FastQCFastQC Report
Mon 5 Dec 2016
JG62_3_ATGTCA_L004_R1_001.fastq

Summary

[OK]Basic Statistics

MeasureValue
FilenameJG62_3_ATGTCA_L004_R1_001.fastq
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences12485151
Sequences flagged as poor quality0
Sequence length50
%GC52

[OK]Per base sequence quality

Per base quality graph

[OK]Per tile sequence quality

Per base quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[FAIL]Per base sequence content

Per base sequence content

[FAIL]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[OK]Sequence Length Distribution

Sequence length distribution

[FAIL]Sequence Duplication Levels

Duplication level graph

[FAIL]Overrepresented sequences

SequenceCountPercentagePossible Source
TTGCGGCCCCGGGTTCCTCCCGGGGCTACGCCTGTCTGAGGGTCGCTTGG5454884.369094134304023No Hit
ATGACCTATGAATTGACAGCCTGGAATTCTCGGGTGCCAAGGAACTCCAG5125984.105661197049199RNA PCR Primer, Index 1 (100% over 29bp)
ATGACCTATGAATTGACAGCCATGGAATTCTCGGGTGCCAAGGAACTCCA4709013.771688464160346RNA PCR Primer, Index 1 (100% over 28bp)
TTCAAGTAATCCAGGATAGGCTTGGAATTCTCGGGTGCCAAGGAACTCCA3547842.841647650076479RNA PCR Primer, Index 1 (100% over 28bp)
CCTGTCTGAGGGTCGCTTGGAATTCTCGGGTGCCAAGGAACTCCAGTCAC3406322.728296998570542RNA PCR Primer, Index 1 (100% over 33bp)
TGAGGTAGTAGGTTGTATAGTTTGGAATTCTCGGGTGCCAAGGAACTCCA2657542.1285605596600314RNA PCR Primer, Index 1 (100% over 28bp)
AAGCTGCCAGCTGAAGAACTGTTGGAATTCTCGGGTGCCAAGGAACTCCA1603501.2843256761572208RNA PCR Primer, Index 1 (100% over 28bp)
TAGCTTATCAGACTGGTGTTGGCTGGAATTCTCGGGTGCCAAGGAACTCC1483981.1885959569091316RNA PCR Primer, Index 1 (100% over 27bp)
CTACGCCTGTCTGAGGGTCGCTTGGAATTCTCGGGTGCCAAGGAACTCCA1396721.118704931962777RNA PCR Primer, Index 1 (100% over 28bp)
TCAGTAACTGGAATCTGTCCCTTGGAATTCTCGGGTGCCAAGGAACTCCA1341781.0747006584061338RNA PCR Primer, Index 1 (100% over 28bp)
TATTGCACTTGTCCCGGCCTGTTGGAATTCTCGGGTGCCAAGGAACTCCA1289141.0325385732219017RNA PCR Primer, Index 1 (100% over 28bp)
AACATTCAACGCTGTCGGTGAGTTGGAATTCTCGGGTGCCAAGGAACTCC1237880.9914818010611165RNA PCR Primer, Index 1 (100% over 27bp)
AACATTCAACGCTGTCGGTGAGTGGAATTCTCGGGTGCCAAGGAACTCCA1209970.9691272456376379RNA PCR Primer, Index 1 (100% over 28bp)
GCTTACGGCCTGGAATTCTCGGGTGCCAAGGAACTCCAGTCACATGTCAA1116690.8944144928643634RNA PCR Primer, Index 15 (100% over 40bp)
