FastQCFastQC Report
Mon 5 Dec 2016
JG66_1_GAGTGG_L001_R1_001.fastq

Summary

[OK]Basic Statistics

MeasureValue
FilenameJG66_1_GAGTGG_L001_R1_001.fastq
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences22668120
Sequences flagged as poor quality0
Sequence length50
%GC50

[OK]Per base sequence quality

Per base quality graph

[FAIL]Per tile sequence quality

Per base quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[FAIL]Per base sequence content

Per base sequence content

[FAIL]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[OK]Sequence Length Distribution

Sequence length distribution

[FAIL]Sequence Duplication Levels

Duplication level graph

[FAIL]Overrepresented sequences

SequenceCountPercentagePossible Source
AACATTCAACGCTGTCGGTGAGTGGAATTCTCGGGTGCCAAGGAACTCCA16015557.065230817553463RNA PCR Primer, Index 1 (100% over 28bp)
AACATTCAACGCTGTCGGTGAGTTGGAATTCTCGGGTGCCAAGGAACTCC12504295.516244840771974RNA PCR Primer, Index 1 (100% over 27bp)
TTCAAGTAATCCAGGATAGGCTTGGAATTCTCGGGTGCCAAGGAACTCCA11861145.232520385457638RNA PCR Primer, Index 1 (100% over 28bp)
TCACAGTGAACCGGTCTCTTTTGGAATTCTCGGGTGCCAAGGAACTCCAG8452923.7289903176796315RNA PCR Primer, Index 1 (100% over 29bp)
TGAGGTAGTAGGTTGTATAGTTTGGAATTCTCGGGTGCCAAGGAACTCCA4685842.0671498121591028RNA PCR Primer, Index 1 (100% over 28bp)
AACATTCAACGCTGTCGGTGATGGAATTCTCGGGTGCCAAGGAACTCCAG3595141.5859894865564501RNA PCR Primer, Index 1 (100% over 29bp)
TTGCATAGTCACAAAAGTGATCTGGAATTCTCGGGTGCCAAGGAACTCCA2500011.1028748744933414RNA PCR Primer, Index 1 (100% over 28bp)
TAAAGCTAGAGAACCGAAAGTATGGAATTCTCGGGTGCCAAGGAACTCCA2204840.9726611646665008RNA PCR Primer, Index 1 (100% over 28bp)
TCCCTGAGACCCTTAACCTGTGTGGAATTCTCGGGTGCCAAGGAACTCCA2122930.9365267168163924RNA PCR Primer, Index 1 (100% over 28bp)
AGCTACATCTGGCTACTGGGTCTCTGGAATTCTCGGGTGCCAAGGAACTC1906250.8409387280462606RNA PCR Primer, Index 1 (100% over 26bp)
TTAAAGGGAATTTGCGACTGTTTGGAATTCTCGGGTGCCAAGGAACTCCA1808360.7977547321965827RNA PCR Primer, Index 1 (100% over 28bp)
TAGCTTATCAGACTGGTGTTGGCTGGAATTCTCGGGTGCCAAGGAACTCC1719210.758426371485593RNA PCR Primer, Index 1 (100% over 27bp)
TCACAGTGAACCGGTCTCTTTTTGGAATTCTCGGGTGCCAAGGAACTCCA1675070.7389540905906622RNA PCR Primer, Index 1 (100% over 28bp)
AAGCTGCCAGCTGAAGAACTGTTGGAATTCTCGGGTGCCAAGGAACTCCA1671760.7374938900976349RNA PCR Primer, Index 1 (100% over 28bp)
TCCCTGAGACCCTTAACCTGTGATGGAATTCTCGGGTGCCAAGGAACTCC1580550.6972567641251237RNA PCR Primer, Index 1 (100% over 27bp)
TCACAGTGAACCGGTCTCTTTGGAATTCTCGGGTGCCAAGGAACTCCAGT1488800.656781418132602RNA PCR Primer, Index 1 (100% over 30bp)
TCTTTGGTTATCTAGCTGTATTGGAATTCTCGGGTGCCAAGGAACTCCAG1384280.6106726098150177RNA PCR Primer, Index 1 (100% over 29bp)
