FastQCFastQC Report
Mon 5 Dec 2016
JG57_3_GGCTAC_L008_R1_001.fastq

Summary

[OK]Basic Statistics

MeasureValue
FilenameJG57_3_GGCTAC_L008_R1_001.fastq
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences11573653
Sequences flagged as poor quality0
Sequence length50
%GC52

[OK]Per base sequence quality

Per base quality graph

[OK]Per tile sequence quality

Per base quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[FAIL]Per base sequence content

Per base sequence content

[FAIL]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[OK]Sequence Length Distribution

Sequence length distribution

[FAIL]Sequence Duplication Levels

Duplication level graph

[FAIL]Overrepresented sequences

SequenceCountPercentagePossible Source
ATGACCTATGAATTGACAGCCTGGAATTCTCGGGTGCCAAGGAACTCCAG5344494.617807359525986RNA PCR Primer, Index 1 (100% over 29bp)
ATGACCTATGAATTGACAGCCATGGAATTCTCGGGTGCCAAGGAACTCCA4868144.206225985866347RNA PCR Primer, Index 1 (100% over 28bp)
TTCAAGTAATCCAGGATAGGCTTGGAATTCTCGGGTGCCAAGGAACTCCA4645094.013503774478119RNA PCR Primer, Index 1 (100% over 28bp)
CCTGTCTGAGGGTCGCTTGGAATTCTCGGGTGCCAAGGAACTCCAGTCAC3840963.3187101773312198RNA PCR Primer, Index 1 (100% over 33bp)
TTGCGGCCCCGGGTTCCTCCCGGGGCTACGCCTGTCTGAGGGTCGCTTGG2627002.269810577524659No Hit
TGAGGTAGTAGGTTGTATAGTTTGGAATTCTCGGGTGCCAAGGAACTCCA2613632.258258477250009RNA PCR Primer, Index 1 (100% over 28bp)
AAGCTGCCAGCTGAAGAACTGTTGGAATTCTCGGGTGCCAAGGAACTCCA2095231.810344581784161RNA PCR Primer, Index 1 (100% over 28bp)
TCAGTAACTGGAATCTGTCCCTTGGAATTCTCGGGTGCCAAGGAACTCCA2036411.7595222528271757RNA PCR Primer, Index 1 (100% over 28bp)
AACATTCAACGCTGTCGGTGAGTGGAATTCTCGGGTGCCAAGGAACTCCA1490651.2879684573228523RNA PCR Primer, Index 1 (100% over 28bp)
AACATTCAACGCTGTCGGTGAGTTGGAATTCTCGGGTGCCAAGGAACTCC1464111.2650370630603838RNA PCR Primer, Index 1 (100% over 27bp)
CTACGCCTGTCTGAGGGTCGCTTGGAATTCTCGGGTGCCAAGGAACTCCA1274391.1011130193725354RNA PCR Primer, Index 1 (100% over 28bp)
TATTGCACTTGTCCCGGCCTGTTGGAATTCTCGGGTGCCAAGGAACTCCA1220691.0547145313584223RNA PCR Primer, Index 1 (100% over 28bp)
TAGCTTATCAGACTGGTGTTGGCTGGAATTCTCGGGTGCCAAGGAACTCC1183341.0224429572927407RNA PCR Primer, Index 1 (100% over 27bp)
TGGAATTCTCGGGTGCCAAGGAACTCCAGTCACGGCTACATCTCGTATGC1064740.9199688292019814RNA PCR Primer, Index 11 (100% over 50bp)
TGTAAACATCCTTGACTGGAAGCTTGGAATTCTCGGGTGCCAAGGAACTC943320.8150581324669056RNA PCR Primer, Index 1 (100% over 26bp)
TGAGGTAGTAGTTTGTATAGTTTGGAATTCTCGGGTGCCAAGGAACTCCA919970.794882998479391RNA PCR Primer, Index 1 (100% over 28bp)