GATCCATGATGACATTAAAACATAACGTGACTGTTGGATGAAGCTTGCGG1090500.8734375739628619No Hit
TGTAAACATCCTTGACTGGAAGCTTGGAATTCTCGGGTGCCAAGGAACTC904780.7246848676479763RNA PCR Primer, Index 1 (100% over 26bp)
ATCCATGATGACATTAAAACATAACGTGACTGTTGGATGAAGCTTGCGGA898780.7198791588503816No Hit
CCGTCGAGCAGCATTCCGGGCTTCACATCGGAGGGCTCCAGCCGGCCCCG842380.67470549615299No Hit
TGAGGTAGTAGTTTGTATAGTTTGGAATTCTCGGGTGCCAAGGAACTCCA832030.666415648477139RNA PCR Primer, Index 1 (100% over 28bp)
GCATTGGTGGTTCAGTGGTAGAATTCTCGCCTTGGAATTCTCGGGTGCCA801390.6418744955507547No Hit
CTGTCTGAGGGTCGCTTGGAATTCTCGGGTGCCAAGGAACTCCAGTCACA793560.6356030455698933RNA PCR Primer, Index 1 (100% over 34bp)
GTTTCCGTAGTGTAGTGGTTATCACGTTCGCCTTGGAATTCTCGGGTGCC768710.6156994016331881No Hit
TGTCTGAGGGTCGCTTGGAATTCTCGGGTGCCAAGGAACTCCAGTCACAT748580.5995762486172574RNA PCR Primer, Index 1 (100% over 35bp)
AGAGATGATGACTTCTGTTACCGCCCCAGTCTGAGAAGTCATGACTGATC656840.5260969611020324No Hit
GTTTCCGTAGTGTAGTGGTTATCACGTTCGCCTCTGGAATTCTCGGGTGC617430.4945314638164969No Hit
GCATTGGTGGTTCAGTGGTAGAATTCTCGCCTGGAATTCTCGGGTGCCAA608620.4874750813986951No Hit
TTCAGTGATGTTTGACAAATGTCTGACCTGAACTGCAATGTGGACAGATC566630.4538431293301939No Hit
CCTGTCTGAGGGTCGCTTGGAATTCTCGGGTGCCCAGGAACTCCAGTCAC561940.4500866669534073RNA PCR Primer, Index 1 (96% over 33bp)
TGGAGTGTGACAATGGTGTTTGTGGAATTCTCGGGTGCCAAGGAACTCCA561120.4494298867510693RNA PCR Primer, Index 1 (100% over 28bp)
TGTAAACATCCTACACTCTCAGCTTGGAATTCTCGGGTGCCAAGGAACTC550130.44062743013680816RNA PCR Primer, Index 1 (100% over 26bp)
GCCCGGCTAGCTCAGTCGGTAGAGCATGAGACTCTGGAATTCTCGGGTGC547980.4389053844843367No Hit
TTCAAGTAATCCAGGATAGGTTTGGAATTCTCGGGTGCCAAGGAACTCCA531560.42575376140825205RNA PCR Primer, Index 1 (100% over 28bp)
TTCACAGTGGCTAAGTTCTGCTGGAATTCTCGGGTGCCAAGGAACTCCAG501360.40156502712702474RNA PCR Primer, Index 1 (100% over 29bp)
CTTCGAACGCACCTTGCGGCCCCGGGTTCCTCCCGGGGCTACGCCTGTCT473680.3793946905407872No Hit
TTCACAGTGGCTAAGTTCTGTGGAATTCTCGGGTGCCAAGGAACTCCAGT459810.36828549370368047RNA PCR Primer, Index 1 (100% over 30bp)
TGAGATGAAGCACTGTAGCTCTGGAATTCTCGGGTGCCAAGGAACTCCAG450120.3605242739955648RNA PCR Primer, Index 1 (100% over 29bp)
TACGCCTGTCTGAGGGTCGCTTGGAATTCTCGGGTGCCAAGGAACTCCAG408250.3269884361030155RNA PCR Primer, Index 1 (100% over 29bp)