AACATTCATTGCTGTCGGTGGGTGGAATTCTCGGGTGCCAAGGAACTCCA1382410.6098476627086852RNA PCR Primer, Index 1 (100% over 28bp)
TTCACAGTGGCTAAGTTCTGCTGGAATTCTCGGGTGCCAAGGAACTCCAG1362660.6011349860508943RNA PCR Primer, Index 1 (100% over 29bp)
TACCCTGTAGAACCGAATTTGTTGGAATTCTCGGGTGCCAAGGAACTCCA1349270.5952280118510049RNA PCR Primer, Index 1 (100% over 28bp)
CCTGTCTGAGGGTCGCTTGGAATTCTCGGGTGCCAAGGAACTCCAGTCAC1339040.5907150659163618RNA PCR Primer, Index 1 (100% over 33bp)
TACCCTGTAGAACCGAATGTGTTGGAATTCTCGGGTGCCAAGGAACTCCA1267350.5590891525190443RNA PCR Primer, Index 1 (100% over 28bp)
TAACAGTCTACAGTCATGGCTTGGAATTCTCGGGTGCCAAGGAACTCCAG1267300.5590670951097841RNA PCR Primer, Index 1 (100% over 29bp)
TCTTTGGTTATCTAGCTGTATGATGGAATTCTCGGGTGCCAAGGAACTCC1254580.5534556901939817RNA PCR Primer, Index 1 (100% over 27bp)
AACATTCATTGCTGTCGGTGGGTTGGAATTCTCGGGTGCCAAGGAACTCC1138070.5020575151357942RNA PCR Primer, Index 1 (100% over 27bp)
TGAGGTAGTAGTTTGTGCTGTTTGGAATTCTCGGGTGCCAAGGAACTCCA1102760.4864805727162199RNA PCR Primer, Index 1 (100% over 28bp)
AGCTACATCTGGCTACTGGGTCTTGGAATTCTCGGGTGCCAAGGAACTCC1073980.4737843279460317RNA PCR Primer, Index 1 (100% over 27bp)
TATTGCACTCGTCCCGGCCTCCTGGAATTCTCGGGTGCCAAGGAACTCCA1073720.4736696294178785RNA PCR Primer, Index 1 (100% over 28bp)
AAGCTGCCAGCTGAAGAACTTGGAATTCTCGGGTGCCAAGGAACTCCAGT1072270.47302996454933177RNA PCR Primer, Index 1 (100% over 30bp)
TGAGGTAGTAGTTTGTATAGTTTGGAATTCTCGGGTGCCAAGGAACTCCA1071210.47256234747301495RNA PCR Primer, Index 1 (100% over 28bp)
TTCACAGTGGCTAAGTTCTGTGGAATTCTCGGGTGCCAAGGAACTCCAGT1069770.47192709408632033RNA PCR Primer, Index 1 (100% over 30bp)
TAAAGCTAGAGAACCGAAAGTTGGAATTCTCGGGTGCCAAGGAACTCCAG1000280.44127170669645305RNA PCR Primer, Index 1 (100% over 29bp)
TCCAGCATCAGTGATTTTGTTGTGGAATTCTCGGGTGCCAAGGAACTCCA979070.4319149536882635RNA PCR Primer, Index 1 (100% over 28bp)
ACCTTGGCTTTAGACTGCTTACTTGGAATTCTCGGGTGCCAAGGAACTCC933600.41185594570701056RNA PCR Primer, Index 1 (100% over 27bp)
AACCCGTAGATCCGAACTTGTGTGGAATTCTCGGGTGCCAAGGAACTCCA903300.3984891556953113RNA PCR Primer, Index 1 (100% over 28bp)
TCCAGCATCAGTGATTTTGTTTGGAATTCTCGGGTGCCAAGGAACTCCAG886450.3910558087746138RNA PCR Primer, Index 1 (100% over 29bp)
TCCCTGAGACCCTAACTTGTGATGGAATTCTCGGGTGCCAAGGAACTCCA858820.3788668844174109RNA PCR Primer, Index 1 (100% over 28bp)
TTCCCTTTGTCATCCTATGCCTGTGGAATTCTCGGGTGCCAAGGAACTCC840700.3708732793015036RNA PCR Primer, Index 1 (100% over 27bp)
TCTTTGGTTATCTAGCTGTATGTGGAATTCTCGGGTGCCAAGGAACTCCA828130.36532804661348184RNA PCR Primer, Index 1 (100% over 28bp)
TACCCTGTAGATCCGGATTTGTTGGAATTCTCGGGTGCCAAGGAACTCCA786990.34717921027416476RNA PCR Primer, Index 1 (100% over 28bp)
TCCCTGAGACCCTTAACCTGTTGGAATTCTCGGGTGCCAAGGAACTCCAG769440.33943705962382414RNA PCR Primer, Index 1 (100% over 29bp)
