FastQCFastQC Report
Mon 5 Dec 2016
JG68_3_GAGTGG_L006_R1_001.fastq

Summary

[OK]Basic Statistics

MeasureValue
FilenameJG68_3_GAGTGG_L006_R1_001.fastq
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences6552147
Sequences flagged as poor quality0
Sequence length50
%GC51

[OK]Per base sequence quality

Per base quality graph

[WARN]Per tile sequence quality

Per base quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[FAIL]Per base sequence content

Per base sequence content

[FAIL]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[OK]Sequence Length Distribution

Sequence length distribution

[FAIL]Sequence Duplication Levels

Duplication level graph

[FAIL]Overrepresented sequences

SequenceCountPercentagePossible Source
ATGACCTATGAATTGACAGCCTGGAATTCTCGGGTGCCAAGGAACTCCAG3910965.968974749803385RNA PCR Primer, Index 1 (100% over 29bp)
ATGACCTATGAATTGACAGCCATGGAATTCTCGGGTGCCAAGGAACTCCA2752494.200897812579601RNA PCR Primer, Index 1 (100% over 28bp)
TTCAAGTAATCCAGGATAGGCTTGGAATTCTCGGGTGCCAAGGAACTCCA1991563.039553294515523RNA PCR Primer, Index 1 (100% over 28bp)
TGAGGTAGTAGGTTGTATAGTTTGGAATTCTCGGGTGCCAAGGAACTCCA1616002.46636713126247RNA PCR Primer, Index 1 (100% over 28bp)
TTGCGGCCCCGGGTTCCTCCCGGGGCTACGCCTGTCTGAGGGTCGCTTGG1565912.389918907497039No Hit
CCTGTCTGAGGGTCGCTTGGAATTCTCGGGTGCCAAGGAACTCCAGTCAC1173061.7903444474002186RNA PCR Primer, Index 1 (100% over 33bp)
GCATTGGTGGTTCAGTGGTAGAATTCTCGCCTTGGAATTCTCGGGTGCCA969251.479286102708013No Hit
TAGCTTATCAGACTGGTGTTGGCTGGAATTCTCGGGTGCCAAGGAACTCC803941.226987123457395RNA PCR Primer, Index 1 (100% over 27bp)
TCAGTAACTGGAATCTGTCCCTTGGAATTCTCGGGTGCCAAGGAACTCCA774731.1824063165859984RNA PCR Primer, Index 1 (100% over 28bp)
AACATTCAACGCTGTCGGTGAGTGGAATTCTCGGGTGCCAAGGAACTCCA758061.1569642744584334RNA PCR Primer, Index 1 (100% over 28bp)
AAGCTGCCAGCTGAAGAACTGTTGGAATTCTCGGGTGCCAAGGAACTCCA728841.1123682054141948RNA PCR Primer, Index 1 (100% over 28bp)
CCGTCGAGCAGCATTCCGGGCTTCACATCGGAGGGCTCCAGCCGGCCCCG722171.1021883361286002No Hit
GTTTCCGTAGTGTAGTGGTTATCACGTTCGCCTTGGAATTCTCGGGTGCC683711.043490019378381No Hit
AACATTCAACGCTGTCGGTGAGTTGGAATTCTCGGGTGCCAAGGAACTCC637970.9736808407992067RNA PCR Primer, Index 1 (100% over 27bp)
