FastQCFastQC Report
Mon 5 Dec 2016
JG64_1_GATCAG_L007_R1_001.fastq

Summary

[OK]Basic Statistics

MeasureValue
FilenameJG64_1_GATCAG_L007_R1_001.fastq
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences14066197
Sequences flagged as poor quality0
Sequence length50
%GC51

[OK]Per base sequence quality

Per base quality graph

[WARN]Per tile sequence quality

Per base quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[FAIL]Per base sequence content

Per base sequence content

[FAIL]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[OK]Sequence Length Distribution

Sequence length distribution

[FAIL]Sequence Duplication Levels

Duplication level graph

[FAIL]Overrepresented sequences

SequenceCountPercentagePossible Source
AACATTCAACGCTGTCGGTGAGTGGAATTCTCGGGTGCCAAGGAACTCCA11741348.347202872247559RNA PCR Primer, Index 1 (100% over 28bp)
AACATTCAACGCTGTCGGTGAGTTGGAATTCTCGGGTGCCAAGGAACTCC9931487.060529580241198RNA PCR Primer, Index 1 (100% over 27bp)
TTCAAGTAATCCAGGATAGGCTTGGAATTCTCGGGTGCCAAGGAACTCCA6119954.3508206233710505RNA PCR Primer, Index 1 (100% over 28bp)
TCACAGTGAACCGGTCTCTTTTGGAATTCTCGGGTGCCAAGGAACTCCAG5423833.8559320618074664RNA PCR Primer, Index 1 (100% over 29bp)
AACATTCAACGCTGTCGGTGATGGAATTCTCGGGTGCCAAGGAACTCCAG2902392.063379319939853RNA PCR Primer, Index 1 (100% over 29bp)
TGAGGTAGTAGGTTGTATAGTTTGGAATTCTCGGGTGCCAAGGAACTCCA2252181.6011292888902382RNA PCR Primer, Index 1 (100% over 28bp)
TCCCTGAGACCCTTAACCTGTGTGGAATTCTCGGGTGCCAAGGAACTCCA1400860.9959052898235393RNA PCR Primer, Index 1 (100% over 28bp)
TTAAAGGGAATTTGCGACTGTTTGGAATTCTCGGGTGCCAAGGAACTCCA1400270.995485844539217RNA PCR Primer, Index 1 (100% over 28bp)
TAGCTTATCAGACTGGTGTTGGCTGGAATTCTCGGGTGCCAAGGAACTCC1382660.982966469188509RNA PCR Primer, Index 1 (100% over 27bp)
AGCTACATCTGGCTACTGGGTCTCTGGAATTCTCGGGTGCCAAGGAACTC1368620.9729850932700573RNA PCR Primer, Index 1 (100% over 26bp)
CCTGTCTGAGGGTCGCTTGGAATTCTCGGGTGCCAAGGAACTCCAGTCAC1335970.9497734177901818RNA PCR Primer, Index 1 (100% over 33bp)
TAAAGCTAGAGAACCGAAAGTATGGAATTCTCGGGTGCCAAGGAACTCCA1329800.9453870154100643RNA PCR Primer, Index 1 (100% over 28bp)
TCCCTGAGACCCTTAACCTGTGATGGAATTCTCGGGTGCCAAGGAACTCC1237950.8800886266558048RNA PCR Primer, Index 1 (100% over 27bp)
TCTTTGGTTATCTAGCTGTATGATGGAATTCTCGGGTGCCAAGGAACTCC1100020.7820308502717542RNA PCR Primer, Index 1 (100% over 27bp)
AACATTCATTGCTGTCGGTGGGTGGAATTCTCGGGTGCCAAGGAACTCCA1098880.7812203966715382RNA PCR Primer, Index 1 (100% over 28bp)
TTGCATAGTCACAAAAGTGATCTGGAATTCTCGGGTGCCAAGGAACTCCA1015610.7220217376452214RNA PCR Primer, Index 1 (100% over 28bp)
AACATTCATTGCTGTCGGTGGGTTGGAATTCTCGGGTGCCAAGGAACTCC1008470.7169457387807096RNA PCR Primer, Index 1 (100% over 27bp)
