FastQCFastQC Report
Mon 5 Dec 2016
JG67_3_CGTACG_L007_R1_001.fastq

Summary

[OK]Basic Statistics

MeasureValue
FilenameJG67_3_CGTACG_L007_R1_001.fastq
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences11471101
Sequences flagged as poor quality0
Sequence length50
%GC52

[OK]Per base sequence quality

Per base quality graph

[OK]Per tile sequence quality

Per base quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[FAIL]Per base sequence content

Per base sequence content

[FAIL]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[OK]Sequence Length Distribution

Sequence length distribution

[FAIL]Sequence Duplication Levels

Duplication level graph

[FAIL]Overrepresented sequences

SequenceCountPercentagePossible Source
ATGACCTATGAATTGACAGCCTGGAATTCTCGGGTGCCAAGGAACTCCAG5387934.696959777444206RNA PCR Primer, Index 1 (100% over 29bp)
ATGACCTATGAATTGACAGCCATGGAATTCTCGGGTGCCAAGGAACTCCA4553713.969723568818721RNA PCR Primer, Index 1 (100% over 28bp)
CCTGTCTGAGGGTCGCTTGGAATTCTCGGGTGCCAAGGAACTCCAGTCAC3419412.980890849099838RNA PCR Primer, Index 1 (100% over 33bp)
TTCAAGTAATCCAGGATAGGCTTGGAATTCTCGGGTGCCAAGGAACTCCA3275422.8553667167606664RNA PCR Primer, Index 1 (100% over 28bp)
TTGCGGCCCCGGGTTCCTCCCGGGGCTACGCCTGTCTGAGGGTCGCTTGG3271652.85208019700986No Hit
TGAGGTAGTAGGTTGTATAGTTTGGAATTCTCGGGTGCCAAGGAACTCCA2727142.3774003907733006RNA PCR Primer, Index 1 (100% over 28bp)
TCAGTAACTGGAATCTGTCCCTTGGAATTCTCGGGTGCCAAGGAACTCCA2569282.2397850040724077RNA PCR Primer, Index 1 (100% over 28bp)
AACATTCAACGCTGTCGGTGAGTTGGAATTCTCGGGTGCCAAGGAACTCC1153611.0056663261878698RNA PCR Primer, Index 1 (100% over 27bp)
AACATTCAACGCTGTCGGTGAGTGGAATTCTCGGGTGCCAAGGAACTCCA1102590.9611893400642187RNA PCR Primer, Index 1 (100% over 28bp)
AAGCTGCCAGCTGAAGAACTGTTGGAATTCTCGGGTGCCAAGGAACTCCA1102200.9608493552624112RNA PCR Primer, Index 1 (100% over 28bp)
TAGCTTATCAGACTGGTGTTGGCTGGAATTCTCGGGTGCCAAGGAACTCC1080890.942272236989283RNA PCR Primer, Index 1 (100% over 27bp)
CTACGCCTGTCTGAGGGTCGCTTGGAATTCTCGGGTGCCAAGGAACTCCA1061470.9253427373710684RNA PCR Primer, Index 1 (100% over 28bp)
TATTGCACTTGTCCCGGCCTGTTGGAATTCTCGGGTGCCAAGGAACTCCA805830.7024870585656948RNA PCR Primer, Index 1 (100% over 28bp)
CTGTCTGAGGGTCGCTTGGAATTCTCGGGTGCCAAGGAACTCCAGTCACC768180.66966544885273RNA PCR Primer, Index 2 (100% over 34bp)
TCAGTAACTGGAATCTGTCCCTGCTGGAATTCTCGGGTGCCAAGGAACTC719780.6274724631925044RNA PCR Primer, Index 1 (100% over 26bp)
