FastQCFastQC Report
Mon 5 Dec 2016
JG65_3_TAGCTT_L004_R1_001.fastq

Summary

[OK]Basic Statistics

MeasureValue
FilenameJG65_3_TAGCTT_L004_R1_001.fastq
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences9903472
Sequences flagged as poor quality0
Sequence length50
%GC52

[OK]Per base sequence quality

Per base quality graph

[OK]Per tile sequence quality

Per base quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[FAIL]Per base sequence content

Per base sequence content

[FAIL]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[OK]Sequence Length Distribution

Sequence length distribution

[FAIL]Sequence Duplication Levels

Duplication level graph

[FAIL]Overrepresented sequences

SequenceCountPercentagePossible Source
TTGCGGCCCCGGGTTCCTCCCGGGGCTACGCCTGTCTGAGGGTCGCTTGG4422084.465181504022024No Hit
TTCAAGTAATCCAGGATAGGCTTGGAATTCTCGGGTGCCAAGGAACTCCA3438063.4715703745110806RNA PCR Primer, Index 1 (100% over 28bp)
ATGACCTATGAATTGACAGCCTGGAATTCTCGGGTGCCAAGGAACTCCAG2939452.968100480316398RNA PCR Primer, Index 1 (100% over 29bp)
ATGACCTATGAATTGACAGCCATGGAATTCTCGGGTGCCAAGGAACTCCA2814392.8418215349122007RNA PCR Primer, Index 1 (100% over 28bp)
CCTGTCTGAGGGTCGCTTGGAATTCTCGGGTGCCAAGGAACTCCAGTCAC2379022.4022080337077747RNA PCR Primer, Index 1 (100% over 33bp)
TGAGGTAGTAGGTTGTATAGTTTGGAATTCTCGGGTGCCAAGGAACTCCA1647751.6638104293120637RNA PCR Primer, Index 1 (100% over 28bp)
AAGCTGCCAGCTGAAGAACTGTTGGAATTCTCGGGTGCCAAGGAACTCCA1444651.4587308370236216RNA PCR Primer, Index 1 (100% over 28bp)
TCAGTAACTGGAATCTGTCCCTTGGAATTCTCGGGTGCCAAGGAACTCCA1067141.0775412905696102RNA PCR Primer, Index 1 (100% over 28bp)
AACATTCAACGCTGTCGGTGAGTGGAATTCTCGGGTGCCAAGGAACTCCA1041221.051368651317437RNA PCR Primer, Index 1 (100% over 28bp)
TAGCTTATCAGACTGGTGTTGGCTGGAATTCTCGGGTGCCAAGGAACTCC1004311.014098893802093RNA PCR Primer, Index 1 (100% over 27bp)
CTACGCCTGTCTGAGGGTCGCTTGGAATTCTCGGGTGCCAAGGAACTCCA981260.9908242281090914RNA PCR Primer, Index 1 (100% over 28bp)
AGAGATGATGACTTCTGTTACCGCCCCAGTCTGAGAAGTCATGACTGATC873210.8817210772141325No Hit
AACATTCAACGCTGTCGGTGAGTTGGAATTCTCGGGTGCCAAGGAACTCC861520.8699171361316516RNA PCR Primer, Index 1 (100% over 27bp)
TATTGCACTTGTCCCGGCCTGTTGGAATTCTCGGGTGCCAAGGAACTCCA845530.8537712834448364RNA PCR Primer, Index 1 (100% over 28bp)
TTCAGTGATGTTTGACAAATGTCTGACCTGAACTGCAATGTGGACAGATC770870.7783835810309758No Hit
CCGTCGAGCAGCATTCCGGGCTTCACATCGGAGGGCTCCAGCCGGCCCCG768070.7755562897537349No Hit
TGAGGTAGTAGTTTGTATAGTTTGGAATTCTCGGGTGCCAAGGAACTCCA617690.6237105532282011RNA PCR Primer, Index 1 (100% over 28bp)
GATCCATGATGACATTAAAACATAACGTGACTGTTGGATGAAGCTTGCGG602960.6088369816161443No Hit
