FastQCFastQC Report
Mon 5 Dec 2016
JG64_3_GATCAG_L005_R1_001.fastq

Summary

[OK]Basic Statistics

MeasureValue
FilenameJG64_3_GATCAG_L005_R1_001.fastq
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences7887036
Sequences flagged as poor quality0
Sequence length50
%GC52

[OK]Per base sequence quality

Per base quality graph

[OK]Per tile sequence quality

Per base quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[FAIL]Per base sequence content

Per base sequence content

[FAIL]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[OK]Sequence Length Distribution

Sequence length distribution

[FAIL]Sequence Duplication Levels

Duplication level graph

[FAIL]Overrepresented sequences

SequenceCountPercentagePossible Source
TTGCGGCCCCGGGTTCCTCCCGGGGCTACGCCTGTCTGAGGGTCGCTTGG4408945.590110150378418No Hit
CCTGTCTGAGGGTCGCTTGGAATTCTCGGGTGCCAAGGAACTCCAGTCAC2375303.011651018202529RNA PCR Primer, Index 1 (100% over 33bp)
ATGACCTATGAATTGACAGCCATGGAATTCTCGGGTGCCAAGGAACTCCA2342032.969467871073493RNA PCR Primer, Index 1 (100% over 28bp)
ATGACCTATGAATTGACAGCCTGGAATTCTCGGGTGCCAAGGAACTCCAG2203272.793533591072743RNA PCR Primer, Index 1 (100% over 29bp)
TTCAAGTAATCCAGGATAGGCTTGGAATTCTCGGGTGCCAAGGAACTCCA2025232.56779606432632RNA PCR Primer, Index 1 (100% over 28bp)
GATGAATGAGGTACATGTTCTTGAGTGGCTATATGGAATTCTCGGGTGCC1413051.791610942310901No Hit
AAGCTGCCAGCTGAAGAACTGTTGGAATTCTCGGGTGCCAAGGAACTCCA1282381.625934001061996RNA PCR Primer, Index 1 (100% over 28bp)
TGAGGTAGTAGGTTGTATAGTTTGGAATTCTCGGGTGCCAAGGAACTCCA1173561.4879607497670861RNA PCR Primer, Index 1 (100% over 28bp)
TCAGTAACTGGAATCTGTCCCTTGGAATTCTCGGGTGCCAAGGAACTCCA923681.1711370405815316RNA PCR Primer, Index 1 (100% over 28bp)
ACTGTATAAGGTACATATGGTTGAGTGTCGTATGGAATTCTCGGGTGCCA874861.10923799510995No Hit
CTACGCCTGTCTGAGGGTCGCTTGGAATTCTCGGGTGCCAAGGAACTCCA841971.0675366512844624RNA PCR Primer, Index 1 (100% over 28bp)
TAGCTTATCAGACTGGTGTTGGCTGGAATTCTCGGGTGCCAAGGAACTCC795551.008680574045814RNA PCR Primer, Index 1 (100% over 27bp)
GTGGGCTCTGGTAGTCCAGTGGCAAGATCGTCTGACTTACGTTTTGGAAT717900.9102278726761232No Hit
AACATTCAACGCTGTCGGTGAGTTGGAATTCTCGGGTGCCAAGGAACTCC673230.8535906264406553RNA PCR Primer, Index 1 (100% over 27bp)
AACATTCAACGCTGTCGGTGAGTGGAATTCTCGGGTGCCAAGGAACTCCA659710.8364485720617987RNA PCR Primer, Index 1 (100% over 28bp)
TATTGCACTTGTCCCGGCCTGTTGGAATTCTCGGGTGCCAAGGAACTCCA648960.8228186101851189RNA PCR Primer, Index 1 (100% over 28bp)