TCAGTAACTGGAATCTGTCCCTGCTGGAATTCTCGGGTGCCAAGGAACTC404880.3242892296616997RNA PCR Primer, Index 1 (100% over 26bp)
CCACGTTCCCGTGGTGGAATTCTCGGGTGCCAAGGAACTCCAGTCACATG397560.318426264928634RNA PCR Primer, Index 15 (100% over 36bp)
ACAGTAGTCTGCACATTGGTTTGGAATTCTCGGGTGCCAAGGAACTCCAG376240.30134997966784705RNA PCR Primer, Index 1 (100% over 29bp)
CTGGACAACTCTTAGCGGTGGAATTCTCGGGTGCCAAGGAACTCCAGTCA355670.2848744080067594RNA PCR Primer, Index 1 (100% over 32bp)
CTTGCGGCCCCGGGTTCCTCCCGGGGCTACGCCTGTCTGAGGGTCGCTTG343060.2747744100171476No Hit
TTCACAGTGGTTAAGTTCTGTGGAATTCTCGGGTGCCAAGGAACTCCAGT342840.2745982006945691RNA PCR Primer, Index 1 (100% over 30bp)
TGTAAACATCCCCGACTGGAAGCTTGGAATTCTCGGGTGCCAAGGAACTC340780.27294824067406154RNA PCR Primer, Index 1 (100% over 26bp)
GTTACATGATGAAACATGTGTTGGTAGGGACATCTGAATGAATGTGATGA339650.27204316551718116No Hit
TCCCTGGTGGTCTAGTGGTTAGGATTTGGCGCTCTGGAATTCTCGGGTGC339290.27175482298932546No Hit
TGCCTGTGATGAGACTCTCGACGGGCGGACTGAATGGGTTTTCACCCTCC333790.2673495899248635No Hit
TCCCTGGTGGTCTAGTGGTTAGGATTCGGCGCTCTGGAATTCTCGGGTGC316710.2536693388810436No Hit
AACCCGTAGATCCGAACTTGTGTGGAATTCTCGGGTGCCAAGGAACTCCA311870.24979273378431704RNA PCR Primer, Index 1 (100% over 28bp)
TCAGTAACTGGAATCTGTCCCTGTGGAATTCTCGGGTGCCAAGGAACTCC310960.24906386795001517RNA PCR Primer, Index 1 (100% over 27bp)
TAAGATGATGATTAACTCACCATCTTTCGGCTGAAGAATGATGTATACTC304850.2441700544911311No Hit
GGACAACTCTTAGCGGTGGAATTCTCGGGTGCCAAGGAACTCCAGTCACA304360.24377758827266086RNA PCR Primer, Index 1 (100% over 34bp)
TGAGGTAGTAGATTGAATAGTTTGGAATTCTCGGGTGCCAAGGAACTCCA303240.24288052263044313RNA PCR Primer, Index 1 (100% over 28bp)
TGAGATGAAGCACTGTAGCTCTTGGAATTCTCGGGTGCCAAGGAACTCCA290780.2329006673607712RNA PCR Primer, Index 1 (100% over 28bp)
TGAGGTAGTAGGTTGTATAGTTTTGGAATTCTCGGGTGCCAAGGAACTCC273590.219132311655662RNA PCR Primer, Index 1 (100% over 27bp)
ATGACCTATGAATTGACAGCCATTGGAATTCTCGGGTGCCAAGGAACTCC271350.2173381803712266RNA PCR Primer, Index 1 (100% over 27bp)
CATTGCACTTGTCTCGGTCTGATGGAATTCTCGGGTGCCAAGGAACTCCA266020.21306910905602985RNA PCR Primer, Index 1 (100% over 28bp)
CATTATTACTTTTGGTACGCGTGGAATTCTCGGGTGCCAAGGAACTCCAG257500.20624500256344516RNA PCR Primer, Index 1 (100% over 29bp)
TGAGGTAGTAGGTTGTATAGTTGGAATTCTCGGGTGCCAAGGAACTCCAG254080.20350574854881612RNA PCR Primer, Index 1 (100% over 29bp)