TAAAGGGAATTTGCGACTGTTTGGAATTCTCGGGTGCCAAGGAACTCCAG717900.31670028215837925RNA PCR Primer, Index 1 (100% over 29bp)
TGAGGTAGTAGGTTGTATAGTTGGAATTCTCGGGTGCCAAGGAACTCCAG689920.30435695593635465RNA PCR Primer, Index 1 (100% over 29bp)
CTACGCCTGTCTGAGGGTCGCTTGGAATTCTCGGGTGCCAAGGAACTCCA680570.3002322204046917RNA PCR Primer, Index 1 (100% over 28bp)
CCCTGAGACCCTTAACCTGTGATGGAATTCTCGGGTGCCAAGGAACTCCA669890.2955207577867066RNA PCR Primer, Index 1 (100% over 28bp)
AGCTGGTGTTGTGAATCAGGCCGTGGAATTCTCGGGTGCCAAGGAACTCC669520.2953575329581809RNA PCR Primer, Index 1 (100% over 27bp)
AGCTACATTGTCTGCTGGGTTTTGGAATTCTCGGGTGCCAAGGAACTCCA653420.2882550471763869RNA PCR Primer, Index 1 (100% over 28bp)
CTGTCTGAGGGTCGCTTGGAATTCTCGGGTGCCAAGGAACTCCAGTCACG624440.2754705727691577RNA PCR Primer, Index 6 (100% over 34bp)
TGAGGTAGTTGGTTGTATAGTTTGGAATTCTCGGGTGCCAAGGAACTCCA606270.26745491024399026RNA PCR Primer, Index 1 (100% over 28bp)
TTCAAGTAATCCAGGATAGGTTTGGAATTCTCGGGTGCCAAGGAACTCCA567260.250245719539159RNA PCR Primer, Index 1 (100% over 28bp)
TACCCTGTAGAACCGAATTTGCGTGGAATTCTCGGGTGCCAAGGAACTCC559680.2469018162953081RNA PCR Primer, Index 1 (100% over 27bp)
AAGCTGCCAGTTGAAGAGCTGTTGGAATTCTCGGGTGCCAAGGAACTCCA557670.2460151084430469RNA PCR Primer, Index 1 (100% over 28bp)
TTCAAGTAATCCAGGATAGGCTGGAATTCTCGGGTGCCAAGGAACTCCAG552330.24365937713405433RNA PCR Primer, Index 1 (100% over 29bp)
TATTGCACTTGTCCCGGCCTGTTGGAATTCTCGGGTGCCAAGGAACTCCA501780.22135933637196203RNA PCR Primer, Index 1 (100% over 28bp)
TTCAAGTAATCCAGGATAGGCTTTGGAATTCTCGGGTGCCAAGGAACTCC499880.22052115482007328RNA PCR Primer, Index 1 (100% over 27bp)
AGCTACATTGTCTGCTGGGTTTCTGGAATTCTCGGGTGCCAAGGAACTCC497610.21951974843965888RNA PCR Primer, Index 1 (100% over 27bp)
TCTTTGGTTATCTAGCTGTATGTTGGAATTCTCGGGTGCCAAGGAACTCC487770.21517885029724565RNA PCR Primer, Index 1 (100% over 27bp)
TTGCATAGTCACAAAAATGAGCTGGAATTCTCGGGTGCCAAGGAACTCCA483730.21339661162901907RNA PCR Primer, Index 1 (100% over 28bp)
TGTAAACATCCTTGACTGGAAGCTTGGAATTCTCGGGTGCCAAGGAACTC473790.20901159866808539RNA PCR Primer, Index 1 (100% over 26bp)
AGAATAATGCCAGCAGTCGGTCTGGAATTCTCGGGTGCCAAGGAACTCCA463420.20443689198751375RNA PCR Primer, Index 1 (100% over 28bp)
TAGCAGCACGTAAATATTGGAGTGGAATTCTCGGGTGCCAAGGAACTCCA459190.2025708351640983RNA PCR Primer, Index 1 (100% over 28bp)
TGCTCAGTAGTCAGTGTAGATCCTGGAATTCTCGGGTGCCAAGGAACTCC455290.20085035724180036RNA PCR Primer, Index 1 (100% over 27bp)
TGATGTAGTAGGTTGTATAGTTTGGAATTCTCGGGTGCCAAGGAACTCCA452490.1996151423232275RNA PCR Primer, Index 1 (100% over 28bp)
TGAGATGAAGCACTGTAGCTCTTGGAATTCTCGGGTGCCAAGGAACTCCA434500.19167888647139683RNA PCR Primer, Index 1 (100% over 28bp)
TGTCTGAGGGTCGCTTGGAATTCTCGGGTGCCAAGGAACTCCAGTCACGA433150.19108333642137063RNA PCR Primer, Index 7 (97% over 35bp)