TGAGGTAGTAGTTTGTATAGTTTGGAATTCTCGGGTGCCAAGGAACTCCA592050.9035969431088772RNA PCR Primer, Index 1 (100% over 28bp)
ATCCATGATGACATTAAAACATAACGTGACTGTTGGATGAAGCTTGCGGA552590.8433724090744606No Hit
GCCCGGCTAGCTCAGTCGGTAGAGCATGAGACTCTGGAATTCTCGGGTGC536400.81866295124331No Hit
GATCCATGATGACATTAAAACATAACGTGACTGTTGGATGAAGCTTGCGG510900.7797444104962846No Hit
TGTAAACATCCTTGACTGGAAGCTTGGAATTCTCGGGTGCCAAGGAACTC506990.7737769009150741RNA PCR Primer, Index 1 (100% over 26bp)
GCATTGGTGGTTCAGTGGTAGAATTCTCGCCTGGAATTCTCGGGTGCCAA496900.7583773685175256No Hit
AGAGATGATGACTTCTGTTACCGCCCCAGTCTGAGAAGTCATGACTGATC421220.6428732444494911No Hit
CTACGCCTGTCTGAGGGTCGCTTGGAATTCTCGGGTGCCAAGGAACTCCA387020.5906766133299513RNA PCR Primer, Index 1 (100% over 28bp)
GTTTCCGTAGTGTAGTGGTTATCACGTTCGCCTCTGGAATTCTCGGGTGC365620.5580155634481339No Hit
GCCCGGCTAGCTCAGTCGGTAGAGCATGAGACTTGGAATTCTCGGGTGCC347090.5297347571719622No Hit
TATTGCACTTGTCCCGGCCTGTTGGAATTCTCGGGTGCCAAGGAACTCCA343720.524591404924218RNA PCR Primer, Index 1 (100% over 28bp)
GCATTGTGGTTCAGTGGTAGAATTCTCGCCTTGGAATTCTCGGGTGCCAA311980.4761492683238029No Hit
TCCCTGGTGGTCTAGTGGTTAGGATTTGGCGCTCTGGAATTCTCGGGTGC293780.4483721137514161No Hit
TCCCATATGGTCTAGCGGTTAGGATTCCTGTGGAATTCTCGGGTGCCAAG279620.4267608770071856No Hit
TTCACAGTGGCTAAGTTCTGTGGAATTCTCGGGTGCCAAGGAACTCCAGT274140.41839720628978566RNA PCR Primer, Index 1 (100% over 30bp)
TTCAGTGATGTTTGACAAATGTCTGACCTGAACTGCAATGTGGACAGATC272790.4163368129561196No Hit
GGACAACTCTTAGCGGTGGAATTCTCGGGTGCCAAGGAACTCCAGTCACG272410.4157568503881247RNA PCR Primer, Index 6 (100% over 34bp)
TTCACAGTGGCTAAGTTCTGCTGGAATTCTCGGGTGCCAAGGAACTCCAG265520.40524121330000684RNA PCR Primer, Index 1 (100% over 29bp)
TGTAAACATCCTACACTCTCAGCTTGGAATTCTCGGGTGCCAAGGAACTC254600.3885749205565748RNA PCR Primer, Index 1 (100% over 26bp)
TGGAGTGTGACAATGGTGTTTGTGGAATTCTCGGGTGCCAAGGAACTCCA253970.38761340366753066RNA PCR Primer, Index 1 (100% over 28bp)
TAAGATGATGATTAACTCACCATCTTTCGGCTGAAGAATGATGTATACTC240720.3673910246519194No Hit
CTGTCTGAGGGTCGCTTGGAATTCTCGGGTGCCAAGGAACTCCAGTCACG240430.36694842163950225RNA PCR Primer, Index 6 (100% over 34bp)
TTCAAGTAATCCAGGATAGGTTTGGAATTCTCGGGTGCCAAGGAACTCCA232300.3545402751189801RNA PCR Primer, Index 1 (100% over 28bp)
TGCCTGTGATGAGACTCTCGACGGGCGGACTGAATGGGTTTTCACCCTCC231130.35275460089646954No Hit