CTGTCTGAGGGTCGCTTGGAATTCTCGGGTGCCAAGGAACTCCAGTCACG845610.7306336210356401RNA PCR Primer, Index 6 (100% over 34bp)
GCATTGGTGGTTCAGTGGTAGAATTCTCGCCTGGAATTCTCGGGTGCCAA723420.6250576200962652No Hit
TGAGATGAAGCACTGTAGCTCTGGAATTCTCGGGTGCCAAGGAACTCCAG663670.5734317419055159RNA PCR Primer, Index 1 (100% over 29bp)
TGGAGTGTGACAATGGTGTTTGTGGAATTCTCGGGTGCCAAGGAACTCCA656780.5674785653241894RNA PCR Primer, Index 1 (100% over 28bp)
TGTAAACATCCTACACTCTCAGCTTGGAATTCTCGGGTGCCAAGGAACTC635900.5494375889790372RNA PCR Primer, Index 1 (100% over 26bp)
TGTCTGAGGGTCGCTTGGAATTCTCGGGTGCCAAGGAACTCCAGTCACGG627280.5419896380166228RNA PCR Primer, Index 2 (97% over 35bp)
TTCAAGTAATCCAGGATAGGTTTGGAATTCTCGGGTGCCAAGGAACTCCA604120.5219786700015976RNA PCR Primer, Index 1 (100% over 28bp)
GCATTGGTGGTTCAGTGGTAGAATTCTCGCCTTGGAATTCTCGGGTGCCA581670.5025811643048222No Hit
TCAGTAACTGGAATCTGTCCCTGCTGGAATTCTCGGGTGCCAAGGAACTC531570.4592931894536668RNA PCR Primer, Index 1 (100% over 26bp)
TGAGATGAAGCACTGTAGCTCTTGGAATTCTCGGGTGCCAAGGAACTCCA516880.44660056768593287RNA PCR Primer, Index 1 (100% over 28bp)
ACAGTAGTCTGCACATTGGTTTGGAATTCTCGGGTGCCAAGGAACTCCAG464170.40105747079163334RNA PCR Primer, Index 1 (100% over 29bp)
GCCCGGCTAGCTCAGTCGGTAGAGCATGAGACTCTGGAATTCTCGGGTGC462620.3997182220686934No Hit
AACCCGTAGATCCGAACTTGTGTGGAATTCTCGGGTGCCAAGGAACTCCA429220.37085957216792315RNA PCR Primer, Index 1 (100% over 28bp)
TCAGTAACTGGAATCTGTCCCTGTGGAATTCTCGGGTGCCAAGGAACTCC422970.36545937570445564RNA PCR Primer, Index 1 (100% over 27bp)
TTCACAGTGGCTAAGTTCTGCTGGAATTCTCGGGTGCCAAGGAACTCCAG417720.36092321067514294RNA PCR Primer, Index 1 (100% over 29bp)
GTTTCCGTAGTGTAGTGGTTATCACGTTCGCCTCTGGAATTCTCGGGTGC416950.3602579064708437No Hit
GGACAACTCTTAGCGGTGGAATTCTCGGGTGCCAAGGAACTCCAGTCACG411640.3556698995554817RNA PCR Primer, Index 6 (100% over 34bp)
GTTTCCGTAGTGTAGTGGTTATCACGTTCGCCTTGGAATTCTCGGGTGCC398230.3440832380234659No Hit
CCACGTTCCCGTGGTGGAATTCTCGGGTGCCAAGGAACTCCAGTCACGGC397330.34330560973272656RNA PCR Primer, Index 6 (97% over 36bp)
TTCACAGTGGCTAAGTTCTGTGGAATTCTCGGGTGCCAAGGAACTCCAGT394310.34069623480157907RNA PCR Primer, Index 1 (100% over 30bp)
CTGGACAACTCTTAGCGGTGGAATTCTCGGGTGCCAAGGAACTCCAGTCA384290.33203863983134796RNA PCR Primer, Index 1 (100% over 32bp)
TTCCAGTGATGACAGCCTATAATCTGACTTGGAATTCTCGGGTGCCAAGG378490.3270272575132501Illumina Small RNA Adapter 2 (100% over 21bp)
TACGCCTGTCTGAGGGTCGCTTGGAATTCTCGGGTGCCAAGGAACTCCAG361150.3120449524450059RNA PCR Primer, Index 1 (100% over 29bp)
TGTAAACATCCCCGACTGGAAGCTTGGAATTCTCGGGTGCCAAGGAACTC311680.26930131739736796RNA PCR Primer, Index 1 (100% over 26bp)