GCATTGGTGGTTCAGTGGTAGAATTCTCGCCTTGGAATTCTCGGGTGCCA685530.5976148235465802No Hit
TGAGGTAGTAGTTTGTATAGTTTGGAATTCTCGGGTGCCAAGGAACTCCA684190.5964466706378054RNA PCR Primer, Index 1 (100% over 28bp)
ATCCATGATGACATTAAAACATAACGTGACTGTTGGATGAAGCTTGCGGA644370.561733350617347No Hit
GTTTCCGTAGTGTAGTGGTTATCACGTTCGCCTTGGAATTCTCGGGTGCC601080.5239950376167031No Hit
GATCCATGATGACATTAAAACATAACGTGACTGTTGGATGAAGCTTGCGG569760.4966916427638463No Hit
TGAGATGAAGCACTGTAGCTCTGGAATTCTCGGGTGCCAAGGAACTCCAG529430.4615337272333318RNA PCR Primer, Index 1 (100% over 29bp)
CCGTCGAGCAGCATTCCGGGCTTCACATCGGAGGGCTCCAGCCGGCCCCG515030.4489804422435126No Hit
TGTCTGAGGGTCGCTTGGAATTCTCGGGTGCCAAGGAACTCCAGTCACCG511880.44623441115198964RNA PCR Primer, Index 2 (100% over 35bp)
TCAGTAACTGGAATCTGTCCCTGTGGAATTCTCGGGTGCCAAGGAACTCC481310.419584833225686RNA PCR Primer, Index 1 (100% over 27bp)
TGTAAACATCCTTGACTGGAAGCTTGGAATTCTCGGGTGCCAAGGAACTC470730.4103616557817772RNA PCR Primer, Index 1 (100% over 26bp)
GTTTCCGTAGTGTAGTGGTTATCACGTTCGCCTCTGGAATTCTCGGGTGC469540.4093242662583129No Hit
TTCACAGTGGCTAAGTTCTGTGGAATTCTCGGGTGCCAAGGAACTCCAGT464830.4052182959595596RNA PCR Primer, Index 1 (100% over 30bp)
TGAGATGAAGCACTGTAGCTCTTGGAATTCTCGGGTGCCAAGGAACTCCA459770.40080721109508144RNA PCR Primer, Index 1 (100% over 28bp)
GCCCGGCTAGCTCAGTCGGTAGAGCATGAGACTCTGGAATTCTCGGGTGC443630.3867370708356591No Hit
TTCACAGTGGCTAAGTTCTGCTGGAATTCTCGGGTGCCAAGGAACTCCAG426310.3716382586117932RNA PCR Primer, Index 1 (100% over 29bp)
CCACGTTCCCGTGGTGGAATTCTCGGGTGCCAAGGAACTCCAGTCACCGT422280.368125082326448RNA PCR Primer, Index 12 (97% over 36bp)
TGGAGTGTGACAATGGTGTTTGTGGAATTCTCGGGTGCCAAGGAACTCCA413090.36011364558641756RNA PCR Primer, Index 1 (100% over 28bp)
TTCAGTGATGTTTGACAAATGTCTGACCTGAACTGCAATGTGGACAGATC394780.3441517950195016No Hit
AGAGATGATGACTTCTGTTACCGCCCCAGTCTGAGAAGTCATGACTGATC391660.3414319166050408No Hit
CTTCGAACGCACCTTGCGGCCCCGGGTTCCTCCCGGGGCTACGCCTGTCT380770.33193849483149No Hit
GGACAACTCTTAGCGGTGGAATTCTCGGGTGCCAAGGAACTCCAGTCACC365850.31893189677259404RNA PCR Primer, Index 2 (100% over 34bp)
TTCAAGTAATCCAGGATAGGTTTGGAATTCTCGGGTGCCAAGGAACTCCA362990.3164386748926716RNA PCR Primer, Index 1 (100% over 28bp)
TGTAAACATCCTACACTCTCAGCTTGGAATTCTCGGGTGCCAAGGAACTC339730.2961616326105053RNA PCR Primer, Index 1 (100% over 26bp)
TTCACAGTGGTTAAGTTCTGTGGAATTCTCGGGTGCCAAGGAACTCCAGT324250.2826668512464497RNA PCR Primer, Index 1 (100% over 30bp)