TGAGATGAAGCACTGTAGCTCTGGAATTCTCGGGTGCCAAGGAACTCCAG227740.34758072430304143RNA PCR Primer, Index 1 (100% over 29bp)
TTCACAGTGGTTAAGTTCTGTGGAATTCTCGGGTGCCAAGGAACTCCAGT227660.34745862692030566RNA PCR Primer, Index 1 (100% over 30bp)
GTGGGCTCTGGTAGTCCAGTGGCAAGATCGTCTGACTTACGTTTTGGAAT222350.33935441314121917No Hit
CTGGACAACTCTTAGCGGTGGAATTCTCGGGTGCCAAGGAACTCCAGTCA219570.3351115290911514RNA PCR Primer, Index 1 (100% over 32bp)
GTTACATGATGAAACATGTGTTGGTAGGGACATCTGAATGAATGTGATGA219480.3349741695355736No Hit
GCATTGGTGGTTCAGTGGTAGAATTCTCGCCTGCTGGAATTCTCGGGTGC219270.33465366390589224No Hit
TGTCTGAGGGTCGCTTGGAATTCTCGGGTGCCAAGGAACTCCAGTCACGA207220.3162627456313175RNA PCR Primer, Index 7 (97% over 35bp)
TGGAATTCTCGGGTGCCAAGGAACTCCAGTCACGAGTGGATCTCGTATGC196120.29932173377673RNA PCR Primer, Index 23 (100% over 50bp)
TGAGATGAAGCACTGTAGCTCTTGGAATTCTCGGGTGCCAAGGAACTCCA194380.29666611570222706RNA PCR Primer, Index 1 (100% over 28bp)
CATTATTACTTTTGGTACGCGTGGAATTCTCGGGTGCCAAGGAACTCCAG188860.28824139629345924RNA PCR Primer, Index 1 (100% over 29bp)
TCAGTAACTGGAATCTGTCCCTGCTGGAATTCTCGGGTGCCAAGGAACTC188740.2880582502193556RNA PCR Primer, Index 1 (100% over 26bp)
TCCCTGGTGGTCTAGTGGTTAGGATTCGGCGCTCTGGAATTCTCGGGTGC184530.2816328754528859No Hit
TGAGGTAGTAGGTTGTATAGTTTTGGAATTCTCGGGTGCCAAGGAACTCC177990.27165141441423707RNA PCR Primer, Index 1 (100% over 27bp)
TCCCTGTGGTCTAGTGGTTAGGATTTGGCGCTCTGGAATTCTCGGGTGCC175640.26806480379637393No Hit
TGTAAACATCCCCGACTGGAAGCTTGGAATTCTCGGGTGCCAAGGAACTC167730.2559924250783751RNA PCR Primer, Index 1 (100% over 26bp)
TTACATGATGAAACATGTGTTGGTAGGGACATCTGAATGAATGTGATGAA163640.24975019638600904No Hit
TTCCAGTGATGACAGCCTATAATCTGACTTGGAATTCTCGGGTGCCAAGG159490.2434163946565912Illumina Small RNA Adapter 2 (100% over 21bp)
GCTTACGGCCTGGAATTCTCGGGTGCCAAGGAACTCCAGTCACGAGTGGA156790.2392956079892591RNA PCR Primer, Index 23 (100% over 40bp)
TGAGGTAGTAGTTTGTGCTGTTTGGAATTCTCGGGTGCCAAGGAACTCCA153800.23473221830950983RNA PCR Primer, Index 1 (100% over 28bp)
TTGCGGCCCCGGGTTCCTCCCGGGGCTACGCCTGTCTGAGGGTCGCTTTG153630.23447276137119635No Hit
GCATTGTGGTTCAGTGGTAGAATTCTCGCCTGGAATTCTCGGGTGCCAAG150940.2303672368767062No Hit
TGAGGTAGTAGGTTGTATAGTTGGAATTCTCGGGTGCCAAGGAACTCCAG147220.22468970857949308RNA PCR Primer, Index 1 (100% over 29bp)