ATGACCTATGAATTGACAGCCATTGGAATTCTCGGGTGCCAAGGAACTCC311070.26877425822253354RNA PCR Primer, Index 1 (100% over 27bp)
AACATTCAACGCTGTCGGTGATGGAATTCTCGGGTGCCAAGGAACTCCAG308010.2661303220340199RNA PCR Primer, Index 1 (100% over 29bp)
TTCACAGTGGTTAAGTTCTGTGGAATTCTCGGGTGCCAAGGAACTCCAGT307650.26581927071772415RNA PCR Primer, Index 1 (100% over 30bp)
TGAGGTAGTAGATTGAATAGTTTGGAATTCTCGGGTGCCAAGGAACTCCA305970.2643676979083441RNA PCR Primer, Index 1 (100% over 28bp)
TCCAGTGATGACAGCCTATAATCTGACTTGGAATTCTCGGGTGCCAAGGA302300.26119670254499594RNA PCR Primer, Index 1 (100% over 22bp)
TGAGGTAGTAGGTTGTATAGTTTTGGAATTCTCGGGTGCCAAGGAACTCC295840.25561505948035596RNA PCR Primer, Index 1 (100% over 27bp)
TGAGGTAGTAGTTTGTGCTGTTTGGAATTCTCGGGTGCCAAGGAACTCCA294680.25461278301673634RNA PCR Primer, Index 1 (100% over 28bp)
TGAGGTAGTAGGTTGTATAGTTGGAATTCTCGGGTGCCAAGGAACTCCAG280510.24236945759476286RNA PCR Primer, Index 1 (100% over 29bp)
CATTGCACTTGTCTCGGTCTGATGGAATTCTCGGGTGCCAAGGAACTCCA278460.2405981931547455RNA PCR Primer, Index 1 (100% over 28bp)
GCATTGTGGTTCAGTGGTAGAATTCTCGCCTGGAATTCTCGGGTGCCAAG271320.23442900871488026No Hit
CATTATTACTTTTGGTACGCGTGGAATTCTCGGGTGCCAAGGAACTCCAG262360.22668728706485325RNA PCR Primer, Index 1 (100% over 29bp)
TGTAAACATCCTACACTCAGCTTGGAATTCTCGGGTGCCAAGGAACTCCA256900.22196967543436805RNA PCR Primer, Index 1 (100% over 28bp)
TCGTACCGTGAGTAATAATGCATGGAATTCTCGGGTGCCAAGGAACTCCA251940.21768407952096025RNA PCR Primer, Index 1 (100% over 28bp)
ACTGGACAACTCTTAGCGGTGGAATTCTCGGGTGCCAAGGAACTCCAGTC242150.20922521178058473RNA PCR Primer, Index 1 (100% over 31bp)
TGGAGTGTGACAATGGTGTTTGTTGGAATTCTCGGGTGCCAAGGAACTCC231190.19975542726224813RNA PCR Primer, Index 1 (100% over 27bp)
TATTGCACTTGTCCCGGCCTGTTTGGAATTCTCGGGTGCCAAGGAACTCC230380.19905556180058276RNA PCR Primer, Index 1 (100% over 27bp)
TGAGATGAAGCACTGTAGCTTGGAATTCTCGGGTGCCAAGGAACTCCAGT230160.1988654748850687RNA PCR Primer, Index 1 (100% over 30bp)
TTCAAGTAATCCAGGATAGGCTGGAATTCTCGGGTGCCAAGGAACTCCAG218040.1883934139031125RNA PCR Primer, Index 1 (100% over 29bp)
GCATTGTGGTTCAGTGGTAGAATTCTCGCCTTGGAATTCTCGGGTGCCAA209860.18132563677172628No Hit
TTCAAGTAATCCAGGATAGGCTTTGGAATTCTCGGGTGCCAAGGAACTCC209250.18079857759689186RNA PCR Primer, Index 1 (100% over 27bp)
TGTAAACATCCCCGACTGGAAGCTGGAATTCTCGGGTGCCAAGGAACTCC205010.1771350843160755RNA PCR Primer, Index 1 (100% over 27bp)
ATGACCTATGAATTGACAGCTGGAATTCTCGGGTGCCAAGGAACTCCAGT194720.1682442008586226RNA PCR Primer, Index 1 (100% over 30bp)
