FastQCFastQC Report
Mon 5 Dec 2016
JG67_5_CGTACG_L002_R1_001.fastq

Summary

[OK]Basic Statistics

MeasureValue
FilenameJG67_5_CGTACG_L002_R1_001.fastq
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences12448973
Sequences flagged as poor quality0
Sequence length50
%GC51

[OK]Per base sequence quality

Per base quality graph

[FAIL]Per tile sequence quality

Per base quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[FAIL]Per base sequence content

Per base sequence content

[WARN]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[OK]Sequence Length Distribution

Sequence length distribution

[FAIL]Sequence Duplication Levels

Duplication level graph

[FAIL]Overrepresented sequences

SequenceCountPercentagePossible Source
AACATTCAACGCTGTCGGTGAGTGGAATTCTCGGGTGCCAAGGAACTCCA6058994.867060118131833RNA PCR Primer, Index 1 (100% over 28bp)
TTCAAGTAATCCAGGATAGGCTTGGAATTCTCGGGTGCCAAGGAACTCCA5025414.0368068916206985RNA PCR Primer, Index 1 (100% over 28bp)
AACATTCAACGCTGTCGGTGAGTTGGAATTCTCGGGTGCCAAGGAACTCC4806623.8610574542976352RNA PCR Primer, Index 1 (100% over 27bp)
TTCCCTTTGTCATCCTATGCCTTGGAATTCTCGGGTGCCAAGGAACTCCA3663852.9430941813433127RNA PCR Primer, Index 1 (100% over 28bp)
TACCCTGTAGAACCGAATTTGTTGGAATTCTCGGGTGCCAAGGAACTCCA3079402.4736177032434723RNA PCR Primer, Index 1 (100% over 28bp)
AAGCTGCCAGCTGAAGAACTGTTGGAATTCTCGGGTGCCAAGGAACTCCA2013191.6171534792468423RNA PCR Primer, Index 1 (100% over 28bp)
TAGCTTATCAGACTGGTGTTGGCTGGAATTCTCGGGTGCCAAGGAACTCC1902801.5284794978670129RNA PCR Primer, Index 1 (100% over 27bp)
TCCTTCATTCCACCGGAGTCTGTGGAATTCTCGGGTGCCAAGGAACTCCA1728201.3882269645857532RNA PCR Primer, Index 1 (100% over 28bp)
TGAGGTAGTAGGTTGTATAGTTTGGAATTCTCGGGTGCCAAGGAACTCCA1692431.3594936706827143RNA PCR Primer, Index 1 (100% over 28bp)
AACAGTAAGAGTTTATGTGCTGTGGAATTCTCGGGTGCCAAGGAACTCCA1623421.3040593790347204RNA PCR Primer, Index 1 (100% over 28bp)
TACCCTGTAGAACCGAATTTGCTGGAATTCTCGGGTGCCAAGGAACTCCA1493121.1993921104977898RNA PCR Primer, Index 1 (100% over 28bp)
TATTGCACTTGTCCCGGCCTGTTGGAATTCTCGGGTGCCAAGGAACTCCA1295821.0409051413317387RNA PCR Primer, Index 1 (100% over 28bp)
TACCCTGTAGAACCGAATTTGCGTGGAATTCTCGGGTGCCAAGGAACTCC1247721.0022674159547136RNA PCR Primer, Index 1 (100% over 27bp)
AACATTCAACGCTGTCGGTGATGGAATTCTCGGGTGCCAAGGAACTCCAG1128300.906339824176661RNA PCR Primer, Index 1 (100% over 29bp)
CCTGTCTGAGGGTCGCTTGGAATTCTCGGGTGCCAAGGAACTCCAGTCAC1008830.8103720684429149RNA PCR Primer, Index 1 (100% over 33bp)
GCATTGGTGGTTCAGTGGTAGAATTCTCGCCTTGGAATTCTCGGGTGCCA960710.7717182774836125No Hit
