTCACACTTGAATCTC104180.10908162652034219RNA PCR Primer, Index 8 (100% over 44bp)
TATTGCACTTGTCCCGGCCTGTTTGGAATTCTCGGGTGCCAAGGAACTCC102660.10749011114012602RNA PCR Primer, Index 1 (100% over 27bp)
TGAGATGAAGCACTGTAGCTTGGAATTCTCGGGTGCCAAGGAACTCCAGT102580.1074063471727462RNA PCR Primer, Index 1 (100% over 30bp)
TGAGGTAGTAGGTTGTATAGTTGGAATTCTCGGGTGCCAAGGAACTCCAG101390.10616035815797173RNA PCR Primer, Index 1 (100% over 29bp)
CTGTATAAGGTACATATGGTTGAGTGTCGTATGGAATTCTCGGGTGCCAA101080.10583577278437502No Hit
TTCAAGTAATCCAGGATAGGCTTTGGAATTCTCGGGTGCCAAGGAACTCC101000.1057520088169952RNA PCR Primer, Index 1 (100% over 27bp)
TACCGTGAAGAATATCACGTCTTTCGCTCCTATCTGATCTGGAATTCTCG100290.1050086036064995No Hit
TCCCTGGTGGTCTAGTGGTTAGGATTCGGCGCTCTCACCGCCGCGGCCCG99830.10452696079406565No Hit
AACTCTTAGCGGTGGATCACTCGGCTCGTGCGTCGATGAAGAACGCAGCT99630.10431755087561617No Hit
TCCCATATGGTCTAGCGGTTAGGATTCCTGGAATTCTCGGGTGCCAAGGA99250.10391967203056211RNA PCR Primer, Index 1 (100% over 22bp)
CATGGAATTCTCGGGTGCCAAGGAACTCCAGTCACACTTGAATCTCGTAT98880.10353226368143055RNA PCR Primer, Index 8 (100% over 48bp)
TACCCTGTAGAACCGAATTTGCGTGGAATTCTCGGGTGCCAAGGAACTCC98280.10290403392608208RNA PCR Primer, Index 1 (100% over 27bp)
TGAGGTAGTTGGTTGTATAGTTTGGAATTCTCGGGTGCCAAGGAACTCCA98060.10267368301578761RNA PCR Primer, Index 1 (100% over 28bp)
GCATTGGTGGTTCAGTGGTAGAATTCTCGCCTGCCATGGAATTCTCGGGT97950.1025585075606404No Hit
CGCCTGTCTGAGGGTCGCTTGGAATTCTCGGGTGCCAAGGAACTCCAGTC96750.10130204804994342RNA PCR Primer, Index 1 (100% over 31bp)

[FAIL]Adapter Content

Adapter graph

[FAIL]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
TAGTCCT302.5305762E-643.99770420
CGCGCTA254.4467983E-543.9974818
ATAGATA207.8624074E-443.99655516
TACGCGC650.043.99655516
TACGCAA1950.043.99402211
CCCCAAC254.4488603E-543.99402210
TAATCCG207.8646373E-443.9940227
GCATACA207.8646373E-443.9940226
GCATTAC10050.043.994026
AACATTC205250.043.9424251
TCAACGC182850.043.849666
TGACCTA538900.043.8459782
CTATGAA541700.043.8356556
TAGCTTA257550.043.833791
ACCTATG540850.043.8191384
CATCCCC47250.043.8078047
GCTTATC258500.043.79833
CCTATGA541950.043.795145
TTCAACG183150.043.7898455
CAACGCT183000.043.7896777