TACGCCTGTCTGAGGGTCGCTTGGAATTCTCGGGTGCCAAGGAACTCCAG298930.2605939918060176RNA PCR Primer, Index 1 (100% over 29bp)
CTGGACAACTCTTAGCGGTGGAATTCTCGGGTGCCAAGGAACTCCAGTCA292550.255032189150806RNA PCR Primer, Index 1 (100% over 32bp)
TGAGGTAGTAGGTTGTATAGTTGGAATTCTCGGGTGCCAAGGAACTCCAG284020.24759611130614226RNA PCR Primer, Index 1 (100% over 29bp)
TCCCTGGTGGTCTAGTGGTTAGGATTTGGCGCTCTGGAATTCTCGGGTGC269140.23462438348332912No Hit
AACATTCAACGCTGTCGGTGATGGAATTCTCGGGTGCCAAGGAACTCCAG262150.22853080972785436RNA PCR Primer, Index 1 (100% over 29bp)
TGAGGTAGTAGGTTGTATAGTTTTGGAATTCTCGGGTGCCAAGGAACTCC259230.22598528249380773RNA PCR Primer, Index 1 (100% over 27bp)
GCATTGGTGGTTCAGTGGTAGAATTCTCGCCTGGAATTCTCGGGTGCCAA257110.22413715998141764No Hit
TGAGGTAGTAGATTGAATAGTTTGGAATTCTCGGGTGCCAAGGAACTCCA256360.22348334305486456RNA PCR Primer, Index 1 (100% over 28bp)
TGAGGTAGTAGTTTGTGCTGTTTGGAATTCTCGGGTGCCAAGGAACTCCA256090.22324796896130544RNA PCR Primer, Index 1 (100% over 28bp)
TGAGATGAAGCACTGTAGCTTGGAATTCTCGGGTGCCAAGGAACTCCAGT236780.20641436249231876RNA PCR Primer, Index 1 (100% over 30bp)
TTGCGGCCCCGGGTTCCTCCCGGGGCTACGCCTGTCTGAGGGTCGCTTTG236660.20630975178407024No Hit
CATTATTACTTTTGGTACGCGTGGAATTCTCGGGTGCCAAGGAACTCCAG235270.20509801108019188RNA PCR Primer, Index 1 (100% over 29bp)
ACAGTAGTCTGCACATTGGTTTGGAATTCTCGGGTGCCAAGGAACTCCAG235160.2050021179309641RNA PCR Primer, Index 1 (100% over 29bp)
ATGACCTATGAATTGACAGCCATTGGAATTCTCGGGTGCCAAGGAACTCC232490.20267452967243513RNA PCR Primer, Index 1 (100% over 27bp)
GCATTGTGGTTCAGTGGTAGAATTCTCGCCTTGGAATTCTCGGGTGCCAA229980.20048642235823746No Hit
GCCCGGCTAGCTCAGTCGGTAGAGCATGAGACTTGGAATTCTCGGGTGCC228370.1990828953559035No Hit
CCTGTCTGAGGGTCGCTTTGGAATTCTCGGGTGCCAAGGAACTCCAGTCA228360.1990741777968828RNA PCR Primer, Index 1 (100% over 32bp)
TCGCTGCGATCCATTGAAAGTCAGCCCTCGATCCAAGTTTTTGTTGGAAT226280.19726092552057556No Hit
TGTAAACATCCCCGACTGGAAGCTTGGAATTCTCGGGTGCCAAGGAACTC200590.1748655163963773RNA PCR Primer, Index 1 (100% over 26bp)
CTTGCGGCCCCGGGTTCCTCCCGGGGCTACGCCTGTCTGAGGGTCGCTTG200170.17449937891750758No Hit
TAAGATGATGATTAACTCACCATCTTTCGGCTGAAGAATGATGTATACTC198360.17292150073475945No Hit
GTTACATGATGAAACATGTGTTGGTAGGGACATCTGAATGAATGTGATGA197820.17245075254764125No Hit
ATGACCTATGAATTGACAGCTGGAATTCTCGGGTGCCAAGGAACTCCAGT195220.17018418720225723RNA PCR Primer, Index 1 (100% over 30bp)
CATTGCACTTGTCTCGGTCTGATGGAATTCTCGGGTGCCAAGGAACTCCA192890.16815299595043232RNA PCR Primer, Index 1 (100% over 28bp)