CTGTCTGAGGGTCGCTTGGAATTCTCGGGTGCCAAGGAACTCCAGTCACT562420.5679018429092343RNA PCR Primer, Index 3 (100% over 34bp)
TGTAAACATCCTTGACTGGAAGCTTGGAATTCTCGGGTGCCAAGGAACTC545700.5510188749965669RNA PCR Primer, Index 1 (100% over 26bp)
ATCCATGATGACATTAAAACATAACGTGACTGTTGGATGAAGCTTGCGGA539380.5446372746850802No Hit
TGTCTGAGGGTCGCTTGGAATTCTCGGGTGCCAAGGAACTCCAGTCACTA515600.5206254937662266RNA PCR Primer, Index 7 (97% over 35bp)
TGGAGTGTGACAATGGTGTTTGTGGAATTCTCGGGTGCCAAGGAACTCCA508160.5131129769438436RNA PCR Primer, Index 1 (100% over 28bp)
GCATTGGTGGTTCAGTGGTAGAATTCTCGCCTGGAATTCTCGGGTGCCAA505420.5103462704796863No Hit
GTTACATGATGAAACATGTGTTGGTAGGGACATCTGAATGAATGTGATGA499140.5040050600435888No Hit
CACCGTCGAGCAGCATTCCGGGCTTCACATCGGAGGGCTCCAGCCGGCCC496640.5014806928317666No Hit
TAAGATGATGATTAACTCACCATCTTTCGGCTGAAGAATGATGTATACTC482110.48680907059665535No Hit
CCTGTCTGAGGGTCGCTTGGAATTCTCGGGTGCCCAGGAACTCCAGTCAC481180.48587000599385755RNA PCR Primer, Index 1 (96% over 33bp)
TTCAAGTAATCCAGGATAGGTTTGGAATTCTCGGGTGCCAAGGAACTCCA419670.42376047511418224RNA PCR Primer, Index 1 (100% over 28bp)
TGCCTGTGATGAGACTCTCGACGGGCGGACTGAATGGGTTTTCACCCTCC418310.42238721935095086No Hit
CTTCGAACGCACCTTGCGGCCCCGGGTTCCTCCCGGGGCTACGCCTGTCT399170.4030606639772395No Hit
TTACATGATGAAACATGTGTTGGTAGGGACATCTGAATGAATGTGATGAA380730.38444093142283836No Hit
GCCCGGCTAGCTCAGTCGGTAGAGCATGAGACTCTGGAATTCTCGGGTGC372830.37646393103347997No Hit
TGTAAACATCCTACACTCTCAGCTTGGAATTCTCGGGTGCCAAGGAACTC364410.3679618622640626RNA PCR Primer, Index 1 (100% over 26bp)
AACCCGTAGATCCGAACTTGTGTGGAATTCTCGGGTGCCAAGGAACTCCA343420.34676727515360267RNA PCR Primer, Index 1 (100% over 28bp)
TTGCGGCCCCGGGTTCCTCCCGGGGCTACGCCTGTCTGAGGGTCGCTTTG333260.33650824680475694No Hit
TTCCAGTGATGACAGCCTATAATCTGACTTGGAATTCTCGGGTGCCAAGG320900.3240277753095076Illumina Small RNA Adapter 2 (100% over 21bp)
ACAGTAGTCTGCACATTGGTTTGGAATTCTCGGGTGCCAAGGAACTCCAG310740.31376874696066187RNA PCR Primer, Index 1 (100% over 29bp)
TGAGATGAAGCACTGTAGCTCTGGAATTCTCGGGTGCCAAGGAACTCCAG301260.3041963464934318RNA PCR Primer, Index 1 (100% over 29bp)
GTTTCCGTAGTGTAGTGGTTATCACGTTCGCCTGGAATTCTCGGGTGCCA300840.30377225280184567No Hit
TCGCTGCGATCCATTGAAAGTCAGCCCTCGATCCAAGTTTTTGTTGGAAT284050.28681860260724723No Hit
TACGCCTGTCTGAGGGTCGCTTGGAATTCTCGGGTGCCAAGGAACTCCAG283010.28576846584712917RNA PCR Primer, Index 1 (100% over 29bp)
CTTGCGGCCCCGGGTTCCTCCCGGGGCTACGCCTGTCTGAGGGTCGCTTG270600.2732375070076434No Hit
TCAGTAACTGGAATCTGTCCCTGCTGGAATTCTCGGGTGCCAAGGAACTC267750.27035972838616595RNA PCR Primer, Index 1 (100% over 26bp)