TTCACAGTGGTTAAGTTCTGTGGAATTCTCGGGTGCCAAGGAACTCCAGT690040.5542947197331057RNA PCR Primer, Index 1 (100% over 30bp)
GTTTCCGTAGTGTAGTGGTTATCACGTTCGCCTTGGAATTCTCGGGTGCC689890.5541742278660255No Hit
TTCACAGTGGCTAAGTTCTGTGGAATTCTCGGGTGCCAAGGAACTCCAGT672080.539867826848046RNA PCR Primer, Index 1 (100% over 30bp)
TCCTTCATTCCACCGGAGTCTGTTGGAATTCTCGGGTGCCAAGGAACTCC654620.52584257351992RNA PCR Primer, Index 1 (100% over 27bp)
TTCACGTAATCCAGGATAGGCTTGGAATTCTCGGGTGCCAAGGAACTCCA629800.5059051859137296RNA PCR Primer, Index 1 (100% over 28bp)
TTGGTCCCCTTCAACCAGCTGTTGGAATTCTCGGGTGCCAAGGAACTCCA621750.4994387890470965RNA PCR Primer, Index 1 (100% over 28bp)
ACCCTGTAGAACCGAATTTGCGTGGAATTCTCGGGTGCCAAGGAACTCCA566800.4552986017400793RNA PCR Primer, Index 1 (100% over 28bp)
ACAGTAGTCTGCACATTGGTTTGGAATTCTCGGGTGCCAAGGAACTCCAG556470.4470007284938284RNA PCR Primer, Index 1 (100% over 29bp)
GTTTCCGTAGTGTAGTGGTTATCACGTTCGCCTCTGGAATTCTCGGGTGC542740.4359717062604281No Hit
TCCCTGGTGGTCTAGTGGTTAGGATTTGGCGCTCTGGAATTCTCGGGTGC493850.3966993903834477No Hit
TAACGGAACCCATAATGCAGCTGTGGAATTCTCGGGTGCCAAGGAACTCC468180.37607921553046986RNA PCR Primer, Index 1 (100% over 27bp)
AAGCTGCCAGCTGAAGAACTTGGAATTCTCGGGTGCCAAGGAACTCCAGT450300.3617165849745196RNA PCR Primer, Index 1 (100% over 30bp)
TTTGGTCCCCTTCAACCAGCTGTTGGAATTCTCGGGTGCCAAGGAACTCC439920.35337854777257527RNA PCR Primer, Index 1 (100% over 27bp)
CCTTTCTGAGGGTCGCTTGGAATTCTCGGGTGCCAAGGAACTCCAGTCAC434250.34882395519694676RNA PCR Primer, Index 1 (100% over 33bp)
GCATTGGTGGTTCAGTGGTAGAATTCTCGCCTGGAATTCTCGGGTGCCAA427410.3433295260580933No Hit
TTAGGTAGTAGGTTGTATAGTTTGGAATTCTCGGGTGCCAAGGAACTCCA416320.3344211606853031RNA PCR Primer, Index 1 (100% over 28bp)
TTCACAGTGGCTAAGTTCTGCTGGAATTCTCGGGTGCCAAGGAACTCCAG408780.32836443616674243RNA PCR Primer, Index 1 (100% over 29bp)
TTCCCTTTGTCATCCTATGCCTGTGGAATTCTCGGGTGCCAAGGAACTCC380200.30540671909241024RNA PCR Primer, Index 1 (100% over 27bp)
TTCACAGTGGCTAAGTTCAGTTGGAATTCTCGGGTGCCAAGGAACTCCAG360150.2893009728593676RNA PCR Primer, Index 1 (100% over 29bp)
CTACGCCTGTCTGAGGGTCGCTTGGAATTCTCGGGTGCCAAGGAACTCCA354240.2845535932964109RNA PCR Primer, Index 1 (100% over 28bp)
TTATGTAGTAGGTTGTATAGTTTGGAATTCTCGGGTGCCAAGGAACTCCA352850.2834370353281351RNA PCR Primer, Index 1 (100% over 28bp)
TTCAAGTAATCCAGGATAGGCTGGAATTCTCGGGTGCCAAGGAACTCCAG343680.27607096585397045RNA PCR Primer, Index 1 (100% over 29bp)
TGATGTAGTAGGTTGTATAGTTTGGAATTCTCGGGTGCCAAGGAACTCCA340580.2735808006009813RNA PCR Primer, Index 1 (100% over 28bp)
TTCAAGTAATCCAGGATAGGTTTGGAATTCTCGGGTGCCAAGGAACTCCA339910.2730426035946901RNA PCR Primer, Index 1 (100% over 28bp)