TGCCTGTGATGAGACTCTCGACGGGCGGACTGAATGGGTTTTCACCCTCC190150.16576438477875838No Hit
TCGTACCGTGAGTAATAATGCATGGAATTCTCGGGTGCCAAGGAACTCCA188020.1639075447073476RNA PCR Primer, Index 1 (100% over 28bp)
GCATTGGTGGTTCAGTGGTAGAATTCTCGCCTGCTGGAATTCTCGGGTGC186480.16256504061815863No Hit
ACTGGACAACTCTTAGCGGTGGAATTCTCGGGTGCCAAGGAACTCCAGTC185780.1619548114867091RNA PCR Primer, Index 1 (100% over 31bp)
AACCCGTAGATCCGAACTTGTGTGGAATTCTCGGGTGCCAAGGAACTCCA181640.15834574205213606RNA PCR Primer, Index 1 (100% over 28bp)
TTCCAGTGATGACAGCCTATAATCTGACTTGGAATTCTCGGGTGCCAAGG175220.15274906916084166Illumina Small RNA Adapter 2 (100% over 21bp)
TGGAATTCTCGGGTGCCAAGGAACTCCAGTCACCGTACGATCTCGTATGC171330.14935793870178635RNA PCR Primer, Index 22 (100% over 50bp)
TAGCTTATCAGACTGGTGTTGGTGGAATTCTCGGGTGCCAAGGAACTCCA168250.14667293052340835RNA PCR Primer, Index 1 (100% over 28bp)
CCTCGATCCAAGTTTTTGTTGGAATTCTCGGGTGCCAAGGAACTCCAGTC162690.14182596770789482RNA PCR Primer, Index 1 (100% over 31bp)
AACTCTTAGCGGTGGATCACTCGGCTCGTGCGTCGATGAAGAACGCAGCT160230.1396814481888007No Hit
TCCCTGGTGGTCTAGTGGTTAGGATTCGGCGCTCTGGAATTCTCGGGTGC159250.13882712740477135No Hit
GAAGGATCATTATGGAATTCTCGGGTGCCAAGGAACTCCAGTCACCGTAC156840.13672619568078076RNA PCR Primer, Index 22 (100% over 38bp)
AGCCTGTGATGATACAAGTTATCCCTGTCTGAACTCTGGTGTGGAATTCT156560.13648210402820096No Hit
ATGACCTATGAATTGACAGCCTTGGAATTCTCGGGTGCCAAGGAACTCCA156180.13615083678541406RNA PCR Primer, Index 1 (100% over 28bp)
TTTGTTCGTTCGGCTCGCGTTATGGAATTCTCGGGTGCCAAGGAACTCCA154410.13460782883874878RNA PCR Primer, Index 1 (100% over 28bp)
AACTGGACAACTCTTAGCGGTGGAATTCTCGGGTGCCAAGGAACTCCAGT152930.13331763010368403RNA PCR Primer, Index 1 (100% over 30bp)
CCTTGCGGCCCCGGGTTCCTCCCGGGGCTACGCCTGTCTGAGGGTCGCTT149820.13060646924824393No Hit
TCCCTGTGGTCTAGTGGTTAGGATTTGGCGCTCTGGAATTCTCGGGTGCC149590.13040596539076763No Hit
TGTAAACATCCTACACTCAGCTTGGAATTCTCGGGTGCCAAGGAACTCCA148300.12928140027709634RNA PCR Primer, Index 1 (100% over 28bp)
GCTTACGGCCTGGAATTCTCGGGTGCCAAGGAACTCCAGTCACCGTACGA146220.12746814800078912RNA PCR Primer, Index 22 (100% over 40bp)
TTCAAGTAATCCAGGATAGGCTGGAATTCTCGGGTGCCAAGGAACTCCAG145710.12702355249073302RNA PCR Primer, Index 1 (100% over 29bp)
TGTAACAGCAACTCCATGTGGATGGAATTCTCGGGTGCCAAGGAACTCCA145550.1268840715464017RNA PCR Primer, Index 1 (100% over 28bp)
