FastQCFastQC Report
Mon 5 Dec 2016
JG58_1_AGTCAA_L007_R1_001.fastq

Summary

[OK]Basic Statistics

MeasureValue
FilenameJG58_1_AGTCAA_L007_R1_001.fastq
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences21487722
Sequences flagged as poor quality0
Sequence length50
%GC50

[OK]Per base sequence quality

Per base quality graph

[WARN]Per tile sequence quality

Per base quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[FAIL]Per base sequence content

Per base sequence content

[FAIL]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[OK]Sequence Length Distribution

Sequence length distribution

[FAIL]Sequence Duplication Levels

Duplication level graph

[FAIL]Overrepresented sequences

SequenceCountPercentagePossible Source
AACATTCAACGCTGTCGGTGAGTGGAATTCTCGGGTGCCAAGGAACTCCA15069307.012981645983693RNA PCR Primer, Index 1 (100% over 28bp)
AACATTCAACGCTGTCGGTGAGTTGGAATTCTCGGGTGCCAAGGAACTCC13370986.222614011852908RNA PCR Primer, Index 1 (100% over 27bp)
TTCAAGTAATCCAGGATAGGCTTGGAATTCTCGGGTGCCAAGGAACTCCA10397204.838670195007177RNA PCR Primer, Index 1 (100% over 28bp)
TCACAGTGAACCGGTCTCTTTTGGAATTCTCGGGTGCCAAGGAACTCCAG6983283.249893125013438RNA PCR Primer, Index 1 (100% over 29bp)
TGAGGTAGTAGGTTGTATAGTTTGGAATTCTCGGGTGCCAAGGAACTCCA3843261.7885841970591392RNA PCR Primer, Index 1 (100% over 28bp)
AACATTCAACGCTGTCGGTGATGGAATTCTCGGGTGCCAAGGAACTCCAG3673321.7094971723852346RNA PCR Primer, Index 1 (100% over 29bp)
TCCCTGAGACCCTTAACCTGTGTGGAATTCTCGGGTGCCAAGGAACTCCA2181491.015226276661621RNA PCR Primer, Index 1 (100% over 28bp)
TAAAGCTAGAGAACCGAAAGTATGGAATTCTCGGGTGCCAAGGAACTCCA2031270.9453165859089204RNA PCR Primer, Index 1 (100% over 28bp)
TTAAAGGGAATTTGCGACTGTTTGGAATTCTCGGGTGCCAAGGAACTCCA2012190.9364370964963155RNA PCR Primer, Index 1 (100% over 28bp)
CCTGTCTGAGGGTCGCTTGGAATTCTCGGGTGCCAAGGAACTCCAGTCAC1958770.9115763876692001RNA PCR Primer, Index 1 (100% over 33bp)
TCCCTGAGACCCTTAACCTGTGATGGAATTCTCGGGTGCCAAGGAACTCC1811480.8430302663074288RNA PCR Primer, Index 1 (100% over 27bp)
TAGCTTATCAGACTGGTGTTGGCTGGAATTCTCGGGTGCCAAGGAACTCC1653020.7692858275065174RNA PCR Primer, Index 1 (100% over 27bp)
TCTTTGGTTATCTAGCTGTATGATGGAATTCTCGGGTGCCAAGGAACTCC1645870.765958345887014RNA PCR Primer, Index 1 (100% over 27bp)
TCTTTGGTTATCTAGCTGTATTGGAATTCTCGGGTGCCAAGGAACTCCAG1490170.6934983615294352RNA PCR Primer, Index 1 (100% over 29bp)
AAGCTGCCAGCTGAAGAACTGTTGGAATTCTCGGGTGCCAAGGAACTCCA1390190.6469694647017492RNA PCR Primer, Index 1 (100% over 28bp)
AACATTCATTGCTGTCGGTGGGTGGAATTCTCGGGTGCCAAGGAACTCCA1372820.638885778585557RNA PCR Primer, Index 1 (100% over 28bp)
TTCACAGTGGCTAAGTTCTGCTGGAATTCTCGGGTGCCAAGGAACTCCAG1339440.6233513259339449RNA PCR Primer, Index 1 (100% over 29bp)