CTGTCTGAGGGTCGCTTGGAATTCTCGGGTGCCAAGGAACTCCAGTCACG522580.6625809746525818RNA PCR Primer, Index 6 (100% over 34bp)
TTGCGGCCCCGGGTTCCTCCCGGGGCTACGCCTGTCTGAGGGTCGCTTTG514810.6527293649984608No Hit
TGAGGTAGTAGTTTGTATAGTTTGGAATTCTCGGGTGCCAAGGAACTCCA494360.6268007398470097RNA PCR Primer, Index 1 (100% over 28bp)
GTTTCCGTAGTGTAGTGGTTATCACGTTCGCCTTGGAATTCTCGGGTGCC404100.5123597762201161No Hit
TGGAGTGTGACAATGGTGTTTGTGGAATTCTCGGGTGCCAAGGAACTCCA394970.5007838179006663RNA PCR Primer, Index 1 (100% over 28bp)
TGTCTGAGGGTCGCTTGGAATTCTCGGGTGCCAAGGAACTCCAGTCACGA392730.4979437142165954RNA PCR Primer, Index 7 (97% over 35bp)
TGTAAACATCCTTGACTGGAAGCTTGGAATTCTCGGGTGCCAAGGAACTC382270.48468144433472854RNA PCR Primer, Index 1 (100% over 26bp)
GCATTGGTGGTTCAGTGGTAGAATTCTCGCCTGGAATTCTCGGGTGCCAA368720.46750135285296024No Hit
GTTTCCGTAGTGTAGTGGTTATCACGTTCGCCTGGAATTCTCGGGTGCCA346640.4395060451099754No Hit
TGAGATGAAGCACTGTAGCTCTGGAATTCTCGGGTGCCAAGGAACTCCAG331200.41992961614477226RNA PCR Primer, Index 1 (100% over 29bp)
AACCCGTAGATCCGAACTTGTGTGGAATTCTCGGGTGCCAAGGAACTCCA321590.40774506417873585RNA PCR Primer, Index 1 (100% over 28bp)
TCAGTAACTGGAATCTGTCCCTGCTGGAATTCTCGGGTGCCAAGGAACTC306530.3886504385170804RNA PCR Primer, Index 1 (100% over 26bp)
CTTCGAACGCACCTTGCGGCCCCGGGTTCCTCCCGGGGCTACGCCTGTCT292770.3712040873149305No Hit
CCTGTCTGAGGGTCGCTTTGGAATTCTCGGGTGCCAAGGAACTCCAGTCA278380.35295895695163554RNA PCR Primer, Index 1 (100% over 32bp)
GTGGGCTCTGGTAGTCCAGTGGCAAGATCGTCTGACTTACGTTTTTGGAA275560.3493834692779392No Hit
TCGCTGCGATCCATTGAAAGTCAGCCCTCGATCCAAGTTTTTGTTGGAAT272580.3456051170553805No Hit
AACTCTTAGCGGTGGATCACTCGGCTCGTGCGTCGATGAAGAACGCAGCT270660.34317074246903395No Hit
GGACAACTCTTAGCGGTGGAATTCTCGGGTGCCAAGGAACTCCAGTCACG265370.33646353332227724RNA PCR Primer, Index 6 (100% over 34bp)
TTCAAGTAATCCAGGATAGGTTTGGAATTCTCGGGTGCCAAGGAACTCCA257950.32705568986879224RNA PCR Primer, Index 1 (100% over 28bp)
TGTAAACATCCTACACTCTCAGCTTGGAATTCTCGGGTGCCAAGGAACTC241220.3058436654783876RNA PCR Primer, Index 1 (100% over 26bp)
CTTGCGGCCCCGGGTTCCTCCCGGGGCTACGCCTGTCTGAGGGTCGCTTG238860.30285141338267No Hit
TTCAGTGATGTTTGACAAATGTCTGACCTGAACTGCAATGTGGACAGATC237150.3006832985167051No Hit
TACGCCTGTCTGAGGGTCGCTTGGAATTCTCGGGTGCCAAGGAACTCCAG236190.2994661112235319RNA PCR Primer, Index 1 (100% over 29bp)
CTGGACAACTCTTAGCGGTGGAATTCTCGGGTGCCAAGGAACTCCAGTCA235790.2989589498513764RNA PCR Primer, Index 1 (100% over 32bp)
CCACGTTCCCGTGGTGGAATTCTCGGGTGCCAAGGAACTCCAGTCACGAT233060.2954975734864149RNA PCR Primer, Index 9 (100% over 36bp)