TATTGCACTTGTCCCGGCCTGTTTGGAATTCTCGGGTGCCAAGGAACTCC143050.12470468179122474RNA PCR Primer, Index 1 (100% over 27bp)
TCAAAGGTTGTGGGTTCGTGTCCCACCGGAGTCGCCATGGAATTCTCGGG140020.12206326140795029No Hit
TTACATGATGAAACATGTGTTGGTAGGGACATCTGAATGAATGTGATGAA138750.12095613141232041No Hit
TCCAGTGATGACAGCCTATAATCTGACTTGGAATTCTCGGGTGCCAAGGA137810.12013668086437387RNA PCR Primer, Index 1 (100% over 22bp)
CTCGCTGCGATCCATTGAAAGTCAGCCCTCGATCCAAGTTTTTGTTGGAA134520.11726860394656101No Hit
TACCCTGTAGATCCGGATTTGTTGGAATTCTCGGGTGCCAAGGAACTCCA134490.11724245126949889RNA PCR Primer, Index 1 (100% over 28bp)
TTTGTTCGTTCGGCTCGCGTTTGGAATTCTCGGGTGCCAAGGAACTCCAG132330.11535945852102603RNA PCR Primer, Index 1 (100% over 29bp)
CGCTGCGATCCATTGAAAGTCAGCCCTCGATCCAAGTTTTTGTTGGAATT130500.11376414522023649No Hit
TGGAGTGTGACAATGGTGTTTGTTGGAATTCTCGGGTGCCAAGGAACTCC130140.11345031309549101RNA PCR Primer, Index 1 (100% over 27bp)
AAGTTCTGTGATACACTCAGACTTGGAATTCTCGGGTGCCAAGGAACTCC126200.11001559484133214RNA PCR Primer, Index 1 (100% over 27bp)
ATCCATGATGACATTAAAACATAACGTGCCTGTTGGATGAAGCTTGCGGA126120.10994585436916648No Hit
TTCACAGTGGTTAAGTTCTGCTGGAATTCTCGGGTGCCAAGGAACTCCAG126010.1098499612199387RNA PCR Primer, Index 1 (100% over 29bp)
TGGCTGTGATGAGAAACTTGCCCTCACTGAAACGTGATTGAGACATCTTT125970.10981509098385586No Hit
TCAGTAACTGGAATCTGTCCCTGCTGGACTTCTCGGGTGCCAAGGAACTC125390.10930947256065482RNA PCR Primer, Index 1 (96% over 26bp)
CGCCTGTCTGAGGGTCGCTTGGAATTCTCGGGTGCCAAGGAACTCCAGTC121640.10604038792788939RNA PCR Primer, Index 1 (100% over 31bp)
TTCAAGTAATCCAGGATAGGCTTTGGAATTCTCGGGTGCCAAGGAACTCC121000.10548246415056409RNA PCR Primer, Index 1 (100% over 27bp)
TACACTGATGACTTCTTAGGACACCTTTGGATTCTTGATGAAAACAAATT119770.10441020439101706No Hit
TTGTTGTGATGAAACTAAACTGAAAATAGCTGGAATTCTCGGGTGCCAAG118130.10298052471162096No Hit

[FAIL]Adapter Content

Adapter graph

[WARN]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
TTATCTC254.443447E-544.0031916
ATATCTA454.802132E-1043.99743712
ATGCCTA254.4468783E-543.99743713
GGGATAG207.861698E-443.99743713
CCTAGTA207.8618666E-443.99724229
TGTATCG302.531564E-643.9953275
AATCTAG351.448825E-743.9953278
TAATCCG207.8635546E-443.9953277
TCAGTAA439050.043.9622731
AACATTC307300.043.954381
TTCAACG284500.043.910275
GCTTATC146100.043.9049873
TCAACGC284500.043.902546
ACATTCA310700.043.876882
CAACGCT284500.043.8716137
CTATGAA1126250.043.8644646
CTTATCA146350.043.860054
GCATGCG15750.043.85795224
ATGCGAC15550.043.8561626
TGACCTA1125000.043.85452