AACATTCATTGCTGTCGGTGGGTTGGAATTCTCGGGTGCCAAGGAACTCC1331990.6198842297010357RNA PCR Primer, Index 1 (100% over 27bp)
TCACAGTGAACCGGTCTCTTTTTGGAATTCTCGGGTGCCAAGGAACTCCA1316430.6126428850857248RNA PCR Primer, Index 1 (100% over 28bp)
TTGCATAGTCACAAAAGTGATCTGGAATTCTCGGGTGCCAAGGAACTCCA1314700.6118377741484183RNA PCR Primer, Index 1 (100% over 28bp)
TGAGGTAGTAGTTTGTGCTGTTTGGAATTCTCGGGTGCCAAGGAACTCCA1311740.6104602432961485RNA PCR Primer, Index 1 (100% over 28bp)
TCCAGCATCAGTGATTTTGTTGTGGAATTCTCGGGTGCCAAGGAACTCCA1148350.5344214710149359RNA PCR Primer, Index 1 (100% over 28bp)
TATTGCACTCGTCCCGGCCTCCTGGAATTCTCGGGTGCCAAGGAACTCCA1127860.5248857929193239RNA PCR Primer, Index 1 (100% over 28bp)
TCACAGTGAACCGGTCTCTTTGGAATTCTCGGGTGCCAAGGAACTCCAGT1088740.5066800473312155RNA PCR Primer, Index 1 (100% over 30bp)
TGAGGTAGTAGTTTGTATAGTTTGGAATTCTCGGGTGCCAAGGAACTCCA1010230.4701429030029335RNA PCR Primer, Index 1 (100% over 28bp)
TCTTTGGTTATCTAGCTGTATGTGGAATTCTCGGGTGCCAAGGAACTCCA1000970.465833465269143RNA PCR Primer, Index 1 (100% over 28bp)
TACCCTGTAGAACCGAATTTGTTGGAATTCTCGGGTGCCAAGGAACTCCA998040.46446989587821363RNA PCR Primer, Index 1 (100% over 28bp)
TACCCTGTAGAACCGAATGTGTTGGAATTCTCGGGTGCCAAGGAACTCCA947900.4411356401576677RNA PCR Primer, Index 1 (100% over 28bp)
AGCTGGTGTTGTGAATCAGGCCGTGGAATTCTCGGGTGCCAAGGAACTCC937000.4360629758705925RNA PCR Primer, Index 1 (100% over 27bp)
TCCAGCATCAGTGATTTTGTTTGGAATTCTCGGGTGCCAAGGAACTCCAG916920.42671810441330166RNA PCR Primer, Index 1 (100% over 29bp)
TTCACAGTGGCTAAGTTCTGTGGAATTCTCGGGTGCCAAGGAACTCCAGT903580.4205099079371931RNA PCR Primer, Index 1 (100% over 30bp)
TTCCCTTTGTCATCCTATGCCTGTGGAATTCTCGGGTGCCAAGGAACTCC864540.4023413929126596RNA PCR Primer, Index 1 (100% over 27bp)
TAACAGTCTACAGTCATGGCTTGGAATTCTCGGGTGCCAAGGAACTCCAG862030.4011732839804983RNA PCR Primer, Index 1 (100% over 29bp)
AGCTACATCTGGCTACTGGGTCTCTGGAATTCTCGGGTGCCAAGGAACTC857010.39883706611617553RNA PCR Primer, Index 1 (100% over 26bp)
CCCTGAGACCCTTAACCTGTGATGGAATTCTCGGGTGCCAAGGAACTCCA851810.39641707948380944RNA PCR Primer, Index 1 (100% over 28bp)
ACCTTGGCTTTAGACTGCTTACTTGGAATTCTCGGGTGCCAAGGAACTCC843020.3923263713110212RNA PCR Primer, Index 1 (100% over 27bp)
TAAAGCTAGAGAACCGAAAGTTGGAATTCTCGGGTGCCAAGGAACTCCAG840200.39101399394500735RNA PCR Primer, Index 1 (100% over 29bp)
TACCCTGTAGATCCGGATTTGTTGGAATTCTCGGGTGCCAAGGAACTCCA828850.3857319077378235RNA PCR Primer, Index 1 (100% over 28bp)
TCCCTGAGACCCTAACTTGTGATGGAATTCTCGGGTGCCAAGGAACTCCA810220.3770618402453271RNA PCR Primer, Index 1 (100% over 28bp)
TAAAGGGAATTTGCGACTGTTTGGAATTCTCGGGTGCCAAGGAACTCCAG800800.3726779413843868RNA PCR Primer, Index 1 (100% over 29bp)
CTGTCTGAGGGTCGCTTGGAATTCTCGGGTGCCAAGGAACTCCAGTCACA795590.3702533009315739RNA PCR Primer, Index 1 (100% over 34bp)