TCAGTAACTGGAATCTGTCCCTGTGGAATTCTCGGGTGCCAAGGAACTCC232010.2941662748845067RNA PCR Primer, Index 1 (100% over 27bp)
GATCCATGATGACATTAAAACATAACGTGACTGTTGGATGAAGCTTGCGG226960.2877633625610432No Hit
ATCCATGATGACATTAAAACATAACGTGACTGTTGGATGAAGCTTGCGGA216400.2743743023361374No Hit
TGAGATGAAGCACTGTAGCTCTTGGAATTCTCGGGTGCCAAGGAACTCCA214470.271927248715487RNA PCR Primer, Index 1 (100% over 28bp)
ACAGTAGTCTGCACATTGGTTTGGAATTCTCGGGTGCCAAGGAACTCCAG211150.26771780932659617RNA PCR Primer, Index 1 (100% over 29bp)
CCTTGCGGCCCCGGGTTCCTCCCGGGGCTACGCCTGTCTGAGGGTCGCTT209990.26624704134734517No Hit
AGAGATGATGACTTCTGTTACCGCCCCAGTCTGAGAAGTCATGACTGATC204100.2587790901423551No Hit
GTTTCCGTAGTGTAGTGGTTATCACGTTCGCCTCTGGAATTCTCGGGTGC197830.2508293356338173No Hit
CTCGCTGCGATCCATTGAAAGTCAGCCCTCGATCCAAGTTTTTGTTGGAA194750.2469241930682198No Hit
GCCCGGCTAGCTCAGTCGGTAGAGCATGAGACTCTGGAATTCTCGGGTGC188210.238632104633477No Hit
CAACTCTTAGCGGTGGATCACTCGGCTCGTGCGTCGATGAAGAACGCAGC182660.23159524059481912No Hit
TGAGGTAGTAGATTGAATAGTTTGGAATTCTCGGGTGCCAAGGAACTCCA182300.2311387953598792RNA PCR Primer, Index 1 (100% over 28bp)
TGAGGTAGTAGTTTGTGCTGTTTGGAATTCTCGGGTGCCAAGGAACTCCA181180.22971874351784372RNA PCR Primer, Index 1 (100% over 28bp)
ATTCGATCTTCTAAGGCTACTCTAGCTTGGCGGTTCTGGAATTCTCGGGT179750.22790564161238774No Hit
TTCCAGTGATGACAGCCTATAATCTGACTTGGAATTCTCGGGTGCCAAGG169760.21523928634280357Illumina Small RNA Adapter 2 (100% over 21bp)
TTCACAGTGGCTAAGTTCTGCTGGAATTCTCGGGTGCCAAGGAACTCCAG167480.2123484665215171RNA PCR Primer, Index 1 (100% over 29bp)
TTCACAGTGGCTAAGTTCTGTGGAATTCTCGGGTGCCAAGGAACTCCAGT157750.20001176614383398RNA PCR Primer, Index 1 (100% over 30bp)
ACTGGACAACTCTTAGCGGTGGAATTCTCGGGTGCCAAGGAACTCCAGTC155780.1975139963859681RNA PCR Primer, Index 1 (100% over 31bp)
TTCACAGTGGTTAAGTTCTGTGGAATTCTCGGGTGCCAAGGAACTCCAGT148540.1883343755499531RNA PCR Primer, Index 1 (100% over 30bp)
TGGAATTCTCGGGTGCCAAGGAACTCCAGTCACGATCAGATCTCGTATGC137780.1746917346389696RNA PCR Primer, Index 9 (100% over 50bp)
AACTGGACAACTCTTAGCGGTGGAATTCTCGGGTGCCAAGGAACTCCAGT137250.17401974582086352RNA PCR Primer, Index 1 (100% over 30bp)
TGTAAACATCCCCGACTGGAAGCTTGGAATTCTCGGGTGCCAAGGAACTC135990.1724221874985736RNA PCR Primer, Index 1 (100% over 26bp)
CTGTATAAGGTACATATGGTTGAGTGTCGTATGGAATTCTCGGGTGCCAA134620.17068515979894094No Hit
AACATTCAACGCTGTCGGTGATGGAATTCTCGGGTGCCAAGGAACTCCAG132790.16836489652132944RNA PCR Primer, Index 1 (100% over 29bp)