TAGCTTATCAGACTGGTGTTGGTGGAATTCTCGGGTGCCAAGGAACTCCA194500.16805411394310854RNA PCR Primer, Index 1 (100% over 28bp)
AGCCTGTGATGATACAAGTTATCCCTGTCTGAACTCTGGTGTGGAATTCT189080.16337106356998954No Hit
AACTGGACAACTCTTAGCGGTGGAATTCTCGGGTGCCAAGGAACTCCAGT184590.15949156243063448RNA PCR Primer, Index 1 (100% over 30bp)
TGGAGTGTGACAATGGTGTTTTGGAATTCTCGGGTGCCAAGGAACTCCAG182310.15752157076076154RNA PCR Primer, Index 1 (100% over 29bp)
CCTGTCTGAGGGTCGCTTTGGAATTCTCGGGTGCCAAGGAACTCCAGTCA182230.15745244824602914RNA PCR Primer, Index 1 (100% over 32bp)
TGTAAACATCCTTGACTGGAAGCTGGAATTCTCGGGTGCCAAGGAACTCC177610.15346062302023397RNA PCR Primer, Index 1 (100% over 27bp)
TTTTGCAGAAACGTTTCAGATTTGGAATTCTCGGGTGCCAAGGAACTCCA177120.15303724761749812RNA PCR Primer, Index 1 (100% over 28bp)
AGAGATGATGACTTCTGTTACCGCCCCAGTCTGAGAAGTCATGACTGATC174180.150496995201083No Hit
ACAGTAGTCTGCACATTGGTTATGGAATTCTCGGGTGCCAAGGAACTCCA167950.1451140793662986RNA PCR Primer, Index 1 (100% over 28bp)
TCCCTGGTGGTCTAGTGGTTAGGATTTGGCGCTCTGGAATTCTCGGGTGC167030.1443191704468762No Hit
GCATTGGTGGTTCAGTGGTAGAATTCTCGCCTGCTGGAATTCTCGGGTGC162180.14012861799122542No Hit
AAGCTGCCAGCTGAAGAACTTGGAATTCTCGGGTGCCAAGGAACTCCAGT159480.13779573311900745RNA PCR Primer, Index 1 (100% over 30bp)
GCCCGGCTAGCTCAGTCGGTAGAGCATGAGACTTGGAATTCTCGGGTGCC158760.137173630486416No Hit
TCACAGTGAACCGGTCTCTTTTGGAATTCTCGGGTGCCAAGGAACTCCAG154040.13309540211720536RNA PCR Primer, Index 1 (100% over 29bp)
TCGTACCGTGAGTAATAATGCTGGAATTCTCGGGTGCCAAGGAACTCCAG153440.13257698325671247RNA PCR Primer, Index 1 (100% over 29bp)
TGTAACAGCAACTCCATGTGGATGGAATTCTCGGGTGCCAAGGAACTCCA152090.1314105408206035RNA PCR Primer, Index 1 (100% over 28bp)
GAAGGATCATTATGGAATTCTCGGGTGCCAAGGAACTCCAGTCACGGCTA151540.13093532353181833RNA PCR Primer, Index 11 (100% over 38bp)
TATTGCACTTGTCCCGGCCTGTATGGAATTCTCGGGTGCCAAGGAACTCC148510.1283173082863293RNA PCR Primer, Index 1 (100% over 27bp)
TTCACAGTGGTTAAGTTCTGCTGGAATTCTCGGGTGCCAAGGAACTCCAG146870.12690029673431544RNA PCR Primer, Index 1 (100% over 29bp)
TGTTGCTGGAGAAAAAGTTACACCTCTGACCTGGAATTCTCGGGTGCCAA145420.12564745115479098No Hit
TCCCATATGGTCTAGCGGTTAGGATTCCTTGGAATTCTCGGGTGCCAAGG143960.12438596526092496Illumina Small RNA Adapter 2 (100% over 21bp)
AAGTTCTGTGATACACTCAGACTTGGAATTCTCGGGTGCCAAGGAACTCC141030.1218543531588514RNA PCR Primer, Index 1 (100% over 27bp)
TGTAAACATCCCCGACTGGATGGAATTCTCGGGTGCCAAGGAACTCCAGT138480.11965107300175666RNA PCR Primer, Index 1 (100% over 30bp)
TCCCTGGTGGTCTAGTGGTTAGGATTCGGCGCTCTGGAATTCTCGGGTGC136620.11804397453422874No Hit
CTTGCGGCCCCGGGTTCCTCCCGGGGCTACGCCTGTCTGAGGGTCGCTTG135610.11717130278573239No Hit