CCACGTTCCCGTGGTGGAATTCTCGGGTGCCAAGGAACTCCAGTCACGAG146820.2240792216658143RNA PCR Primer, Index 7 (97% over 36bp)
TCCCATATGGTCTAGCGGTTAGGATTCCTTGGAATTCTCGGGTGCCAAGG142620.21766910907218656Illumina Small RNA Adapter 2 (100% over 21bp)
TCAGTAACTGGAATCTGTCCCTGTGGAATTCTCGGGTGCCAAGGAACTCC142400.2173333412696632RNA PCR Primer, Index 1 (100% over 27bp)
AACCCGTAGATCCGAACTTGTGTGGAATTCTCGGGTGCCAAGGAACTCCA138210.21093849084887747RNA PCR Primer, Index 1 (100% over 28bp)
GTTTCCGTAGTGTAGTGGTTATCACGTTCGCCTGGAATTCTCGGGTGCCA137390.20968699267583588No Hit
AAACCGTTACCATTACTGAGTTTTGGAATTCTCGGGTGCCAAGGAACTCC137030.20913755445352492RNA PCR Primer, Index 1 (100% over 27bp)
ACTGGACAACTCTTAGCGGTGGAATTCTCGGGTGCCAAGGAACTCCAGTC135370.2066040337617578RNA PCR Primer, Index 1 (100% over 31bp)
TGAGATGAAGCACTGTAGCTTGGAATTCTCGGGTGCCAAGGAACTCCAGT130850.19970553163718702RNA PCR Primer, Index 1 (100% over 30bp)
ACAGTAGTCTGCACATTGGTTTGGAATTCTCGGGTGCCAAGGAACTCCAG129190.1971720109454199RNA PCR Primer, Index 1 (100% over 29bp)
TCGTACCGTGAGTAATAATGCATGGAATTCTCGGGTGCCAAGGAACTCCA128450.19604261015511404RNA PCR Primer, Index 1 (100% over 28bp)
TCGCTGCGATCCATTGAAAGTCAGCCCTCGATCCAAGTTTTTGTTGGAAT128040.19541686106859324No Hit
ATGACCTATGAATTGACAGCCATTGGAATTCTCGGGTGCCAAGGAACTCC127850.1951268797845958RNA PCR Primer, Index 1 (100% over 27bp)
AGCCTGTGATGATACAAGTTATCCCTGTCTGAACTCTGGTGTGGAATTCT125350.19131133657410312No Hit
CTTCGAACGCACCTTGCGGCCCCGGGTTCCTCCCGGGGCTACGCCTGTCT124430.18990721667264182No Hit
TACGCCTGTCTGAGGGTCGCTTGGAATTCTCGGGTGCCAAGGAACTCCAG122710.18728212294382285RNA PCR Primer, Index 1 (100% over 29bp)
TGAGGTAGTAGATTGAATAGTTTGGAATTCTCGGGTGCCAAGGAACTCCA121590.18557275958552213RNA PCR Primer, Index 1 (100% over 28bp)
CTTGCGGCCCCGGGTTCCTCCCGGGGCTACGCCTGTCTGAGGGTCGCTTG120190.18343605538764624No Hit
GCCCGGCTAGCTCAGTCGGTAGAGCATGAGACTCTTAATCTTGGAATTCT119100.1817724785478714No Hit
GCATTGGTGGTTCAGTGGTAGAATTCTCGCCTGTGGAATTCTCGGGTGCC117650.17955946348578566No Hit
TCCGAATGATGAAATGTTGTTGATCTCTGTAGTAACCACGGTTACAGTGA115990.1770259427940185No Hit
TCCCTGGTGGTCTAGTGGTTAGGATTCGGCGCTCTCACCGCCGCGGCCCG114710.17507238467024624No Hit
AACTGGACAACTCTTAGCGGTGGAATTCTCGGGTGCCAAGGAACTCCAGT113120.17264569918837291RNA PCR Primer, Index 1 (100% over 30bp)