GGACAACTCTTAGCGGTGGAATTCTCGGGTGCCAAGGAACTCCAGTCACT259390.2619182444298323RNA PCR Primer, Index 3 (100% over 34bp)
CTGGACAACTCTTAGCGGTGGAATTCTCGGGTGCCAAGGAACTCCAGTCA255040.2575258454812615RNA PCR Primer, Index 1 (100% over 32bp)
GTTTCCGTAGTGTAGTGGTTATCACGTTCGCCTTGGAATTCTCGGGTGCC244600.24698408800469168No Hit
TCCAGTGATGACAGCCTATAATCTGACTTGGAATTCTCGGGTGCCAAGGA238410.24073375478821973RNA PCR Primer, Index 1 (100% over 22bp)
CCACGTTCCCGTGGTGGAATTCTCGGGTGCCAAGGAACTCCAGTCACTAG236130.23843153189103783RNA PCR Primer, Index 7 (97% over 36bp)
TCAGTAACTGGAATCTGTCCCTGTGGAATTCTCGGGTGCCAAGGAACTCC231490.23374630634589566RNA PCR Primer, Index 1 (100% over 27bp)
TCCCATATGGTCTAGCGGTTAGGATTCCTGTGGAATTCTCGGGTGCCAAG225210.22740509590979807No Hit
TTCACAGTGGCTAAGTTCTGCTGGAATTCTCGGGTGCCAAGGAACTCCAG222000.2241638084098183RNA PCR Primer, Index 1 (100% over 29bp)
TACACTGATGACTTCTTAGGACACCTTTGGATTCTTGATGAAAACAAATT218530.220659986719809No Hit
TTCACAGTGGCTAAGTTCTGTGGAATTCTCGGGTGCCAAGGAACTCCAGT215080.21717635996749424RNA PCR Primer, Index 1 (100% over 30bp)
TCCGAATGATGAAATGTTGTTGATCTCTGTAGTAACCACGGTTACAGTGA213960.21604544345659782No Hit
CCTGTCTGAGGGTCGCTTTGGAATTCTCGGGTGCCAAGGAACTCCAGTCA213620.21570212951579001RNA PCR Primer, Index 1 (100% over 32bp)
TGAGGTAGTAGATTGAATAGTTTGGAATTCTCGGGTGCCAAGGAACTCCA212920.2149953066964798RNA PCR Primer, Index 1 (100% over 28bp)
CCTTGCGGCCCCGGGTTCCTCCCGGGGCTACGCCTGTCTGAGGGTCGCTT207980.21000715708591897No Hit
AACATTCAACGCTGTCGGTGATGGAATTCTCGGGTGCCAAGGAACTCCAG207890.20991627986629335RNA PCR Primer, Index 1 (100% over 29bp)
AGCCTGTGATGATACAAGTTATCCCTGTCTGAACTCTGGTGTGGAATTCT204480.20647304298936778No Hit
CTCGCTGCGATCCATTGAAAGTCAGCCCTCGATCCAAGTTTTTGTTGGAA199290.2012324566576247No Hit
TTCACAGTGGTTAAGTTCTGTGGAATTCTCGGGTGCCAAGGAACTCCAGT193160.1950427082542365RNA PCR Primer, Index 1 (100% over 30bp)
TGTAAACATCCCCGACTGGAAGCTTGGAATTCTCGGGTGCCAAGGAACTC191540.19340691830097564RNA PCR Primer, Index 1 (100% over 26bp)
GTTTCCGTAGTGTAGTGGTTATCACGTTCGCCTCTGGAATTCTCGGGTGC189890.19174083594117294No Hit
TGAGGTAGTAGTTTGTGCTGTTTGGAATTCTCGGGTGCCAAGGAACTCCA189290.1911349878103356RNA PCR Primer, Index 1 (100% over 28bp)
CATGGCTGATGACCTTTGATGCGTTAGACTTCTGATTTAAAAATGAAGTC185910.1877220433399519No Hit
TCCCATATGGTCTAGCGGTTAGGATTCCTTGGAATTCTCGGGTGCCAAGG183960.18575303691473052Illumina Small RNA Adapter 2 (100% over 21bp)
GTGGGCTCTGGTAGTCCAGTGGCAAGATCGTCTGACTTACGTTTTGGAAT183020.18480387484308533No Hit
TCGTACCGTGAGTAATAATGCATGGAATTCTCGGGTGCCAAGGAACTCCA178530.18027011133065252RNA PCR Primer, Index 1 (100% over 28bp)
CATTATTACTTTTGGTACGCGTGGAATTCTCGGGTGCCAAGGAACTCCAG177640.17937143660324378RNA PCR Primer, Index 1 (100% over 29bp)
