FastQCFastQC Report
Mon 5 Dec 2016
JG64_5_GATCAG_L004_R1_001.fastq

Summary

[OK]Basic Statistics

MeasureValue
FilenameJG64_5_GATCAG_L004_R1_001.fastq
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences17750499
Sequences flagged as poor quality0
Sequence length50
%GC51

[OK]Per base sequence quality

Per base quality graph

[FAIL]Per tile sequence quality

Per base quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[FAIL]Per base sequence content

Per base sequence content

[WARN]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[OK]Sequence Length Distribution

Sequence length distribution

[FAIL]Sequence Duplication Levels

Duplication level graph

[FAIL]Overrepresented sequences

SequenceCountPercentagePossible Source
AACATTCAACGCTGTCGGTGAGTGGAATTCTCGGGTGCCAAGGAACTCCA6670493.757916890111089RNA PCR Primer, Index 1 (100% over 28bp)
TTCAAGTAATCCAGGATAGGCTTGGAATTCTCGGGTGCCAAGGAACTCCA6472603.6464327002863417RNA PCR Primer, Index 1 (100% over 28bp)
AACATTCAACGCTGTCGGTGAGTTGGAATTCTCGGGTGCCAAGGAACTCC5803953.2697390648003752RNA PCR Primer, Index 1 (100% over 27bp)
TCCTTCATTCCACCGGAGTCTGTGGAATTCTCGGGTGCCAAGGAACTCCA3822462.1534380526429144RNA PCR Primer, Index 1 (100% over 28bp)
TACCCTGTAGAACCGAATTTGTTGGAATTCTCGGGTGCCAAGGAACTCCA3730352.1015465537053353RNA PCR Primer, Index 1 (100% over 28bp)
GATGAATGAGGTACATGTTCTTGAGTGGCTATATGGAATTCTCGGGTGCC3345111.8845160352956838No Hit
TTCCCTTTGTCATCCTATGCCTTGGAATTCTCGGGTGCCAAGGAACTCCA3014681.6983635220621123RNA PCR Primer, Index 1 (100% over 28bp)
TAGCTTATCAGACTGGTGTTGGCTGGAATTCTCGGGTGCCAAGGAACTCC2626501.479676712187077RNA PCR Primer, Index 1 (100% over 27bp)
AAGCTGCCAGCTGAAGAACTGTTGGAATTCTCGGGTGCCAAGGAACTCCA2595781.4623701564671505RNA PCR Primer, Index 1 (100% over 28bp)
TGAGGTAGTAGGTTGTATAGTTTGGAATTCTCGGGTGCCAAGGAACTCCA2429801.3688629260506986RNA PCR Primer, Index 1 (100% over 28bp)
CCTGTCTGAGGGTCGCTTGGAATTCTCGGGTGCCAAGGAACTCCAGTCAC2413711.3597983921466095RNA PCR Primer, Index 1 (100% over 33bp)
AACAGTAAGAGTTTATGTGCTGTGGAATTCTCGGGTGCCAAGGAACTCCA2255781.2708262455044221RNA PCR Primer, Index 1 (100% over 28bp)
ACTGTATAAGGTACATATGGTTGAGTGTCGTATGGAATTCTCGGGTGCCA1971851.1108701789172237No Hit
ACAGTAGTCTGCACATTGGTTTGGAATTCTCGGGTGCCAAGGAACTCCAG1672320.9421256270035001RNA PCR Primer, Index 1 (100% over 29bp)
TACCCTGTAGAACCGAATTTGCGTGGAATTCTCGGGTGCCAAGGAACTCC1445190.8141686608359573RNA PCR Primer, Index 1 (100% over 27bp)
TACCCTGTAGAACCGAATTTGCTGGAATTCTCGGGTGCCAAGGAACTCCA1439080.8107265040830683RNA PCR Primer, Index 1 (100% over 28bp)
AACATTCAACGCTGTCGGTGATGGAATTCTCGGGTGCCAAGGAACTCCAG1424590.8025633532893921RNA PCR Primer, Index 1 (100% over 29bp)
TATTGCACTTGTCCCGGCCTGTTGGAATTCTCGGGTGCCAAGGAACTCCA1357630.7648404701186147RNA PCR Primer, Index 1 (100% over 28bp)
TCCTTCATTCCACCGGAGTCTGTTGGAATTCTCGGGTGCCAAGGAACTCC1292980.7284189588134959RNA PCR Primer, Index 1 (100% over 27bp)