GTGGGCTCTGGTAGTCCAGTGGCAAGATCGTCTGACTAACGTTTTGGAAT130310.1652204960139652No Hit
AGCCTGTGATGATACAAGTTATCCCTGTCTGAACTCTGGTGTGGAATTCT129820.1645992233330747No Hit
GCATTGTGGTTCAGTGGTAGAATTCTCGCCTGGAATTCTCGGGTGCCAAG128720.163204529559647No Hit
CATTATTACTTTTGGTACGCGTGGAATTCTCGGGTGCCAAGGAACTCCAG128140.16246914557002148RNA PCR Primer, Index 1 (100% over 29bp)
TCCCATATGGTCTAGCGGTTAGGATTCCTGGAATTCTCGGGTGCCAAGGA120110.1522878810239994RNA PCR Primer, Index 1 (100% over 22bp)
CATTGCACTTGTCTCGGTCTGATGGAATTCTCGGGTGCCAAGGAACTCCA118560.15032263070689672RNA PCR Primer, Index 1 (100% over 28bp)
TCGTACCGTGAGTAATAATGCATGGAATTCTCGGGTGCCAAGGAACTCCA117920.1495111725114479RNA PCR Primer, Index 1 (100% over 28bp)
ATGACCTATGAATTGACAGCCATTGGAATTCTCGGGTGCCAAGGAACTCC117400.14885186272764572RNA PCR Primer, Index 1 (100% over 27bp)
TCCAGTGATGACAGCCTATAATCTGACTTGGAATTCTCGGGTGCCAAGGA116710.14797700936067745RNA PCR Primer, Index 1 (100% over 22bp)
CACCTTGCGGCCCCGGGTTCCTCCCGGGGCTACGCCTGTCTGAGGGTCGC116170.1472923415082675No Hit
TCCCATATGGTCTAGCGGTTAGGATTCCTTGGAATTCTCGGGTGCCAAGG110830.14052173718999125Illumina Small RNA Adapter 2 (100% over 21bp)
TACCGTGAAGAATATCACGTCTTTCGCTCCTATCTGATCTGGAATTCTCG110610.14024279843530574No Hit
TCCCATATGGTCTAGCGGTTAGGATTCCTGTGGAATTCTCGGGTGCCAAG108880.1380493255007331No Hit
TGTAAACATCCTTGACTGGAAGCTTGGACTTCTCGGGTGCCAAGGAACTC107220.13594460580628767RNA PCR Primer, Index 1 (96% over 26bp)
CGCTGCGATCCATTGAAAGTCAGCCCTCGATCCAAGTTTTTGTTGGAATT106050.1344611587927328No Hit
TATTGCACTTGTCCCGGCCTGTTTGGAATTCTCGGGTGCCAAGGAACTCC105960.13434704748399778RNA PCR Primer, Index 1 (100% over 27bp)
GCATTGGTGGTTCAGTGGTAGAATTCTCGCCTTGGAATTCTCGGGTGCCA105660.13396667645488114No Hit
GCCCGGCTAGCTCAGTCGGTAGAGCATGAGACTCTTAATCTTGGAATTCT104940.1330537859850012No Hit
TGGAGTGTGACAATGGTGTTTGTTGGAATTCTCGGGTGCCAAGGAACTCC103490.13121532601093744RNA PCR Primer, Index 1 (100% over 27bp)
TCCCTGGTGGTCTAGTGGTTAGGATTCGTGGAATTCTCGGGTGCCAAGGA103000.13059405333004692RNA PCR Primer, Index 1 (100% over 22bp)
TGAGGTAGTAGGTTGTATAGTTGGAATTCTCGGGTGCCAAGGAACTCCAG100520.12744965282268267RNA PCR Primer, Index 1 (100% over 29bp)
TGTAAACATCCTACACTCAGCTTGGAATTCTCGGGTGCCAAGGAACTCCA100330.12720875117090882RNA PCR Primer, Index 1 (100% over 28bp)
TGAGGTAGTAGGTTGTATAGTTTTGGAATTCTCGGGTGCCAAGGAACTCC99710.12642265104406775RNA PCR Primer, Index 1 (100% over 27bp)
GCGGCCCCGGGTTCCTCCCGGGGCTACGCCTGTCTGAGGGTCGCTTGGAA98420.1247870556188662No Hit
GCATTGGTGGTTCAGTGGTAGAATTCTCGCCTGCCATGGAATTCTCGGGT98310.12464758624152344No Hit