AAGCTGCCAGCTGAAGAACTGCTGGAATTCTCGGGTGCCAAGGAACTCCA339660.2728417838162232RNA PCR Primer, Index 1 (100% over 28bp)
GCCCGGCTAGCTCAGTCGGTAGAGCATGAGACTCTGGAATTCTCGGGTGC339260.27252047217067626No Hit
TCCCTGGTGGTCTAGTGGTTAGGATTCGGCGCTCTGGAATTCTCGGGTGC327960.2634434181839739No Hit
ATGACCTATGAATTGACAGCCTGGAATTCTCGGGTGCCAAGGAACTCCAG322840.2593306291209725RNA PCR Primer, Index 1 (100% over 29bp)
TCCTTCATTCCACCGGAGTCTTGGAATTCTCGGGTGCCAAGGAACTCCAG315820.25369160974162286RNA PCR Primer, Index 1 (100% over 29bp)
GCATTGTGGTTCAGTGGTAGAATTCTCGCCTTGGAATTCTCGGGTGCCAA313730.25201275639363985No Hit
TAGCTTATCAGACTGGTGTTGGTGGAATTCTCGGGTGCCAAGGAACTCCA309520.2486309513242578RNA PCR Primer, Index 1 (100% over 28bp)
AACATTCATTGCTGTCGGTGGGTGGAATTCTCGGGTGCCAAGGAACTCCA298800.24001979922359862RNA PCR Primer, Index 1 (100% over 28bp)
TTCCATTTGTCATCCTATGCCTTGGAATTCTCGGGTGCCAAGGAACTCCA281750.22632389033215833RNA PCR Primer, Index 1 (100% over 28bp)
TATTGCACTTGTCCCGGCCTGTTTGGAATTCTCGGGTGCCAAGGAACTCC278500.22371323321208905RNA PCR Primer, Index 1 (100% over 27bp)
TCCCTGTGGTCTAGTGGTTAGGATTTGGCGCTCTGGAATTCTCGGGTGCC278330.2235766757627316No Hit
CATTGCACTTGTCTCGGTCTGATGGAATTCTCGGGTGCCAAGGAACTCCA271360.21797782033907537RNA PCR Primer, Index 1 (100% over 28bp)
AACATTCATTGCTGTCGGTGGGTTGGAATTCTCGGGTGCCAAGGAACTCC264100.21214601397239757RNA PCR Primer, Index 1 (100% over 27bp)
CTGTCTGAGGGTCGCTTGGAATTCTCGGGTGCCAAGGAACTCCAGTCACC258400.207567323023353RNA PCR Primer, Index 2 (100% over 34bp)
TGAGGTAGTAGGTTGTATAGTTGGAATTCTCGGGTGCCAAGGAACTCCAG252720.2030046976565858RNA PCR Primer, Index 1 (100% over 29bp)
TGAGGTAGTAGTTTGTATAGTTTGGAATTCTCGGGTGCCAAGGAACTCCA252110.2025146973971267RNA PCR Primer, Index 1 (100% over 28bp)
ATGACCTATGAATTGACAGCCATGGAATTCTCGGGTGCCAAGGAACTCCA251100.20170338549212052RNA PCR Primer, Index 1 (100% over 28bp)
TACCATGTAGAACCGAATTTGTTGGAATTCTCGGGTGCCAAGGAACTCCA247110.19849830182778933RNA PCR Primer, Index 1 (100% over 28bp)
TACAGTAGTCTGCACATTGGTTTGGAATTCTCGGGTGCCAAGGAACTCCA242320.19465059487236416RNA PCR Primer, Index 1 (100% over 28bp)
TACCCTGTAGATCCGGATTTGTTGGAATTCTCGGGTGCCAAGGAACTCCA241990.1943855127647879RNA PCR Primer, Index 1 (100% over 28bp)
ACCCTGTAGAACCGAATTTGTGTGGAATTCTCGGGTGCCAAGGAACTCCA235950.1895337069170284RNA PCR Primer, Index 1 (100% over 28bp)
TATGTGCCCTTGGACTACATCGTGGAATTCTCGGGTGCCAAGGAACTCCA231830.18622419696789444RNA PCR Primer, Index 1 (100% over 28bp)
TTGTTCCCCTTCAACCAGCTGTTGGAATTCTCGGGTGCCAAGGAACTCCA230040.1847863273540717RNA PCR Primer, Index 1 (100% over 28bp)