TCGTACCGTGAGTAATAATGCATGGAATTCTCGGGTGCCAAGGAACTCCA249280.19966118151074022RNA PCR Primer, Index 1 (100% over 28bp)
ACTGGACAACTCTTAGCGGTGGAATTCTCGGGTGCCAAGGAACTCCAGTC242750.19443096843602453RNA PCR Primer, Index 1 (100% over 31bp)
CCTTGCGGCCCCGGGTTCCTCCCGGGGCTACGCCTGTCTGAGGGTCGCTT242200.19399044512957833No Hit
GCATTGTGGTTCAGTGGTAGAATTCTCGCCTTGGAATTCTCGGGTGCCAA241140.19314143657533658No Hit
TCGCTGCGATCCATTGAAAGTCAGCCCTCGATCCAAGTTTTTGTTGGAAT239700.1919880664639138No Hit
TTACATGATGAAACATGTGTTGGTAGGGACATCTGAATGAATGTGATGAA237760.19043422061935816No Hit
TAGCTTATCAGACTGGTGTTGGTGGAATTCTCGGGTGCCAAGGAACTCCA233000.1866216916399329RNA PCR Primer, Index 1 (100% over 28bp)
GCCCGGCTAGCTCAGTCGGTAGAGCATGAGACTTGGAATTCTCGGGTGCC231990.18581273065900444No Hit
AACATTCAACGCTGTCGGTGATGGAATTCTCGGGTGCCAAGGAACTCCAG225040.18024611796845708RNA PCR Primer, Index 1 (100% over 29bp)
GCATTGTGGTTCAGTGGTAGAATTCTCGCCTGGAATTCTCGGGTGCCAAG223120.17870829115322673No Hit
TTCCAGTGATGACAGCCTATAATCTGACTTGGAATTCTCGGGTGCCAAGG204300.16363438455810425Illumina Small RNA Adapter 2 (100% over 21bp)
TATTGCACTTGTCCCGGCCTGTTTGGAATTCTCGGGTGCCAAGGAACTCC202170.16192835793495808RNA PCR Primer, Index 1 (100% over 27bp)
TTGCGGCCCCGGGTTCCTCCCGGGGCTACGCCTGTCTGAGGGTCGCTTTG201950.16175214861237963No Hit
TCCCATATGGTCTAGCGGTTAGGATTCCTTGGAATTCTCGGGTGCCAAGG198790.15922114197897969Illumina Small RNA Adapter 2 (100% over 21bp)
TGAGGTAGTAGTTTGTGCTGTTTGGAATTCTCGGGTGCCAAGGAACTCCA197420.1581238384701955RNA PCR Primer, Index 1 (100% over 28bp)
TACACTGATGACTTCTTAGGACACCTTTGGATTCTTGATGAAAACAAATT197040.1578194769130145No Hit
TGTAAACATCCTACACTCAGCTTGGAATTCTCGGGTGCCAAGGAACTCCA194810.15603335514324176RNA PCR Primer, Index 1 (100% over 28bp)
TGGAGTGTGACAATGGTGTTTGTTGGAATTCTCGGGTGCCAAGGAACTCC192660.1543113094907703RNA PCR Primer, Index 1 (100% over 27bp)
TCCCTGTGGTCTAGTGGTTAGGATTTGGCGCTCTGGAATTCTCGGGTGCC189140.15149196032951465No Hit
GTTTCCGTAGTGTAGTGGTTATCACGTTCGCCTGGAATTCTCGGGTGCCA186070.14903303932807863No Hit
GCTTACGGCCTGGAATTCTCGGGTGCCACGGAACTCCAGTCACATGTCAA182400.1460935474468831RNA PCR Primer, Index 15 (97% over 40bp)
TGGAATTCTCGGGTGCCAAGGAACTCCAGTCACATGTCAATCTCGTATGC181450.14533264355393058RNA PCR Primer, Index 15 (100% over 50bp)
TCCGAATGATGAAATGTTGTTGATCTCTGTAGTAACCACGGTTACAGTGA177520.142184904291506No Hit