TCCCATATGGTCTAGCGGTTAGGATTCCTGTGGAATTCTCGGGTGCCAAG995910.561060283432032No Hit
TTCACAGTGGTTAAGTTCTGTGGAATTCTCGGGTGCCAAGGAACTCCAGT951880.5362553469623587RNA PCR Primer, Index 1 (100% over 30bp)
TTCACAGTGGCTAAGTTCTGTGGAATTCTCGGGTGCCAAGGAACTCCAGT823650.4640151243072096RNA PCR Primer, Index 1 (100% over 30bp)
TATGAATGAGGTACATGTTCTTGAGTGGCTATATGGAATTCTCGGGTGCC778440.43854541779360684No Hit
CTACGCCTGTCTGAGGGTCGCTTGGAATTCTCGGGTGCCAAGGAACTCCA726210.4091208928830677RNA PCR Primer, Index 1 (100% over 28bp)
TTGGTCCCCTTCAACCAGCTGTTGGAATTCTCGGGTGCCAAGGAACTCCA683670.3851553694349663RNA PCR Primer, Index 1 (100% over 28bp)
TTCACAGTGGCTAAGTTCTGCTGGAATTCTCGGGTGCCAAGGAACTCCAG653840.3683502080702069RNA PCR Primer, Index 1 (100% over 29bp)
CTGTCTGAGGGTCGCTTGGAATTCTCGGGTGCCAAGGAACTCCAGTCACG649850.3661023839386149RNA PCR Primer, Index 6 (100% over 34bp)
ACCCTGTAGAACCGAATTTGCGTGGAATTCTCGGGTGCCAAGGAACTCCA620980.34983805244010324RNA PCR Primer, Index 1 (100% over 28bp)
TTCAAGTAATCCAGGATAGGTTTGGAATTCTCGGGTGCCAAGGAACTCCA603490.3399848083144029RNA PCR Primer, Index 1 (100% over 28bp)
TTCACAGTGGCTAAGTTCAGTTGGAATTCTCGGGTGCCAAGGAACTCCAG546750.3080195097613876RNA PCR Primer, Index 1 (100% over 29bp)
CTGTATAAGGTACATATGGTTGAGTGTCGTATGGAATTCTCGGGTGCCAA534510.30112392896672935No Hit
TGAGGTAGTAGTTTGTATAGTTTGGAATTCTCGGGTGCCAAGGAACTCCA525080.2958114022597337RNA PCR Primer, Index 1 (100% over 28bp)
ACAGTAGTCTGCACATTGGTTATGGAATTCTCGGGTGCCAAGGAACTCCA514250.28971016533112676RNA PCR Primer, Index 1 (100% over 28bp)
AAGCTGCCAGCTGAAGAACTTGGAATTCTCGGGTGCCAAGGAACTCCAGT487720.27476410663159384RNA PCR Primer, Index 1 (100% over 30bp)
GCATTGGTGGTTCAGTGGTAGAATTCTCGCCTTGGAATTCTCGGGTGCCA471980.2658967502829075No Hit
GCCCGGCTAGCTCAGTCGGTAGAGCATGAGACTCTGGAATTCTCGGGTGC469810.26467424943941015No Hit
TTCCCTTTGTCATCCTATGCCTGTGGAATTCTCGGGTGCCAAGGAACTCC451490.2543534128251831RNA PCR Primer, Index 1 (100% over 27bp)
TTAGGTAGTAGGTTGTATAGTTTGGAATTCTCGGGTGCCAAGGAACTCCA449490.2532266839371671RNA PCR Primer, Index 1 (100% over 28bp)
TACAGTAGTCTGCACATTGGTTTGGAATTCTCGGGTGCCAAGGAACTCCA448530.25268585407091937RNA PCR Primer, Index 1 (100% over 28bp)
TCCCATATGGTCTAGCGGTTAGGATTCCTTGGAATTCTCGGGTGCCAAGG445020.2507084448724512Illumina Small RNA Adapter 2 (100% over 21bp)
TAACGGAACCCATAATGCAGCTGTGGAATTCTCGGGTGCCAAGGAACTCC442040.2490296188293073RNA PCR Primer, Index 1 (100% over 27bp)
TAGCTTATCAGACTGGTGTTGGTGGAATTCTCGGGTGCCAAGGAACTCCA430670.24262416510093607RNA PCR Primer, Index 1 (100% over 28bp)
TTTGGTCCCCTTCAACCAGCTGTTGGAATTCTCGGGTGCCAAGGAACTCC428160.24121012034647588RNA PCR Primer, Index 1 (100% over 27bp)
GTTTCCGTAGTGTAGTGGTTATCACGTTCGCCTTGGAATTCTCGGGTGCC404610.22794288769008691No Hit
AAGCTGCCAGCTGAAGAACTGCTGGAATTCTCGGGTGCCAAGGAACTCCA398380.2244331272039169RNA PCR Primer, Index 1 (100% over 28bp)