TACCCTGTAGAACCGAATTTGTGGAATTCTCGGGTGCCAAGGAACTCCAG224550.18037632501893933RNA PCR Primer, Index 1 (100% over 29bp)
CCACGTTCCCGTGGTGGAATTCTCGGGTGCCAAGGAACTCCAGTCACCGT223480.17951681636710112RNA PCR Primer, Index 12 (97% over 36bp)
TTCAGTCATTGTTTCTGGTTGTTGGAATTCTCGGGTGCCAAGGAACTCCA218080.1751791091522168RNA PCR Primer, Index 1 (100% over 28bp)
ACATTAGTCTGCACATTGGTTTGGAATTCTCGGGTGCCAAGGAACTCCAG209130.16798976108310298RNA PCR Primer, Index 1 (100% over 29bp)
ACAGTAGTCTGCACATTGGTTATGGAATTCTCGGGTGCCAAGGAACTCCA205400.16499352998837735RNA PCR Primer, Index 1 (100% over 28bp)
TTCAAGTAATCCAGGATAGGCTTTGGAATTCTCGGGTGCCAAGGAACTCC201280.1616840200392434RNA PCR Primer, Index 1 (100% over 27bp)
TTCACAGTGGTTAAGTTCTGCCTGGAATTCTCGGGTGCCAAGGAACTCCA201240.1616518888746887RNA PCR Primer, Index 1 (100% over 28bp)
TCCCTGGTGGTCTAGTGGTTAGGATTCGGCGCTTGGAATTCTCGGGTGCC199070.1599087731975963No Hit
GCATTGGTGGTTCAGTGGTAGAATTCTCGCCTGCTGGAATTCTCGGGTGC193830.15569959064093078No Hit
AACATTCAACGCTGTCGGTGGTGGAATTCTCGGGTGCCAAGGAACTCCAG192470.15460713104607102RNA PCR Primer, Index 1 (100% over 29bp)
TCCAGCATCAGTGATTTTGTTTGGAATTCTCGGGTGCCAAGGAACTCCAG182690.14675106131244722RNA PCR Primer, Index 1 (100% over 29bp)
TGAGGTAGTAGGTTGTATAGTTTTGGAATTCTCGGGTGCCAAGGAACTCC180440.1449436833062454RNA PCR Primer, Index 1 (100% over 27bp)
AACCCGTAGATCCGAACTTGTGTGGAATTCTCGGGTGCCAAGGAACTCCA173700.13952958207877872RNA PCR Primer, Index 1 (100% over 28bp)
GCCCGGCTAGCTCAGTCGGTAGAGCATGAGACTTGGAATTCTCGGGTGCC172820.13882269645857534No Hit
CACCACGTTCCCGTGGTGGAATTCTCGGGTGCCAAGGAACTCCAGTCACC172380.13846925364847365RNA PCR Primer, Index 2 (100% over 34bp)
TCCCTGTGGTCTAGTGGTTAGGATTCGGCGCTCTGGAATTCTCGGGTGCC171900.13808367967381727No Hit
TTCCAGTGATGACAGCCTATAATCTGACTTGGAATTCTCGGGTGCCAAGG168370.1352481044018651Illumina Small RNA Adapter 2 (100% over 21bp)
TTTTGTCCCCTTCAACCAGCTGTTGGAATTCTCGGGTGCCAAGGAACTCC160690.12907892080736297RNA PCR Primer, Index 1 (100% over 27bp)
TGAGATGAAGCACTGTAGCTCTGGAATTCTCGGGTGCCAAGGAACTCCAG159860.12841219914285298RNA PCR Primer, Index 1 (100% over 29bp)
AGCCTGTGATGATACAAGTTATCCCTGTCTGAACTCTGGTGTGGAATTCT159170.12785793655428446No Hit
TTCACAGTGGTTAAGTTCTGCTGGAATTCTCGGGTGCCAAGGAACTCCAG156170.12544809921268205RNA PCR Primer, Index 1 (100% over 29bp)
TATTGCACTTGTCCCGGCCTGTATGGAATTCTCGGGTGCCAAGGAACTCC155450.12486973825069747RNA PCR Primer, Index 1 (100% over 27bp)
CATTATTACTTTTGGTACGCGTGGAATTCTCGGGTGCCAAGGAACTCCAG152060.12214662205468677RNA PCR Primer, Index 1 (100% over 29bp)
AACATTCAACGCTGTCGGTGAGATGGAATTCTCGGGTGCCAAGGAACTCC150450.12085334268136014RNA PCR Primer, Index 1 (100% over 27bp)