TAAGATGATGATTAACTCACCATCTTTCGGCTGAAGAATGATGTATACTC97930.12416578293797569No Hit
TCCCTGGTGGTCTAGTGGTTAGGATTCGGCGCTCTGGAATTCTCGGGTGC96570.1224414342726469No Hit
TGAGATGAAGCACTGTAGCTTGGAATTCTCGGGTGCCAAGGAACTCCAGT92870.11775019158020833RNA PCR Primer, Index 1 (100% over 30bp)
TGGAGTGTGACAATGGTGTTTTGGAATTCTCGGGTGCCAAGGAACTCCAG92820.1176867964086889RNA PCR Primer, Index 1 (100% over 29bp)
GTGGGCTCTGGTAGTCCAGTGGCAAGATCGTCTGACTAACGTTTTTGGAA91070.1154679654055085No Hit
TTCAAGTAATCCAGGATAGGCTGGAATTCTCGGGTGCCAAGGAACTCCAG91020.11540457023398905RNA PCR Primer, Index 1 (100% over 29bp)
TCACAGTGAACCGGTCTCTTTTGGAATTCTCGGGTGCCAAGGAACTCCAG90790.11511295244499961RNA PCR Primer, Index 1 (100% over 29bp)
GTTACATGATGAAACATGTGTTGGTAGGGACATCTGAATGAATGTGATGA90380.11459311203854021No Hit
CGCCTGTCTGAGGGTCGCTTGGAATTCTCGGGTGCCAAGGAACTCCAGTC89780.11383236998030694RNA PCR Primer, Index 1 (100% over 31bp)
TGTAAACATCCCCGACTGGAAGCTGGAATTCTCGGGTGCCAAGGAACTCC89260.11317306019650475RNA PCR Primer, Index 1 (100% over 27bp)
TCAGTAACTGGAATCTGTCCCTGCTGGACTTCTCGGGTGCCAAGGAACTC89080.11294483757903476RNA PCR Primer, Index 1 (96% over 26bp)
CTACGCCTGTCTGAGGGTCGCTTTGGAATTCTCGGGTGCCAAGGAACTCC84860.10759428510279401RNA PCR Primer, Index 1 (100% over 27bp)
TGAGGTAGTTGTTTGTACAGTTTGGAATTCTCGGGTGCCAAGGAACTCCA84840.10756892703418623RNA PCR Primer, Index 1 (100% over 28bp)
TTTTGCAGAAACGTTTCAGATTTGGAATTCTCGGGTGCCAAGGAACTCCA84340.10693497531899182RNA PCR Primer, Index 1 (100% over 28bp)
AAGTTCTGTGATACACTCAGACTTGGAATTCTCGGGTGCCAAGGAACTCC81400.10320733923364873RNA PCR Primer, Index 1 (100% over 27bp)
GCATGAGTGACTGGTTAATCTTTTGGAATTCTCGGGTGCCAAGGAACTCC80440.10199015194047548RNA PCR Primer, Index 1 (100% over 27bp)
TAGCTTATCAGACTGGTGTTGGTGGAATTCTCGGGTGCCAAGGAACTCCA80010.10144495346540829RNA PCR Primer, Index 1 (100% over 28bp)

[FAIL]Adapter Content

Adapter graph

[FAIL]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
CTCTATA351.4476973E-743.99933218
CTACGCG302.530096E-643.9987826
GGATGCA207.8603695E-443.99877524
ATATTAG207.863315E-443.9954314
TTCTCTA351.4487887E-743.9951532
ATAATCC207.864297E-443.9943126
CTATAGT408.3327905E-943.9943125
CACGATT207.864297E-443.9943126
CCATACG207.864297E-443.9943129
CCTATTT254.4486143E-543.9943127
AACATTC186700.043.9403651
TCAGTAA171700.043.931091
TCAACGC166800.043.8756266
TAGCTTA105050.043.857851
ATAGGTT30850.043.8550416
TGACCTA510600.043.8488122
CTATGAA511200.043.8351026
ACATTCA188750.043.8247832
ACCTATG511500.043.805094
AGCTTAT105100.043.790292