CTCGCTGCGATCCATTGAAAGTCAGCCCTCGATCCAAGTTTTTGTTGGAA176750.14156817166248128No Hit
CAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACT176030.1409914866067699No Hit
TTCACAGTGGTTAAGTTCTGCTGGAATTCTCGGGTGCCAAGGAACTCCAG175440.1405189252416731RNA PCR Primer, Index 1 (100% over 29bp)
AACTGGACAACTCTTAGCGGTGGAATTCTCGGGTGCCAAGGAACTCCAGT173210.13873280347190034RNA PCR Primer, Index 1 (100% over 30bp)
GCATTGGTGGTTCAGTGGTAGAATTCTCGCCTGCTGGAATTCTCGGGTGC172370.13806000424023704No Hit
TCCCTGTGGTCTAGTGGTTAGGATTCGGCGCTCTGGAATTCTCGGGTGCC171920.13769957608041744No Hit
TCGTACCGTGAGTAATAATGCTGGAATTCTCGGGTGCCAAGGAACTCCAG171320.13721900520065797RNA PCR Primer, Index 1 (100% over 29bp)
CACCGTCGAGCAGCATTCCGGGCTTCACATCGGAGGGCTCCAGCCGGCCC165280.1323812583444125No Hit
TGTAAACATCCCCGACTGGAAGCTGGAATTCTCGGGTGCCAAGGAACTCC164970.1321329633898701RNA PCR Primer, Index 1 (100% over 27bp)
TAACGGAACCCATAATGCAGCTGTGGAATTCTCGGGTGCCAAGGAACTCC162360.13004248006291633RNA PCR Primer, Index 1 (100% over 27bp)
ATCCATGATGACATTAAAACATAACGTGCCTGTTGGATGAAGCTTGCGGA156740.1255411328225025No Hit
CATGGCTGATGACCTTTGATGCGTTAGACTTCTGATTTAAAAATGAAGTC156600.1254289996172253No Hit
ATGACCTATGAATTGACAGCTGGAATTCTCGGGTGCCAAGGAACTCCAGT156020.12496444776679114RNA PCR Primer, Index 1 (100% over 30bp)
GAAGGATCATTATGGAATTCTCGGGTGCCAAGGAACTCCAGTCACATGTC154380.12365088736211521RNA PCR Primer, Index 15 (100% over 38bp)
ACAGTAGTCTGCACATTGGTTATGGAATTCTCGGGTGCCAAGGAACTCCA152760.12235334598676459RNA PCR Primer, Index 1 (100% over 28bp)
TTCAAGTAATCCAGGATAGGCTGGAATTCTCGGGTGCCAAGGAACTCCAG151700.12150433743252284RNA PCR Primer, Index 1 (100% over 29bp)
AGCCTGTGATGATACAAGTTATCCCTGTCTGAACTCTGGTGTGGAATTCT149670.11987840595600326No Hit
TGAGATGAAGCACTGTAGCTTGGAATTCTCGGGTGCCAAGGAACTCCAGT147440.11809228418623052RNA PCR Primer, Index 1 (100% over 30bp)
TCCAGTGATGACAGCCTATAATCTGACTTGGAATTCTCGGGTGCCAAGGA144580.1158015629927103RNA PCR Primer, Index 1 (100% over 22bp)
CCTGTCTGAGGGTCGCTTTGGAATTCTCGGGTGCCAAGGAACTCCAGTCA143400.11485644026251664RNA PCR Primer, Index 1 (100% over 32bp)
TGAGAACTGAATTCCATAGATGGTGGAATTCTCGGGTGCCAAGGAACTCC143100.11461615482263691RNA PCR Primer, Index 1 (100% over 27bp)
CACCTTGCGGCCCCGGGTTCCTCCCGGGGCTACGCCTGTCTGAGGGTCGC142240.11392733656164832No Hit
TGTAAACATCCTTGACTGGAAGCTTGGACTTCTCGGGTGCCAAGGAACTC141860.11362297500446732RNA PCR Primer, Index 1 (96% over 26bp)