TATTGCACTTGTCCCGGCCTGTATTGGAATTCTCGGGTGCCAAGGAACTC148260.11909416142199039RNA PCR Primer, Index 1 (100% over 26bp)
TTTGGTCCCCTTCAACCAGCTGTGGAATTCTCGGGTGCCAAGGAACTCCA145930.1172225210866792RNA PCR Primer, Index 1 (100% over 28bp)
TCCAGCATCAGTGATTTTGTTGTGGAATTCTCGGGTGCCAAGGAACTCCA144930.11641924197281174RNA PCR Primer, Index 1 (100% over 28bp)
TACCCTGTAGAACCGAATGTGTTGGAATTCTCGGGTGCCAAGGAACTCCA142270.11428251952992428RNA PCR Primer, Index 1 (100% over 28bp)
TGAGATGAAGCACTGTAGCTCTTGGAATTCTCGGGTGCCAAGGAACTCCA140850.11314186318823248RNA PCR Primer, Index 1 (100% over 28bp)
GCATTGTGGTTCAGTGGTAGAATTCTCGCCTGGAATTCTCGGGTGCCAAG139100.1117361247389644No Hit
ACCCTGTAGAACCGAATTTGCTGGAATTCTCGGGTGCCAAGGAACTCCAG138050.11089268166940357RNA PCR Primer, Index 1 (100% over 29bp)
TCCCTGAGACCCTTAACCTGTGTGGAATTCTCGGGTGCCAAGGAACTCCA137630.11055530444157924RNA PCR Primer, Index 1 (100% over 28bp)
TGTCTGAGGGTCGCTTGGAATTCTCGGGTGCCAAGGAACTCCAGTCACCG137530.11047497653019249RNA PCR Primer, Index 2 (100% over 35bp)
TGGAATTCTCGGGTGCCAAGGAACTCCAGTCACCGTACGATCTCGTATGC135560.10889251667587359RNA PCR Primer, Index 22 (100% over 50bp)
TGTAAACATCCTTGACTGGAAGCTTGGAATTCTCGGGTGCCAAGGAACTC134240.10783218824556853RNA PCR Primer, Index 1 (100% over 26bp)
TGTAAACATCCTACACTCTCAGCTTGGAATTCTCGGGTGCCAAGGAACTC132600.10651481049882588RNA PCR Primer, Index 1 (100% over 26bp)
ACCCTGTAGAACCGAATTTGTTGGAATTCTCGGGTGCCAAGGAACTCCAG130500.10482792435970421RNA PCR Primer, Index 1 (100% over 29bp)
TTCACAGTGGCTAAGTTCTGCTTGGAATTCTCGGGTGCCAAGGAACTCCA130480.10481185877742685RNA PCR Primer, Index 1 (100% over 28bp)
TATTGCACTTGTCCCGGCCTGTTTTGGAATTCTCGGGTGCCAAGGAACTC129620.10412103873950083RNA PCR Primer, Index 1 (100% over 26bp)
AACACTCAACGCTGTCGGTGAGTGGAATTCTCGGGTGCCAAGGAACTCCA128830.10348644823954556RNA PCR Primer, Index 1 (100% over 28bp)
TCCAGTGATGACAGCCTATAATCTGACTTGGAATTCTCGGGTGCCAAGGA125730.1009962829865564RNA PCR Primer, Index 1 (100% over 22bp)

[WARN]Adapter Content

Adapter graph

[FAIL]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
ACGTTCG202100.045.2324324
GTTCGCC202300.045.21609526
TTCGCCT204300.045.08765427
TCGCCTC75050.044.8752928
CGTTCGC204650.044.78649525
AACACTA8500.043.7663151
AACATTC1546850.043.7422681
AACAGTA182250.043.6702581
CCTTATA254.649368E-543.6667989
CCATTAC4000.043.66679810
CGCGTAA700.043.6566243
TGCGTAG1850.043.6566244
CCATTTA1300.043.6566243
TCCTTCA312700.043.633351
TTCACGT105000.043.620431
TATTGCA252200.043.58411
TTCAAGT700550.043.5788961
TTATGTA73650.043.5583271
CAACGCT1548100.043.5500877
TCAACGC1548600.043.5472156