CTACGCCTGTCTGAGGGTCGCTTGGAATTCTCGGGTGCCAAGGAACTCCA792440.3687873474908136RNA PCR Primer, Index 1 (100% over 28bp)
AACCCGTAGATCCGAACTTGTGTGGAATTCTCGGGTGCCAAGGAACTCCA791100.3681637355509346RNA PCR Primer, Index 1 (100% over 28bp)
TCCCTGAGACCCTTAACCTGTTGGAATTCTCGGGTGCCAAGGAACTCCAG706200.3286527999571104RNA PCR Primer, Index 1 (100% over 29bp)
TATTGCACTTGTCCCGGCCTGTTGGAATTCTCGGGTGCCAAGGAACTCCA644480.29992942015910296RNA PCR Primer, Index 1 (100% over 28bp)
TGAGGTAGTTGGTTGTATAGTTTGGAATTCTCGGGTGCCAAGGAACTCCA591960.27548755517220486RNA PCR Primer, Index 1 (100% over 28bp)
TCTTTGGTTATCTAGCTGTATGTTGGAATTCTCGGGTGCCAAGGAACTCC591030.27505474987064704RNA PCR Primer, Index 1 (100% over 27bp)
AAGCTGCCAGCTGAAGAACTTGGAATTCTCGGGTGCCAAGGAACTCCAGT587060.27320718315324444RNA PCR Primer, Index 1 (100% over 30bp)
AAGCTGCCAGTTGAAGAGCTGTTGGAATTCTCGGGTGCCAAGGAACTCCA571320.26588206976989RNA PCR Primer, Index 1 (100% over 28bp)
TGTCTGAGGGTCGCTTGGAATTCTCGGGTGCCAAGGAACTCCAGTCACAG557100.25926433709445795RNA PCR Primer, Index 2 (97% over 35bp)
TACCCTGTAGAACCGAATTTGCGTGGAATTCTCGGGTGCCAAGGAACTCC550800.2563324302129374RNA PCR Primer, Index 1 (100% over 27bp)
TGAGGTAGTAGGTTGTATAGTTGGAATTCTCGGGTGCCAAGGAACTCCAG523150.2434646166773751RNA PCR Primer, Index 1 (100% over 29bp)
TAGCAGCACGTAAATATTGGAGTGGAATTCTCGGGTGCCAAGGAACTCCA522670.24324123329592592RNA PCR Primer, Index 1 (100% over 28bp)
TGTAAACATCCTTGACTGGAAGCTTGGAATTCTCGGGTGCCAAGGAACTC509890.2372936507648414RNA PCR Primer, Index 1 (100% over 26bp)
TTCAAGTAATCCAGGATAGGTTTGGAATTCTCGGGTGCCAAGGAACTCCA502500.2338544774546134RNA PCR Primer, Index 1 (100% over 28bp)
CCACGTTCCCGTGGTGGAATTCTCGGGTGCCAAGGAACTCCAGTCACAGT446980.2080164663336579RNA PCR Primer, Index 8 (97% over 36bp)
AACATTCAACGCTGTCGGTGGTGGAATTCTCGGGTGCCAAGGAACTCCAG443370.20633643715234218RNA PCR Primer, Index 1 (100% over 29bp)
TTCAAGTAATCCAGGATAGGCTTTGGAATTCTCGGGTGCCAAGGAACTCC440600.20504732888856253RNA PCR Primer, Index 1 (100% over 27bp)
TTCAAGTAATCCAGGATAGGCTGGAATTCTCGGGTGCCAAGGAACTCCAG439080.20433994818064008RNA PCR Primer, Index 1 (100% over 29bp)
AGAATAATGCCAGCAGTCGGTCTGGAATTCTCGGGTGCCAAGGAACTCCA431070.20061223800270683RNA PCR Primer, Index 1 (100% over 28bp)
TACCCTGTAGAACCGAATTTGCTGGAATTCTCGGGTGCCAAGGAACTCCA424820.1977036002234206RNA PCR Primer, Index 1 (100% over 28bp)
TGTAAACATCCTACACTCTCAGCTTGGAATTCTCGGGTGCCAAGGAACTC417780.1944273106288326RNA PCR Primer, Index 1 (100% over 26bp)
TACCCTGTAGATCCGGATTTGTGTGGAATTCTCGGGTGCCAAGGAACTCC416930.19403173589084965RNA PCR Primer, Index 1 (100% over 27bp)
ACCATCGACCGTTGACTGTACCTGGAATTCTCGGGTGCCAAGGAACTCCA395760.18417959800485134RNA PCR Primer, Index 1 (100% over 28bp)