TACCCTGTAGAACCGAATTTGCGTGGAATTCTCGGGTGCCAAGGAACTCC111440.17008165415092183RNA PCR Primer, Index 1 (100% over 27bp)
TCCAGTGATGACAGCCTATAATCTGACTTGGAATTCTCGGGTGCCAAGGA110450.16857069903956673RNA PCR Primer, Index 1 (100% over 22bp)
ATGACCTATGAATTGACAGCCTTGGAATTCTCGGGTGCCAAGGAACTCCA108080.16495356407601966RNA PCR Primer, Index 1 (100% over 28bp)
CACCGTCGAGCAGCATTCCGGGCTTCACATCGGAGGGCTCCAGCCGGCCC107110.16347313331034852No Hit
CCTGTCTGAGGGTCGCTTTGGAATTCTCGGGTGCCAAGGAACTCCAGTCA107090.16344260896466456RNA PCR Primer, Index 1 (100% over 32bp)
CATGGCTGATGACCTTTGATGCGTTAGACTTCTGATTTAAAAATGAAGTC106970.1632594628905609No Hit
TCCCTGGTGGTCTAGTGGTTAGGATTCGGCGCTTGGAATTCTCGGGTGCC103010.1572156424451405No Hit
ATGACCTATGAATTGACAGCTGGAATTCTCGGGTGCCAAGGAACTCCAGT99810.15233174713570988RNA PCR Primer, Index 1 (100% over 30bp)
CAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACT99020.15112603548119416No Hit
TCCCTGGTGGTCTAGTGGTTAGGATTCGTGGAATTCTCGGGTGCCAAGGA98640.1505460729131993RNA PCR Primer, Index 1 (100% over 22bp)
CATTGCACTTGTCTCGGTCTGATGGAATTCTCGGGTGCCAAGGAACTCCA97590.14894354476479235RNA PCR Primer, Index 1 (100% over 28bp)
GCATTGGTGGTTCAGTGGTAGAATTCTCGCTGGAATTCTCGGGTGCCAAG97060.14813464960416792No Hit
TCGTACCGTGAGTAATAATGCTGGAATTCTCGGGTGCCAAGGAACTCCAG93840.14322022994905334RNA PCR Primer, Index 1 (100% over 29bp)
AAGTTCTGTGATACACTCAGACTTGGAATTCTCGGGTGCCAAGGAACTCC93130.14213661567727343RNA PCR Primer, Index 1 (100% over 27bp)
TGTAAACATCCTACACTCAGCTTGGAATTCTCGGGTGCCAAGGAACTCCA92030.14045777666465664RNA PCR Primer, Index 1 (100% over 28bp)
TACCCTGTAGAACCGAATTTGTTGGAATTCTCGGGTGCCAAGGAACTCCA91910.140274630590553RNA PCR Primer, Index 1 (100% over 28bp)
TCCCTGTGGTCTAGTGGTTAGGATTCGGCGCTCTGGAATTCTCGGGTGCC90220.13769532338025994No Hit
CCTTGCGGCCCCGGGTTCCTCCCGGGGCTACGCCTGTCTGAGGGTCGCTT88750.13545178397249025No Hit
TAGCTTATCAGACTGGTGTTGGTGGAATTCTCGGGTGCCAAGGAACTCCA88010.1343223831821844RNA PCR Primer, Index 1 (100% over 28bp)
TACACTGATGACTTCTTAGGACACCTTTGGATTCTTGATGAAAACAAATT87870.13410871276239683No Hit
AACATTCAACGCTGTCGGTGATGGAATTCTCGGGTGCCAAGGAACTCCAG86850.1325519711325158RNA PCR Primer, Index 1 (100% over 29bp)
TGGAGTGTGACAATGGTGTTTGTTGGAATTCTCGGGTGCCAAGGAACTCC86680.1322925141942023RNA PCR Primer, Index 1 (100% over 27bp)
TACCCTGTAGATCCGGATTTGTTGGAATTCTCGGGTGCCAAGGAACTCCA86380.13183464900894318RNA PCR Primer, Index 1 (100% over 28bp)