TGAGATGAAGCACTGTAGCTCTTGGAATTCTCGGGTGCCAAGGAACTCCA174580.17628161113597332RNA PCR Primer, Index 1 (100% over 28bp)
TGAGGTAGTAGGTTGTATAGTTTTGGAATTCTCGGGTGCCAAGGAACTCC174330.1760291744147911RNA PCR Primer, Index 1 (100% over 27bp)
ACTGGACAACTCTTAGCGGTGGAATTCTCGGGTGCCAAGGAACTCCAGTC172610.17429240977305738RNA PCR Primer, Index 1 (100% over 31bp)
GCATTGTGGTTCAGTGGTAGAATTCTCGCCTGGAATTCTCGGGTGCCAAG166870.1684964626547134No Hit
ATGGCTGATGACCTTTGATGCGTTAGACTTCTGATTTAAAAATGAAGTCA165300.166911160045689No Hit
TGGAGTGTGACAATGGTGTTTGTTGGAATTCTCGGGTGCCAAGGAACTCC165090.16669911319989594RNA PCR Primer, Index 1 (100% over 27bp)
CATTGCACTTGTCTCGGTCTGATGGAATTCTCGGGTGCCAAGGAACTCCA164610.16621443469522607RNA PCR Primer, Index 1 (100% over 28bp)
TACCGTGAAGAATATCACGTCTTTCGCTCCTATCTGATCTGGAATTCTCG163110.1646998143681327No Hit
ATGACCTATGAATTGACAGCCATTGGAATTCTCGGGTGCCAAGGAACTCC162910.16449786499118693RNA PCR Primer, Index 1 (100% over 27bp)
TCCCATATGGTCTAGCGGTTAGGATTCCTGGAATTCTCGGGTGCCAAGGA159640.16119599267812337RNA PCR Primer, Index 1 (100% over 22bp)
TGTAAACATCCTACACTCAGCTTGGAATTCTCGGGTGCCAAGGAACTCCA158230.15977224957065564RNA PCR Primer, Index 1 (100% over 28bp)
ACCGTCGAGCAGCATTCCGGGCTTCACATCGGAGGGCTCCAGCCGGCCCC155810.15732866210961166No Hit
TGAGGTAGTAGGTTGTATAGTTGGAATTCTCGGGTGCCAAGGAACTCCAG154270.15577365190712913RNA PCR Primer, Index 1 (100% over 29bp)
TATTGCACTTGTCCCGGCCTGTTTGGAATTCTCGGGTGCCAAGGAACTCC152430.15391571763922796RNA PCR Primer, Index 1 (100% over 27bp)
GCATTGGTGGTTCAGTGGTAGAATTCTCGCCTTGGAATTCTCGGGTGCCA152070.15355220876072553No Hit
GCATTGGTGGTTCAGTGGTAGAATTCTCGCCTGCCATGGAATTCTCGGGT149340.1507955997654156No Hit
TTCAAGTAATCCAGGATAGGCTGGAATTCTCGGGTGCCAAGGAACTCCAG149040.15049267569999694RNA PCR Primer, Index 1 (100% over 29bp)
TTCAAGTAATCCAGGATAGGCTTTGGAATTCTCGGGTGCCAAGGAACTCC142000.14338405763150538RNA PCR Primer, Index 1 (100% over 27bp)
TAGCTTATCAGACTGGTGTTGGTGGAATTCTCGGGTGCCAAGGAACTCCA139690.1410515423277816RNA PCR Primer, Index 1 (100% over 28bp)
AACTGGACAACTCTTAGCGGTGGAATTCTCGGGTGCCAAGGAACTCCAGT137800.13914312071564397RNA PCR Primer, Index 1 (100% over 30bp)
TTTTGCAGAAACGTTTCAGATTTGGAATTCTCGGGTGCCAAGGAACTCCA132740.1340338014789157RNA PCR Primer, Index 1 (100% over 28bp)
TGTAAACATCCCCGACTGGAAGCTGGAATTCTCGGGTGCCAAGGAACTCC131970.13325629637767442RNA PCR Primer, Index 1 (100% over 27bp)
TCCCTGGTGGTCTAGTGGTTAGGATTCGTGGAATTCTCGGGTGCCAAGGA130240.13150943426709338RNA PCR Primer, Index 1 (100% over 22bp)
TGGAGTGTGACAATGGTGTTTTGGAATTCTCGGGTGCCAAGGAACTCCAG129240.13049968738236448RNA PCR Primer, Index 1 (100% over 29bp)