AAGCTGCCAGCTGAAGAACTGTTGGAATTCTCGGGTGCCAAGGAACTCCA974050.6924757274478667RNA PCR Primer, Index 1 (100% over 28bp)
TCACAGTGAACCGGTCTCTTTTTGGAATTCTCGGGTGCCAAGGAACTCCA927730.6595457180075041RNA PCR Primer, Index 1 (100% over 28bp)
TCTTTGGTTATCTAGCTGTATTGGAATTCTCGGGTGCCAAGGAACTCCAG858660.6104421827733537RNA PCR Primer, Index 1 (100% over 29bp)
TCACAGTGAACCGGTCTCTTTGGAATTCTCGGGTGCCAAGGAACTCCAGT831320.5910055148523798RNA PCR Primer, Index 1 (100% over 30bp)
TTCCCTTTGTCATCCTATGCCTGTGGAATTCTCGGGTGCCAAGGAACTCC818800.5821047437342162RNA PCR Primer, Index 1 (100% over 27bp)
TGAGGTAGTAGTTTGTGCTGTTTGGAATTCTCGGGTGCCAAGGAACTCCA747560.5314585029628122RNA PCR Primer, Index 1 (100% over 28bp)
TTCACAGTGGCTAAGTTCTGCTGGAATTCTCGGGTGCCAAGGAACTCCAG739550.5257640000349775RNA PCR Primer, Index 1 (100% over 29bp)
TATTGCACTCGTCCCGGCCTCCTGGAATTCTCGGGTGCCAAGGAACTCCA720930.5125265912314466RNA PCR Primer, Index 1 (100% over 28bp)
AGCTGGTGTTGTGAATCAGGCCGTGGAATTCTCGGGTGCCAAGGAACTCC682410.4851417906346684RNA PCR Primer, Index 1 (100% over 27bp)
TCTTTGGTTATCTAGCTGTATGTGGAATTCTCGGGTGCCAAGGAACTCCA661950.4705962812834201RNA PCR Primer, Index 1 (100% over 28bp)
ACCTTGGCTTTAGACTGCTTACTTGGAATTCTCGGGTGCCAAGGAACTCC630930.44854341226701144RNA PCR Primer, Index 1 (100% over 27bp)
TGAGGTAGTAGTTTGTATAGTTTGGAATTCTCGGGTGCCAAGGAACTCCA600480.42689577005071094RNA PCR Primer, Index 1 (100% over 28bp)
AACCCGTAGATCCGAACTTGTGTGGAATTCTCGGGTGCCAAGGAACTCCA578530.4112909836254959RNA PCR Primer, Index 1 (100% over 28bp)
TAAAGGGAATTTGCGACTGTTTGGAATTCTCGGGTGCCAAGGAACTCCAG573640.40781456423509493RNA PCR Primer, Index 1 (100% over 29bp)
TTCACAGTGGCTAAGTTCTGTGGAATTCTCGGGTGCCAAGGAACTCCAGT559940.39807490254828654RNA PCR Primer, Index 1 (100% over 30bp)
TCCAGCATCAGTGATTTTGTTGTGGAATTCTCGGGTGCCAAGGAACTCCA558550.39708671789539135RNA PCR Primer, Index 1 (100% over 28bp)
TAACAGTCTACAGTCATGGCTTGGAATTCTCGGGTGCCAAGGAACTCCAG544410.3870342495558679RNA PCR Primer, Index 1 (100% over 29bp)
TAAAGCTAGAGAACCGAAAGTTGGAATTCTCGGGTGCCAAGGAACTCCAG540260.3840839140813967RNA PCR Primer, Index 1 (100% over 29bp)
CTACGCCTGTCTGAGGGTCGCTTGGAATTCTCGGGTGCCAAGGAACTCCA510030.36259267519145366RNA PCR Primer, Index 1 (100% over 28bp)
TATTGCACTTGTCCCGGCCTGTTGGAATTCTCGGGTGCCAAGGAACTCCA501920.35682707984254736RNA PCR Primer, Index 1 (100% over 28bp)
CTGTCTGAGGGTCGCTTGGAATTCTCGGGTGCCAAGGAACTCCAGTCACG501540.3565569286424753RNA PCR Primer, Index 6 (100% over 34bp)
AGCTACATCTGGCTACTGGGTCTTGGAATTCTCGGGTGCCAAGGAACTCC500540.35584600443175934RNA PCR Primer, Index 1 (100% over 27bp)
TCCCTGAGACCCTAACTTGTGATGGAATTCTCGGGTGCCAAGGAACTCCA496050.35265395472564476RNA PCR Primer, Index 1 (100% over 28bp)