GTTCCTGTAGTGTAGTGGTTATCACGTTCGCCTTGGAATTCTCGGGTGCC86220.13159045424347163No Hit
TTCAAGTAATCCAGGATAGGCTGGAATTCTCGGGTGCCAAGGAACTCCAG85600.13064419952726947RNA PCR Primer, Index 1 (100% over 29bp)
CAGTCGGTAGAGCATCTGGAATTCTCGGGTGCCAAGGAACTCCAGTCACG83910.1280648923169764RNA PCR Primer, Index 6 (100% over 34bp)
TCCCATATGGTCTAGCGGTTAGGATTCCTGGAATTCTCGGGTGCCAAGGA82700.12621816940309794RNA PCR Primer, Index 1 (100% over 22bp)
TTCACAGTGGTTAAGTTCTGCTGGAATTCTCGGGTGCCAAGGAACTCCAG82470.12586713942773262RNA PCR Primer, Index 1 (100% over 29bp)
AAGGTCCAACCTCACATGTCCTTGGAATTCTCGGGTGCCAAGGAACTCCA82120.12533296337826363RNA PCR Primer, Index 1 (100% over 28bp)
AACTCTTAGCGGTGGATCACTCGGCTCGTGCGTCGATGAAGAACGCAGCT80290.12253998574818299No Hit
CGCTGCGATCCATTGAAAGTCAGCCCTCGATCCAAGTTTTTGTTGGAATT76740.11712191438928339No Hit
GCATTGGTGGTTCAGTGGTAGAATTCTCGCCTGCCATGGAATTCTCGGGT75490.11521414278403705No Hit
TCCCTGTGGTCTAGTGGTTAGGATTCGGCGCTCTCACCGCCGCGGCCCGG71430.10901770061019693No Hit
TTCAAGTAATCCAGGATAGGCTTTGGAATTCTCGGGTGCCAAGGAACTCC70430.10749148332599985RNA PCR Primer, Index 1 (100% over 27bp)
TGGCTGTGATGAGAAACTTGCCCTCACTGAAACGTGATTGAGACATCTTT70120.10701835596789876No Hit
GCATTGTGGTTCAGTGGTAGAATTCTCGCCTGCTGGAATTCTCGGGTGCC69240.10567528475780535No Hit
TCAAAGGTTGTGGGTTCGTGTCCCACCGGAGTCGCCATGGAATTCTCGGG68250.10416432964645023No Hit
TCCCTGGTGGTCTAGTGGTTAGGATTTGGCGCTCTCACCGCCGCGGCCCG68230.10413380530076631No Hit
GCATTGGTGGTTCAGTGGTAGAATTCTCTGGAATTCTCGGGTGCCAAGGA66870.10205814979425828RNA PCR Primer, Index 1 (100% over 22bp)

[FAIL]Adapter Content

Adapter graph

[WARN]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
ACTGCCC207.82666E-444.037081
TATTGAA800.044.037081
TACGAAC254.423091E-544.037081
ACGGAGG207.82666E-444.037081
CCCCCAC551.8189894E-1244.037081
GCCCGAC1800.044.037081
CAATGCG207.8307826E-444.0323743
GCCTAGC502.7284841E-1143.99708622
TACTAAC207.8617583E-443.99708622
ATAACTA1650.043.99708622
ATCGCGT254.447078E-543.9967521
CAAGGGT2650.043.99641420
TATCGCG254.4472785E-543.99641420
CGATAAT454.802132E-1043.99641420
CATACCG4450.043.9964120
TATTTCG254.4474786E-543.9960823
CGTGCGC254.4474786E-543.9960825
TCTTCAA254.4474786E-543.9960823
CAACCGG254.4474786E-543.9960823
CCGTGAC4000.043.9960824