AGCTACATCTGGCTACTGGGTCTTGGAATTCTCGGGTGCCAAGGAACTCC395220.183928291700721RNA PCR Primer, Index 1 (100% over 27bp)
CCTTTCTGAGGGTCGCTTGGAATTCTCGGGTGCCAAGGAACTCCAGTCAC389850.18142919012075828RNA PCR Primer, Index 1 (100% over 33bp)
TTGCATAGTCACAAAAATGAGCTGGAATTCTCGGGTGCCAAGGAACTCCA378230.1760214507615093RNA PCR Primer, Index 1 (100% over 28bp)
ACCGTGGCTTTAGATTGTTACTTGGAATTCTCGGGTGCCAAGGAACTCCA363110.16898487424586003RNA PCR Primer, Index 1 (100% over 28bp)
TGAGATGAAGCACTGTAGCTCTTGGAATTCTCGGGTGCCAAGGAACTCCA342610.15944454232980118RNA PCR Primer, Index 1 (100% over 28bp)
TGAGATGAAGCACTGTAGCTCTGGAATTCTCGGGTGCCAAGGAACTCCAG342230.15926769715282058RNA PCR Primer, Index 1 (100% over 29bp)
TAGCTTATCAGACTGGTGTTGGTGGAATTCTCGGGTGCCAAGGAACTCCA341370.15886746859439077RNA PCR Primer, Index 1 (100% over 28bp)
AACATTCATTGCTGTCGGTGGGTTTGGAATTCTCGGGTGCCAAGGAACTC339200.1578575895574226RNA PCR Primer, Index 1 (100% over 26bp)
AAGGTCCAACCTCACATGTCCTTGGAATTCTCGGGTGCCAAGGAACTCCA335170.15598209991733886RNA PCR Primer, Index 1 (100% over 28bp)
ACCATCGACCGTTGACTGTGCCTGGAATTCTCGGGTGCCAAGGAACTCCA329610.1533945757488858RNA PCR Primer, Index 1 (100% over 28bp)
AACATTCAACGCTGTCGGTGAGTTTGGAATTCTCGGGTGCCAAGGAACTC328090.1526871950409634RNA PCR Primer, Index 1 (100% over 26bp)
TGATGTAGTAGGTTGTATAGTTTGGAATTCTCGGGTGCCAAGGAACTCCA326020.1517238542084638RNA PCR Primer, Index 1 (100% over 28bp)
CTTTGGTTATCTAGCTGTATGATGGAATTCTCGGGTGCCAAGGAACTCCA314090.14617184641536224RNA PCR Primer, Index 1 (100% over 28bp)
AGCAGCATTGTACAGGGCTATGATGGAATTCTCGGGTGCCAAGGAACTCC311950.1451759288397346RNA PCR Primer, Index 1 (100% over 27bp)
TTCCCTTTGTCATCCTATGCCTTGGAATTCTCGGGTGCCAAGGAACTCCA311870.14513869827615977RNA PCR Primer, Index 1 (100% over 28bp)
TAAATCTAGAGAACCGAAAGTATGGAATTCTCGGGTGCCAAGGAACTCCA297980.13867454167547402RNA PCR Primer, Index 1 (100% over 28bp)
GTTTCCGTAGTGTAGTGGTTATCACGTTCGCCTCTGGAATTCTCGGGTGC297790.13858611908698373No Hit
TCCCTGAGACCCTTAACCTGTGGTGGAATTCTCGGGTGCCAAGGAACTCC295160.13736216430946008RNA PCR Primer, Index 1 (100% over 27bp)
AACATTCAACGCTGTCGGTGAGATGGAATTCTCGGGTGCCAAGGAACTCC291490.1356542122054632RNA PCR Primer, Index 1 (100% over 27bp)
CCTGTCTGAGGGTCGCTTGGAATTCTCGGGTGCCCAGGAACTCCAGTCAC288810.13440698832570527RNA PCR Primer, Index 1 (96% over 33bp)
TGAGGTAGTTGGTTGTATTGTTTGGAATTCTCGGGTGCCAAGGAACTCCA288780.13439302686436466RNA PCR Primer, Index 1 (100% over 28bp)
GCATTGGTGGTTCAGTGGTAGAATTCTCGCCTTGGAATTCTCGGGTGCCA286980.13355533918393026No Hit
CATTATTACTTTTGGTACGCGTGGAATTCTCGGGTGCCAAGGAACTCCAG281160.13084681568385892RNA PCR Primer, Index 1 (100% over 29bp)
TGAGGTAGTAGGTTGTATAGTTTTGGAATTCTCGGGTGCCAAGGAACTCC279780.13020458846219252RNA PCR Primer, Index 1 (100% over 27bp)