CCCTGAGACCCTTAACCTGTGATGGAATTCTCGGGTGCCAAGGAACTCCA481960.34263703259665707RNA PCR Primer, Index 1 (100% over 28bp)
AAGCTGCCAGCTGAAGAACTTGGAATTCTCGGGTGCCAAGGAACTCCAGT444460.31597737469480913RNA PCR Primer, Index 1 (100% over 30bp)
TCCCTGAGACCCTTAACCTGTTGGAATTCTCGGGTGCCAAGGAACTCCAG391850.27857565196904327RNA PCR Primer, Index 1 (100% over 29bp)
TGAGGTAGTTGGTTGTATAGTTTGGAATTCTCGGGTGCCAAGGAACTCCA389810.2771253665791827RNA PCR Primer, Index 1 (100% over 28bp)
TGTCTGAGGGTCGCTTGGAATTCTCGGGTGCCAAGGAACTCCAGTCACGA372510.26482637773379686RNA PCR Primer, Index 7 (97% over 35bp)
AACATTCAACGCTGTCGGTGGTGGAATTCTCGGGTGCCAAGGAACTCCAG371830.26434294927051RNA PCR Primer, Index 1 (100% over 29bp)
TCCAGCATCAGTGATTTTGTTTGGAATTCTCGGGTGCCAAGGAACTCCAG365010.25949444615342726RNA PCR Primer, Index 1 (100% over 29bp)
TGTAAACATCCTTGACTGGAAGCTTGGAATTCTCGGGTGCCAAGGAACTC362620.2577953372898162RNA PCR Primer, Index 1 (100% over 26bp)
TCTTTGGTTATCTAGCTGTATGTTGGAATTCTCGGGTGCCAAGGAACTCC350330.24905807874011718RNA PCR Primer, Index 1 (100% over 27bp)
CCACGTTCCCGTGGTGGAATTCTCGGGTGCCAAGGAACTCCAGTCACGAT326280.23196035147239868RNA PCR Primer, Index 9 (100% over 36bp)
TAGCAGCACGTAAATATTGGAGTGGAATTCTCGGGTGCCAAGGAACTCCA321910.22885361267156998RNA PCR Primer, Index 1 (100% over 28bp)
TGCTCAGTAGTCAGTGTAGATCCTGGAATTCTCGGGTGCCAAGGAACTCC304440.2164337667103624RNA PCR Primer, Index 1 (100% over 27bp)
AGAATAATGCCAGCAGTCGGTCTGGAATTCTCGGGTGCCAAGGAACTCCA297750.21167768374067275RNA PCR Primer, Index 1 (100% over 28bp)
ACCGTGGCTTTAGATTGTTACTTGGAATTCTCGGGTGCCAAGGAACTCCA283680.2016749800958994RNA PCR Primer, Index 1 (100% over 28bp)
ACCATCGACCGTTGACTGTGCCTGGAATTCTCGGGTGCCAAGGAACTCCA282690.20097116512729063RNA PCR Primer, Index 1 (100% over 28bp)
ACCATCGACCGTTGACTGTACCTGGAATTCTCGGGTGCCAAGGAACTCCA279050.19838340100028456RNA PCR Primer, Index 1 (100% over 28bp)
TGAGATGAAGCACTGTAGCTCTGGAATTCTCGGGTGCCAAGGAACTCCAG278370.19789997253699776RNA PCR Primer, Index 1 (100% over 29bp)
TGAGGTAGTAGGTTGTATAGTTGGAATTCTCGGGTGCCAAGGAACTCCAG275050.19553970415742078RNA PCR Primer, Index 1 (100% over 29bp)
TTGCATAGTCACAAAAATGAGCTGGAATTCTCGGGTGCCAAGGAACTCCA266300.18931911731365628RNA PCR Primer, Index 1 (100% over 28bp)
AGCTACATTGTCTGCTGGGTTTTGGAATTCTCGGGTGCCAAGGAACTCCA265770.1889423274819768RNA PCR Primer, Index 1 (100% over 28bp)
AACATTCATTGCTGTCGGTGGGTTTGGAATTCTCGGGTGCCAAGGAACTC261180.18567918535479064RNA PCR Primer, Index 1 (100% over 26bp)
AAGGTCCAACCTCACATGTCCTTGGAATTCTCGGGTGCCAAGGAACTCCA256950.18267197594346218RNA PCR Primer, Index 1 (100% over 28bp)
TTCAAGTAATCCAGGATAGGTTTGGAATTCTCGGGTGCCAAGGAACTCCA255650.18174777446953147RNA PCR Primer, Index 1 (100% over 28bp)