TCGTACCGTGAGTAATAATGCTGGAATTCTCGGGTGCCAAGGAACTCCAG123100.12429984151012896RNA PCR Primer, Index 1 (100% over 29bp)
TGGAATTCTCGGGTGCCAAGGAACTCCAGTCACTAGCTTATCTCGTATGC123060.12425945163473981RNA PCR Primer, Index 10 (100% over 50bp)
CAGATGTGATGAGCCAGTGATCTCCCGATCCTCTGTGAAGATTCAAAAGA120650.12182596164254315No Hit
CACCTTGCGGCCCCGGGTTCCTCCCGGGGCTACGCCTGTCTGAGGGTCGC116780.11791824119864226No Hit
CGCTGCGATCCATTGAAAGTCAGCCCTCGATCCAAGTTTTTGTTGGAATT115600.11672673987466214No Hit
TATTGCACTTGTCCCGGCCTGTATGGAATTCTCGGGTGCCAAGGAACTCC115510.11663586265503653RNA PCR Primer, Index 1 (100% over 27bp)
ACAGTAGTCTGCACATTGGTTATGGAATTCTCGGGTGCCAAGGAACTCCA115490.11661566771734196RNA PCR Primer, Index 1 (100% over 28bp)
TACCCTGTAGAACCGAATTTGCGTGGAATTCTCGGGTGCCAAGGAACTCC115090.11621176896345038RNA PCR Primer, Index 1 (100% over 27bp)
TTTCTATGATGATGAATGTTCAGTTCTGCTACTGAATGGAAGTGGTGATA114330.11544436133105643No Hit
TGTAAACATCCTTGACTGGAAGCTGGAATTCTCGGGTGCCAAGGAACTCC113470.11457597901018957RNA PCR Primer, Index 1 (100% over 27bp)
TCCCTGGTGGTCTAGTGGTTAGGATTCGGCGCTCTCACCGCCGCGGCCCG111940.11303106627655432No Hit
GAGCAATGAGGATAAAAACTCAACAGAGATGTACTGTGGTGATCGTATAC109100.11016338512392422No Hit
TGTTGCTGGAGAAAAAGTTACACCTCTGACCTGGAATTCTCGGGTGCCAA108240.10929500280305736No Hit
AACAGCTGTTGAGAAATAATCGATCTGACATGGAATTCTCGGGTGCCAAG107480.10852759517066338No Hit
TCACAGTGAACCGGTCTCTTTTGGAATTCTCGGGTGCCAAGGAACTCCAG105740.10677063559123506RNA PCR Primer, Index 1 (100% over 29bp)
AAGCTGCCAGCTGAAGAACTTGGAATTCTCGGGTGCCAAGGAACTCCAGT103960.10497328613641763RNA PCR Primer, Index 1 (100% over 30bp)
GTCAGATGATGACACATCTCCGGAATCTCTGCACTATGTTGATGAAAAAT103070.1040746114090089No Hit
AACTCTTAGCGGTGGATCACTCGGCTCGTGCGTCGATGAAGAACGCAGCT101360.10234794423612244No Hit
CTGTTGTGATGTGATCTTGTGATCCTGATGCTCATGAAGGCTCATACTGA99580.10055059478130499No Hit
AAGTTCTGTGATACACTCAGACTTGGAATTCTCGGGTGCCAAGGAACTCC99240.10020728084049715RNA PCR Primer, Index 1 (100% over 27bp)

[FAIL]Adapter Content

Adapter graph

[FAIL]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
CTCGTAC7450.044.0399931
CGTATTC502.7284841E-1144.0228643
AATTACG351.4479338E-743.99863435
CGCTTAT1900.043.9986335
TTAACGT1200.043.9970742
GGGTACG207.862354E-443.9966322
TATTTCG302.5311E-643.9964123
TAGGGCC8150.043.9964124
TTCGACA254.4475782E-543.9961928
AGCCATA254.4485067E-543.99463318
CGCGCTA254.4485067E-543.99463318
TTATCAT351.4489706E-743.99463319
TAGGCTA1200.043.99463317
TACGTGT254.4485067E-543.99463317
TCAATAC351.4491343E-743.9939712
CTATTCC254.4489043E-543.9939710
TATTGCC600.043.99396511
TATGTTA207.8647E-443.99396513
TAGTATA1150.043.9939658
ATATCGT254.4498323E-543.9924135