TATGTGCCCTTGGACTACATCGTGGAATTCTCGGGTGCCAAGGAACTCCA393370.22161067133943674RNA PCR Primer, Index 1 (100% over 28bp)
TCCCTGGTGGTCTAGTGGTTAGGATTCGTGGAATTCTCGGGTGCCAAGGA388680.21896849209703906RNA PCR Primer, Index 1 (100% over 22bp)
TACCCTGTAGATCCGGATTTGTTGGAATTCTCGGGTGCCAAGGAACTCCA386610.21780232769794244RNA PCR Primer, Index 1 (100% over 28bp)
TCCTTCATTCCACCGGAGTCTTGGAATTCTCGGGTGCCAAGGAACTCCAG379320.21369540090112396RNA PCR Primer, Index 1 (100% over 29bp)
TTCACAGTGGTTAAGTTCTGCCTGGAATTCTCGGGTGCCAAGGAACTCCA378110.21301372992387427RNA PCR Primer, Index 1 (100% over 28bp)
TGTCTGAGGGTCGCTTGGAATTCTCGGGTGCCAAGGAACTCCAGTCACGA377150.21247290005762653RNA PCR Primer, Index 7 (97% over 35bp)
ATTCGATCTTCTAAGGCTACTCTAGCTTGGCGGTTCTGGAATTCTCGGGT374880.21119406276972832No Hit
TTCAAGTAATCCAGGATAGGCTGGAATTCTCGGGTGCCAAGGAACTCCAG373610.21047858992583815RNA PCR Primer, Index 1 (100% over 29bp)
GTGTAATGGTTAGCACTCTGTGGAATTCTCGGGTGCCAAGGAACTCCAGT367190.2068617901953066RNA PCR Primer, Index 1 (100% over 30bp)
CCACGTTCCCGTGGTGGAATTCTCGGGTGCCAAGGAACTCCAGTCACGAT361360.20357737548673985RNA PCR Primer, Index 9 (100% over 36bp)
GTTTCCGTAGTGTAGTGGTTATCACGTTCGCCTCTGGAATTCTCGGGTGC352290.19846765997958704No Hit
TTCAGTCATTGTTTCTGGTTGTTGGAATTCTCGGGTGCCAAGGAACTCCA330710.18631025527789388RNA PCR Primer, Index 1 (100% over 28bp)
CACCACGTTCCCGTGGTGGAATTCTCGGGTGCCAAGGAACTCCAGTCACG330440.18615814687801172RNA PCR Primer, Index 6 (100% over 34bp)
AACATTCATTGCTGTCGGTGGGTTGGAATTCTCGGGTGCCAAGGAACTCC314830.17736402790704645RNA PCR Primer, Index 1 (100% over 27bp)
AACATTCATTGCTGTCGGTGGGTGGAATTCTCGGGTGCCAAGGAACTCCA308820.17397820759855823RNA PCR Primer, Index 1 (100% over 28bp)
TTCACAGTGGTTAAGTTCTGCTGGAATTCTCGGGTGCCAAGGAACTCCAG304220.1713867311561213RNA PCR Primer, Index 1 (100% over 29bp)
ACCCTGTAGAACCGAATTTGTGTGGAATTCTCGGGTGCCAAGGAACTCCA296550.16706572587057975RNA PCR Primer, Index 1 (100% over 28bp)
TGAGGTAGTAGGTTGTATAGTTGGAATTCTCGGGTGCCAAGGAACTCCAG290410.16360666818437047RNA PCR Primer, Index 1 (100% over 29bp)
AACATTAAGAGTTTATGTGCTGTGGAATTCTCGGGTGCCAAGGAACTCCA287300.16185460476350552RNA PCR Primer, Index 1 (100% over 28bp)
TGGAATTCTCGGGTGCCAAGGAACTCCAGTCACGATCAGATCTCGTATGC285240.160694074008849RNA PCR Primer, Index 9 (100% over 50bp)
AACCCGTAGATCCGAACTTGTGTGGAATTCTCGGGTGCCAAGGAACTCCA270610.15245205219301158RNA PCR Primer, Index 1 (100% over 28bp)
CATTGCACTTGTCTCGGTCTGATGGAATTCTCGGGTGCCAAGGAACTCCA265450.1495450916619302RNA PCR Primer, Index 1 (100% over 28bp)
TTCAAGTAATCCAGGATAGGCTTTGGAATTCTCGGGTGCCAAGGAACTCC255160.1437480715330876RNA PCR Primer, Index 1 (100% over 27bp)
GCATTGGTGGTTCAGTGGTAGAATTCTCGCCTGGAATTCTCGGGTGCCAA247200.1392636905587837No Hit
TGAGATGAAGCACTGTAGCTCTGGAATTCTCGGGTGCCAAGGAACTCCAG242210.13645250198318368RNA PCR Primer, Index 1 (100% over 29bp)