ATGACCTATGAATTGACAGCCTTGGAATTCTCGGGTGCCAAGGAACTCCA133680.11550372211781362RNA PCR Primer, Index 1 (100% over 28bp)
CCTCGATCCAAGTTTTTGTTGGAATTCTCGGGTGCCAAGGAACTCCAGTC131920.11398302679370119RNA PCR Primer, Index 1 (100% over 31bp)
TGAGGTAGTTGTTTGTACAGTTTGGAATTCTCGGGTGCCAAGGAACTCCA131190.11335228384676817RNA PCR Primer, Index 1 (100% over 28bp)
TTCAGTGATGTTTGACAAATGTCTGACCTGAACTGCAATGTGGACAGATC130280.1125660152416873No Hit
AACATTCATTGCTGTCGGTGGGTGGAATTCTCGGGTGCCAAGGAACTCCA129400.11180566757963108RNA PCR Primer, Index 1 (100% over 28bp)
GTTTCCGTAGTGTAGTGGTTATCACGTTCGCCTGGAATTCTCGGGTGCCA127970.11057010262878972No Hit
TGTAAACATCCTTGACTGGAAGCTTGGACTTCTCGGGTGCCAAGGAACTC127150.10986159685278278RNA PCR Primer, Index 1 (96% over 26bp)
TACCCTGTAGAACCGAATTTGCGTGGAATTCTCGGGTGCCAAGGAACTCC127120.10983567590975814RNA PCR Primer, Index 1 (100% over 27bp)
GATCCATGATGACATTAAAACATAACGTGACTGTTGGATGAAGCTTGCGG125780.1086778737879907No Hit
TGGACAACTCTTAGCGGTGGAATTCTCGGGTGCCAAGGAACTCCAGTCAC124640.10769287795305424RNA PCR Primer, Index 1 (100% over 33bp)
TAACGGAACCCATAATGCAGCTGTGGAATTCTCGGGTGCCAAGGAACTCC123270.10650915488826217RNA PCR Primer, Index 1 (100% over 27bp)
TGAGGTAGTAAGTTGTGTTGTTTGGAATTCTCGGGTGCCAAGGAACTCCA121920.10534271245215318RNA PCR Primer, Index 1 (100% over 28bp)
TCAGTGCATTACAGAACTTTGTTGGAATTCTCGGGTGCCAAGGAACTCCA121670.10512670459361446RNA PCR Primer, Index 1 (100% over 28bp)
ATCCATGATGACATTAAAACATAACGTGACTGTTGGATGAAGCTTGCGGA120820.1043922778745829No Hit
TGTAAACATCCTACACTCTCAGCTGGAATTCTCGGGTGCCAAGGAACTCC120100.10377017524199143RNA PCR Primer, Index 1 (100% over 27bp)
TCCTCCCGGGGCTACGCCTGTCTGAGGGTCGCTTGGAATTCTCGGGTGCC119360.1031307919807169No Hit
CCGTCGAGCAGCATTCCGGGCTTCACATCGGAGGGCTCCAGCCGGCCCCG119070.10288022286481201No Hit
CGCCTGTCTGAGGGTCGCTTGGAATTCTCGGGTGCCAAGGAACTCCAGTC116170.10037453170576309RNA PCR Primer, Index 1 (100% over 31bp)

[FAIL]Adapter Content

Adapter graph

[WARN]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
CACAGTA207.8227365E-444.041851
CGCGCTA302.5297195E-643.9999918
TATATTA700.043.9999913
CCTAAAT207.859456E-443.9999916
TACGCGA454.802132E-1043.9999916
ATATATT700.043.9999912
GTATCAT1150.043.9999918
CGCGTTT3950.043.99998516
ATATTAG650.043.99998514
CGACCTA408.3291525E-943.9973262
AACATTC394650.043.9972081
CATACTA351.4484976E-743.99656320
GAGTGCG254.447514E-543.9963765
TTATATC551.8189894E-1243.99637610
TTCCCTA750.043.9963763
CATAGTC2150.043.9963764
AACGCTA207.862634E-443.9963766
ACGCTAC207.862634E-443.9963767
CTATTCC750.043.99637610
TAAATCG408.3291525E-943.9963764