TACCCTGTAGAACCGAATTTGCTGGAATTCTCGGGTGCCAAGGAACTCCA426520.18815852395346416RNA PCR Primer, Index 1 (100% over 28bp)
TAGCTTATCAGACTGGTGTTGGTGGAATTCTCGGGTGCCAAGGAACTCCA396490.17491084395177017RNA PCR Primer, Index 1 (100% over 28bp)
ACCGTGGCTTTAGATTGTTACTTGGAATTCTCGGGTGCCAAGGAACTCCA392100.17297420341872197RNA PCR Primer, Index 1 (100% over 28bp)
TGCTCAGTAGTCAGTGTAGATCTGGAATTCTCGGGTGCCAAGGAACTCCA391180.17256834708833374RNA PCR Primer, Index 1 (100% over 28bp)
AACATTCAACGCTGTCGGTGGTGGAATTCTCGGGTGCCAAGGAACTCCAG383880.1693479653363402RNA PCR Primer, Index 1 (100% over 29bp)
AACAGTCAACGCTGTCGGTGAGTGGAATTCTCGGGTGCCAAGGAACTCCA383770.1692994390359677RNA PCR Primer, Index 1 (100% over 28bp)
TGAGATGAAGCACTGTAGCTCTGGAATTCTCGGGTGCCAAGGAACTCCAG364660.16086909721670786RNA PCR Primer, Index 1 (100% over 29bp)
TACCCTGTAGATCCGGATTTGTGTGGAATTCTCGGGTGCCAAGGAACTCC362570.15994709750963026RNA PCR Primer, Index 1 (100% over 27bp)
TTCCCTTTGTCATCCTATGCCTTGGAATTCTCGGGTGCCAAGGAACTCCA354850.15654143351985078RNA PCR Primer, Index 1 (100% over 28bp)
ACCATCGACCGTTGACTGTGCCTGGAATTCTCGGGTGCCAAGGAACTCCA343940.15172850681926864RNA PCR Primer, Index 1 (100% over 28bp)
AGCAGCATTGTACAGGGCTATGATGGAATTCTCGGGTGCCAAGGAACTCC329030.14515098737786813RNA PCR Primer, Index 1 (100% over 27bp)
GTACAGTACTGTGATAACTGATGGAATTCTCGGGTGCCAAGGAACTCCAG322930.14245998344812008RNA PCR Primer, Index 1 (100% over 29bp)
TGAGGTAGTAGGTTGTATAGTTTTGGAATTCTCGGGTGCCAAGGAACTCC317390.1400160225020866RNA PCR Primer, Index 1 (100% over 27bp)
TAAATCTAGAGAACCGAAAGTATGGAATTCTCGGGTGCCAAGGAACTCCA311400.1373735448727111RNA PCR Primer, Index 1 (100% over 28bp)
CTTTGGTTATCTAGCTGTATGATGGAATTCTCGGGTGCCAAGGAACTCCA310550.1369985689152872RNA PCR Primer, Index 1 (100% over 28bp)
ACCATCGACCGTTGACTGTACCTGGAATTCTCGGGTGCCAAGGAACTCCA308780.13621773662747505RNA PCR Primer, Index 1 (100% over 28bp)
AACATTCAACGCTGTCGGTGAGATGGAATTCTCGGGTGCCAAGGAACTCC304190.13419286645738598RNA PCR Primer, Index 1 (100% over 27bp)
CATTATTACTTTTGGTACGCGTGGAATTCTCGGGTGCCAAGGAACTCCAG295260.1302534131635089RNA PCR Primer, Index 1 (100% over 29bp)
AACAGTCAACGCTGTCGGTGAGTTGGAATTCTCGGGTGCCAAGGAACTCC292430.12900496379937992RNA PCR Primer, Index 1 (100% over 27bp)
TAACAGTCTACAGCCATGGTCGTGGAATTCTCGGGTGCCAAGGAACTCCA291730.12869616006973672RNA PCR Primer, Index 1 (100% over 28bp)
TTGCGGCCCCGGGTTCCTCCCGGGGCTACGCCTGTCTGAGGGTCGCTTGG290580.12818883965675143No Hit
TTAGGTAGTAGGTTGTATAGTTTGGAATTCTCGGGTGCCAAGGAACTCCA285010.1257316442651618RNA PCR Primer, Index 1 (100% over 28bp)
TACAGTACTGTGATAACTGAAGTGGAATTCTCGGGTGCCAAGGAACTCCA283310.124981692350314RNA PCR Primer, Index 1 (100% over 28bp)
TGTAAACATCCTACACTCTCAGCTTGGAATTCTCGGGTGCCAAGGAACTC282830.12476994122141581RNA PCR Primer, Index 1 (100% over 26bp)