TGAGGTAGTAGATTGAATAGTTTGGAATTCTCGGGTGCCAAGGAACTCCA234020.13183854718675794RNA PCR Primer, Index 1 (100% over 28bp)
TACCCTGTAGAACCGAATTTGTGGAATTCTCGGGTGCCAAGGAACTCCAG225900.1272640279014128RNA PCR Primer, Index 1 (100% over 29bp)
TCCCTGGTGGTCTAGTGGTTAGGATTCGGCGCTCTGGAATTCTCGGGTGC222900.12557393456938873No Hit
GATTAATGAGGTACATGTTCTTGAGTGGCTATATGGAATTCTCGGGTGCC217350.1224472619051442No Hit
TATTGCACTTGTCCCGGCCTGTTTGGAATTCTCGGGTGCCAAGGAACTCC212840.119906488262668RNA PCR Primer, Index 1 (100% over 27bp)
TACCCTGTAGAACCGAATGTGTTGGAATTCTCGGGTGCCAAGGAACTCCA208440.11742768470903268RNA PCR Primer, Index 1 (100% over 28bp)
TGAGGTAGTAGGTTGTATAGTTTTGGAATTCTCGGGTGCCAAGGAACTCC205550.1157995614658495RNA PCR Primer, Index 1 (100% over 27bp)
TCCCTGGTGGTCTAGTGGTTAGGATTCGGCGCTTGGAATTCTCGGGTGCC200410.11290386822364826No Hit
GCGTGTCGTTGGCATTTGGAATTCTCGGGTGCCAAGGAACTCCAGTCACG198680.11192924773551437RNA PCR Primer, Index 6 (100% over 34bp)
TCCCTGGTGGTCTAGTGGTTAGGATTTGGCGCTCTGGAATTCTCGGGTGC197480.11125321040270475No Hit
TCCAGCATCAGTGATTTTGTTGTGGAATTCTCGGGTGCCAAGGAACTCCA197390.11120250760274401RNA PCR Primer, Index 1 (100% over 28bp)
TCCCTGGTGGTCTAGTGGTTAGGATTCGGCTGGAATTCTCGGGTGCCAAG196120.11048703475885382No Hit
TCCCTGAGACCCTTAACCTGTGTGGAATTCTCGGGTGCCAAGGAACTCCA192450.10841948724934437RNA PCR Primer, Index 1 (100% over 28bp)
TGTAAACATCCTTGACTGGAAGCTTGGAATTCTCGGGTGCCAAGGAACTC190680.10742233218345018RNA PCR Primer, Index 1 (100% over 26bp)
ACCACGTTCCCGTGGTGGAATTCTCGGGTGCCAAGGAACTCCAGTCACGA187300.10551816036270303RNA PCR Primer, Index 7 (97% over 35bp)
TGAGATGAAGCACTGTAGCTCTTGGAATTCTCGGGTGCCAAGGAACTCCA187040.10537168560726096RNA PCR Primer, Index 1 (100% over 28bp)
TTCCAGTGATGACAGCCTATAATCTGACTTGGAATTCTCGGGTGCCAAGG186560.1051012706741371Illumina Small RNA Adapter 2 (100% over 21bp)
CACGTTCCCGTGGTGGAATTCTCGGGTGCCAAGGAACTCCAGTCACGATC183330.10328160351999117RNA PCR Primer, Index 9 (100% over 37bp)
TACGCCTGTCTGAGGGTCGCTTGGAATTCTCGGGTGCCAAGGAACTCCAG182210.10265063534270219RNA PCR Primer, Index 1 (100% over 29bp)
AACATTCAACGCTGTCGGTGGTGGAATTCTCGGGTGCCAAGGAACTCCAG179290.10100561116619877RNA PCR Primer, Index 1 (100% over 29bp)
TCCCTGGTGGTCTAGTGGTTAGGATTCTGGAATTCTCGGGTGCCAAGGAA178540.10058308783319275RNA PCR Primer, Index 1 (100% over 23bp)

[FAIL]Adapter Content

Adapter graph

[WARN]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
ACGTGCG206.975422E-445.0791124
TAGCCGC1150.043.8783871
GCTTCCG408.53106E-943.8783841
AACATTC1802350.043.8686451
GTACGCA208.0373004E-443.80063215
TACGCAA1250.043.79495611
CTACGCA1250.043.79495610
AACAGTA253750.043.7659871
TTCAAGT913450.043.734281
TCCTTCA650200.043.729921
TCAACGC1795000.043.7217646
CATTCAA1714200.043.717653
ACATTCA1825950.043.7009542
TCGGTGA1746300.043.70030215
ATTCAAC1763950.043.6998674
GCTTATC383650.043.6985443
CAACGCT1795200.043.694947
CTTATCA396700.043.690574
TCCCATA232350.043.670651
AGCTTAT382800.043.669852