AGCTACATTGTCTGCTGGGTTTCTGGAATTCTCGGGTGCCAAGGAACTCC255260.18147051402735223RNA PCR Primer, Index 1 (100% over 27bp)
TTCAAGTAATCCAGGATAGGCTGGAATTCTCGGGTGCCAAGGAACTCCAG252850.1797571866795268RNA PCR Primer, Index 1 (100% over 29bp)
TAGCTTATCAGACTGGTGTTGGTGGAATTCTCGGGTGCCAAGGAACTCCA252600.17957945562684782RNA PCR Primer, Index 1 (100% over 28bp)
CCTTTCTGAGGGTCGCTTGGAATTCTCGGGTGCCAAGGAACTCCAGTCAC252070.1792026657951684RNA PCR Primer, Index 1 (100% over 33bp)
TGTAAACATCCTACACTCTCAGCTTGGAATTCTCGGGTGCCAAGGAACTC251680.17892540535298915RNA PCR Primer, Index 1 (100% over 26bp)
TACCCTGTAGAACCGAATGTGTTGGAATTCTCGGGTGCCAAGGAACTCCA251370.1787050188476672RNA PCR Primer, Index 1 (100% over 28bp)
AAGCTGCCAGTTGAAGAGCTGTTGGAATTCTCGGGTGCCAAGGAACTCCA247000.17559828004683853RNA PCR Primer, Index 1 (100% over 28bp)
ATCTACATCTGGCTACTGGGTCTCTGGAATTCTCGGGTGCCAAGGAACTC237110.16856723960285783RNA PCR Primer, Index 1 (100% over 26bp)
AGCAGCATTGTACAGGGCTATGATGGAATTCTCGGGTGCCAAGGAACTCC232670.16541073610727902RNA PCR Primer, Index 1 (100% over 27bp)
AACATTCAACGCTGTCGGTGAGTTTGGAATTCTCGGGTGCCAAGGAACTC231850.16482777825449196RNA PCR Primer, Index 1 (100% over 26bp)
TTCAAGTAATCCAGGATAGGCTTTGGAATTCTCGGGTGCCAAGGAACTCC224950.15992240120055193RNA PCR Primer, Index 1 (100% over 27bp)
TGCTCAGTAGTCAGTGTAGATCTGGAATTCTCGGGTGCCAAGGAACTCCA224850.15985130877948034RNA PCR Primer, Index 1 (100% over 28bp)
CCTGTCTGAGGGTCGCTTGGAATTCTCGGGTGCCCAGGAACTCCAGTCAC224370.15951006515833668RNA PCR Primer, Index 1 (96% over 33bp)
TGAGATGAAGCACTGTAGCTCTTGGAATTCTCGGGTGCCAAGGAACTCCA217580.1546828897675754RNA PCR Primer, Index 1 (100% over 28bp)
TCCCTGAGACCCTTAACCTGTGGTGGAATTCTCGGGTGCCAAGGAACTCC212910.15136287370353194RNA PCR Primer, Index 1 (100% over 27bp)
TAACAGTCTACAGCCATGGTCGTGGAATTCTCGGGTGCCAAGGAACTCCA211890.1506377310086017RNA PCR Primer, Index 1 (100% over 28bp)
AACATTCAACGCTGTCGGTGAGATGGAATTCTCGGGTGCCAAGGAACTCC196690.1398316830057193RNA PCR Primer, Index 1 (100% over 27bp)
TTCCCTTTGTCATCCTATGCCTTGGAATTCTCGGGTGCCAAGGAACTCCA194130.1380117170262865RNA PCR Primer, Index 1 (100% over 28bp)
CATTATTACTTTTGGTACGCGTGGAATTCTCGGGTGCCAAGGAACTCCAG189390.1346419362674929RNA PCR Primer, Index 1 (100% over 29bp)
CCTTGGCTTTAGACTGCTTACTTGGAATTCTCGGGTGCCAAGGAACTCCA189050.13440022203584948RNA PCR Primer, Index 1 (100% over 28bp)
AATATTCAACGCTGTCGGTGAGTGGAATTCTCGGGTGCCAAGGAACTCCA187580.13335516344609707RNA PCR Primer, Index 1 (100% over 28bp)
AACAGTCAACGCTGTCGGTGAGTGGAATTCTCGGGTGCCAAGGAACTCCA184990.13151386974034276RNA PCR Primer, Index 1 (100% over 28bp)
CTTTGGTTATCTAGCTGTATGATGGAATTCTCGGGTGCCAAGGAACTCCA183970.13078872704541247RNA PCR Primer, Index 1 (100% over 28bp)