CGCCTGTCTGAGGGTCGCTTGGAATTCTCGGGTGCCAAGGAACTCCAGTC141140.11304628994875593RNA PCR Primer, Index 1 (100% over 31bp)
TGTAAACATCCTTGACTGGAAGCTGGAATTCTCGGGTGCCAAGGAACTCC140630.11263780470096035RNA PCR Primer, Index 1 (100% over 27bp)
TTTTGCAGAAACGTTTCAGATTTGGAATTCTCGGGTGCCAAGGAACTCCA140210.11230140508512873RNA PCR Primer, Index 1 (100% over 28bp)
TTTGTTGGAATTCTCGGGTGCCAAGGAACTCCAGTCACATGTCAATCTCG135780.10875319008957121RNA PCR Primer, Index 15 (100% over 45bp)
TTCAAGTAATCCAGGATAGGCTTTGGAATTCTCGGGTGCCAAGGAACTCC133290.10675882093856934RNA PCR Primer, Index 1 (100% over 27bp)
AAGCTGCCAGCTGAAGAACTTGGAATTCTCGGGTGCCAAGGAACTCCAGT133150.10664668773329213RNA PCR Primer, Index 1 (100% over 30bp)
ACCGTCGAGCAGCATTCCGGGCTTCACATCGGAGGGCTCCAGCCGGCCCC132920.10646246889605099No Hit
TGGCTGTGATGAGAAACTTGCCCTCACTGAAACGTGATTGAGACATCTTT132850.1064064022934124No Hit
TTCACAGTGGTTAAGTTCTGCCTGGAATTCTCGGGTGCCAAGGAACTCCA129740.10391544323332573RNA PCR Primer, Index 1 (100% over 28bp)
AAGTTCTGTGATACACTCAGACTTGGAATTCTCGGGTGCCAAGGAACTCC129550.10376326245473523RNA PCR Primer, Index 1 (100% over 27bp)
TCAAAGGTTGTGGGTTCGTGTCCCACCGGAGTCGCCATGGAATTCTCGGG129370.10361909119080738No Hit
CCTCGATCCAAGTTTTTGTTGGAATTCTCGGGTGCCAAGGAACTCCAGTC129050.10336278672160232RNA PCR Primer, Index 1 (100% over 31bp)
TGAGGTAGTAAGTTGTGTTGTTTGGAATTCTCGGGTGCCAAGGAACTCCA128610.10301036807644538RNA PCR Primer, Index 1 (100% over 28bp)
TACCGTGAAGAATATCACGTCTTTCGCTCCTATCTGATCTGGAATTCTCG126860.10160870301048021No Hit
TATTGCACTTGTCCCGGCCTGTATGGAATTCTCGGGTGCCAAGGAACTCC125910.10084779911752768RNA PCR Primer, Index 1 (100% over 27bp)

[FAIL]Adapter Content

Adapter graph

[FAIL]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
ACCCCTA351.4368197E-744.041941
TGACATA800.043.996782
GCTATGT1250.043.99466717
CTATAGG5750.043.99413312
ATAGGCA3050.043.9932616
ATTAGGT700.043.99325616
CGAGTAA302.5324716E-643.993083
ATAATCC254.4495006E-543.993086
CTATAGT502.7284841E-1143.993085
ATATCGT408.3346094E-943.993085
CATACAA207.86556E-443.993083
AGTAACG254.4495006E-543.993083
GCATACA207.86556E-443.993086
CCCTATT351.4494071E-743.9930763
CCTAAGA351.4494071E-743.9930765
CTACGAA551.8189894E-1243.9930766
AACATTC316100.043.9513741
GCTTACG151200.043.881731
TTCAACG294200.043.8809285
TCAGTAA241850.043.8780441