TAAAGCTAGAGAACCGAAAGTAATGGAATTCTCGGGTGCCAAGGAACTCC280980.1239538170787873RNA PCR Primer, Index 1 (100% over 27bp)
TTACAATTAAAGGATATTTCTTTGGAATTCTCGGGTGCCAAGGAACTCCA276770.12209658321907595RNA PCR Primer, Index 1 (100% over 28bp)
TACCCTGTAGAACCGAATGTGTGTGGAATTCTCGGGTGCCAAGGAACTCC274580.12113046869347789RNA PCR Primer, Index 1 (100% over 27bp)
AAGCTGCCAGCTGAAGAACTGCTGGAATTCTCGGGTGCCAAGGAACTCCA273540.1206716745808651RNA PCR Primer, Index 1 (100% over 28bp)
TGAGGTAGTTGGTTGTATTGTTTGGAATTCTCGGGTGCCAAGGAACTCCA273010.12043786604270666RNA PCR Primer, Index 1 (100% over 28bp)
AAGGTCCAACCTCACATGTCCTTGGAATTCTCGGGTGCCAAGGAACTCCA269240.11877473738448535RNA PCR Primer, Index 1 (100% over 28bp)
AACATTCATTGCTGTCGGTGGGTTTGGAATTCTCGGGTGCCAAGGAACTC268670.11852328291891871RNA PCR Primer, Index 1 (100% over 26bp)
AAGCCCTTACCCCAAAAAGCATTGGAATTCTCGGGTGCCAAGGAACTCCA266940.11776009655851478RNA PCR Primer, Index 1 (100% over 28bp)
AACATTCAACGCTGTCGGTGAGTTTGGAATTCTCGGGTGCCAAGGAACTC262730.11590286269880343RNA PCR Primer, Index 1 (100% over 26bp)
TGAGGTAGTAGGTTGTGTGGTTTGGAATTCTCGGGTGCCAAGGAACTCCA260940.11511320744728722RNA PCR Primer, Index 1 (100% over 28bp)
AACATTCAACGCTGTCGGTGTGGAATTCTCGGGTGCCAAGGAACTCCAGT244740.10796660684697275RNA PCR Primer, Index 1 (100% over 30bp)
TCCCTGAGACCCTAACTTGTGTGGAATTCTCGGGTGCCAAGGAACTCCAG243080.10723430085953312RNA PCR Primer, Index 1 (100% over 29bp)
AACTTTCAACGCTGTCGGTGAGTGGAATTCTCGGGTGCCAAGGAACTCCA237740.10487856955054059RNA PCR Primer, Index 1 (100% over 28bp)
TCCCTGAGACCCTTAACCTGTGGTGGAATTCTCGGGTGCCAAGGAACTCC236630.10438889506496347RNA PCR Primer, Index 1 (100% over 27bp)
TCACAGTGAACCGGTCTCTTGGAATTCTCGGGTGCCAAGGAACTCCAGTC232720.10266400566081352RNA PCR Primer, Index 1 (100% over 31bp)
TGAGGTAGTAGATTGAATAGTTTGGAATTCTCGGGTGCCAAGGAACTCCA229830.10138908740557223RNA PCR Primer, Index 1 (100% over 28bp)
TAAGGCACGCGGTGAATGCCTGGAATTCTCGGGTGCCAAGGAACTCCAGT229340.10117292479482197RNA PCR Primer, Index 1 (100% over 30bp)
AATATTCAACGCTGTCGGTGAGTGGAATTCTCGGGTGCCAAGGAACTCCA228500.10080236031925012RNA PCR Primer, Index 1 (100% over 28bp)

[FAIL]Adapter Content

Adapter graph

[WARN]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
ACGTCTA207.8786555E-443.978381
TATACGG302.538396E-643.9783741
TACGTAA850.043.9783741
TATATGT502.7284841E-1143.9641152
AGTACAA254.4669483E-543.9641152
CCCTATA5050.043.964023
CAATATC502.7284841E-1143.964023
AATACGT207.891334E-443.9640163
CGAGTAA19500.043.9640123
CAGCGCG302.5445315E-643.962954
CGATTAA551.8189894E-1243.962954
ACGCGAC408.38736E-943.9619817
GATACGT302.5449172E-643.9619815
ACACTAA900.043.960439
GCTATCG5000.043.96042611
CGTAATA650.043.96042611
CCACGTA207.894592E-443.960336
ATCGATA2150.043.960336
AACATTC4277400.043.952671
CGTTCAA49200.043.9193423