GCATTGGTGGTTCAGTGGTAGAATTCTCGCCTTGGAATTCTCGGGTGCCA183950.13077450856119816No Hit
TGAGGTAGTTGGTTGTATTGTTTGGAATTCTCGGGTGCCAAGGAACTCCA181450.12899719803440832RNA PCR Primer, Index 1 (100% over 28bp)
AGCTACATCTGGCTACTGGGTCTCTTGGAATTCTCGGGTGCCAAGGAACT178220.1267009128337958RNA PCR Primer, Index 1 (100% over 25bp)
GTTTCCGTAGTGTAGTGGTTATCACGTTCGCCTCTGGAATTCTCGGGTGC177410.1261250642231159No Hit
AACATTCAACGCTGTCGGTGTGGAATTCTCGGGTGCCAAGGAACTCCAGT175770.12495914851754174RNA PCR Primer, Index 1 (100% over 30bp)
TAAATCTAGAGAACCGAAAGTATGGAATTCTCGGGTGCCAAGGAACTCCA174570.1241060394646826RNA PCR Primer, Index 1 (100% over 28bp)
CAGGCTGGTTAGATGGTTGTCTTGGAATTCTCGGGTGCCAAGGAACTCCA174210.12385010674882486RNA PCR Primer, Index 1 (100% over 28bp)
AAGCTGCCAGCTGAAGAACTGCTGGAATTCTCGGGTGCCAAGGAACTCCA166190.11814849457888299RNA PCR Primer, Index 1 (100% over 28bp)
TGATGTAGTAGGTTGTATAGTTTGGAATTCTCGGGTGCCAAGGAACTCCA165460.11762951990506035RNA PCR Primer, Index 1 (100% over 28bp)
TGTAAACATCCCCGACTGGAAGCTTGGAATTCTCGGGTGCCAAGGAACTC161670.1149351171464469RNA PCR Primer, Index 1 (100% over 26bp)
AAGCCCTTACCCCAAAAAGCATTGGAATTCTCGGGTGCCAAGGAACTCCA160190.11388294931458731RNA PCR Primer, Index 1 (100% over 28bp)
AATATTCAACGCTGTCGGTGAGTTGGAATTCTCGGGTGCCAAGGAACTCC158130.11241844544051245RNA PCR Primer, Index 1 (100% over 27bp)
AACAGTCAACGCTGTCGGTGAGTTGGAATTCTCGGGTGCCAAGGAACTCC156170.1110250339875092RNA PCR Primer, Index 1 (100% over 27bp)
CACCACGTTCCCGTGGTGGAATTCTCGGGTGCCAAGGAACTCCAGTCACG154490.10983068131350641RNA PCR Primer, Index 6 (100% over 34bp)
CTTTTTGCGGTCTGGGCTTGCTGGAATTCTCGGGTGCCAAGGAACTCCAG153410.10906288316593318RNA PCR Primer, Index 1 (100% over 29bp)
TATGGCTTTTTATTCCTATCTGTGGAATTCTCGGGTGCCAAGGAACTCCA152000.10806048002882371RNA PCR Primer, Index 1 (100% over 28bp)
ACCATTGACCGTTGACTGTACCTGGAATTCTCGGGTGCCAAGGAACTCCA146460.10412195990145738RNA PCR Primer, Index 1 (100% over 28bp)
TCCCTGAGACCCTAACTTGTGTGGAATTCTCGGGTGCCAAGGAACTCCAG141340.10048202794259173RNA PCR Primer, Index 1 (100% over 29bp)

[FAIL]Adapter Content

Adapter graph

[WARN]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
TTATGCA254.39482E-544.085381
TCCCTAT1350.044.085381
CAGGGGG207.7848294E-444.085381
CACTATT650.044.085381
CCTTTGC2900.044.085381
AACATTC3218400.044.050451
GCATGCC454.802132E-1044.0052833
TTAGCAA302.5309455E-643.996992
CCCTAGA254.447197E-543.996992
TACGATT207.8621536E-443.9969862
GTAAGGT207.8621536E-443.9969862
CGACATT2750.043.9968343
GTTCACT950.043.9968343
CCATATA254.44729E-543.996833
CTATTAC700.043.996833
AGCGTCA502.7284841E-1143.9932374
AAGTAAG551.8189894E-1243.9932374
CATATAG207.8654574E-443.9932374
GTCAATA207.8654574E-443.9932374
GTAAGTG2450.043.99292818