TAACAGTCTACAGCCATGGTCGTGGAATTCTCGGGTGCCAAGGAACTCCA274180.12759844901195203RNA PCR Primer, Index 1 (100% over 28bp)
CCTTGGCTTTAGACTGCTTACTTGGAATTCTCGGGTGCCAAGGAACTCCA264570.12312612756252152RNA PCR Primer, Index 1 (100% over 28bp)
AACAGTCAACGCTGTCGGTGAGTGGAATTCTCGGGTGCCAAGGAACTCCA259860.12093417813205141RNA PCR Primer, Index 1 (100% over 28bp)
CAGGCTGGTTAGATGGTTGTCTTGGAATTCTCGGGTGCCAAGGAACTCCA252220.11737865931065192RNA PCR Primer, Index 1 (100% over 28bp)
TTTGTTGGAATTCTCGGGTGCCAAGGAACTCCAGTCACAGTCAAATCTCG250830.11673177826853866RNA PCR Primer, Index 13 (100% over 45bp)
AATATTCAACGCTGTCGGTGAGTGGAATTCTCGGGTGCCAAGGAACTCCA249220.11598251317659451RNA PCR Primer, Index 1 (100% over 28bp)
AAGCCCTTACCCCAAAAAGCATTGGAATTCTCGGGTGCCAAGGAACTCCA248290.11554970787503673RNA PCR Primer, Index 1 (100% over 28bp)
GTACAGTACTGTGATAACTGATGGAATTCTCGGGTGCCAAGGAACTCCAG238270.11088657978728504RNA PCR Primer, Index 1 (100% over 29bp)
AACATTCAACGCTGTCGGTGTGGAATTCTCGGGTGCCAAGGAACTCCAGT237030.11030950605187465RNA PCR Primer, Index 1 (100% over 30bp)
TAAGGCACGCGGTGAATGCCTGGAATTCTCGGGTGCCAAGGAACTCCAGT236990.11029089077008722RNA PCR Primer, Index 1 (100% over 30bp)
AGCTACATTGTCTGCTGGGTTTTGGAATTCTCGGGTGCCAAGGAACTCCA236100.10987670075031684RNA PCR Primer, Index 1 (100% over 28bp)
TACAGTACTGTGATAACTGAAGTGGAATTCTCGGGTGCCAAGGAACTCCA234630.10919258914462873RNA PCR Primer, Index 1 (100% over 28bp)
TACCCTGTAGAACCGAATGTGTGTGGAATTCTCGGGTGCCAAGGAACTCC228910.10653060384902596RNA PCR Primer, Index 1 (100% over 27bp)
TTTTTGTTGGAATTCTCGGGTGCCAAGGAACTCCAGTCACAGTCAAATCT228760.10646079654232309RNA PCR Primer, Index 13 (100% over 43bp)
TCCCTGAGACCCTAACTTGTGTGGAATTCTCGGGTGCCAAGGAACTCCAG228420.10630256664712993RNA PCR Primer, Index 1 (100% over 29bp)
AACAGTCAACGCTGTCGGTGAGTTGGAATTCTCGGGTGCCAAGGAACTCC226480.1053997254804395RNA PCR Primer, Index 1 (100% over 27bp)
AATATTCAACGCTGTCGGTGAGTTGGAATTCTCGGGTGCCAAGGAACTCC223330.10393377203967921RNA PCR Primer, Index 1 (100% over 27bp)
AGCTACATTGTCTGCTGGGTTTCTGGAATTCTCGGGTGCCAAGGAACTCC218700.10177905317278396RNA PCR Primer, Index 1 (100% over 27bp)

[FAIL]Adapter Content

Adapter graph

[FAIL]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
TATATGC454.7293724E-1044.074851
CACGACG207.794087E-444.074851
AACATTC4288350.044.0440181
TAACGTA254.4484324E-543.9950523
ACTCATA254.4484324E-543.9950523
AACGTAT5450.043.9935217
AATATGT207.8653014E-443.99351516
TATGCAT254.449899E-543.9925965
GCCGTTA600.043.9925965
TACGCAA3400.043.99249611
ACGGGTC1600.043.99249310
GTACCCC254.44996E-543.9924911
ATCGTAA600.043.992498
TTCAAGT1370900.043.9398161
CATTCAA3855650.043.914613
TTCAACG3973750.043.912335
ACCGGTC1188300.043.9110510
TCCCTGA728850.043.908551
TCAACGC4044000.043.906666
ATTCAAC3915050.043.89564