FastQCFastQC Report
Mon 5 Dec 2016
JG71_3_ACTGAT_L004_R1_001.fastq

Summary

[OK]Basic Statistics

MeasureValue
FilenameJG71_3_ACTGAT_L004_R1_001.fastq
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences10232907
Sequences flagged as poor quality0
Sequence length50
%GC52

[OK]Per base sequence quality

Per base quality graph

[OK]Per tile sequence quality

Per base quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[FAIL]Per base sequence content

Per base sequence content

[FAIL]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[OK]Sequence Length Distribution

Sequence length distribution

[FAIL]Sequence Duplication Levels

Duplication level graph

[FAIL]Overrepresented sequences

SequenceCountPercentagePossible Source
ATGACCTATGAATTGACAGCCTGGAATTCTCGGGTGCCAAGGAACTCCAG4380034.280337933296961RNA PCR Primer, Index 1 (100% over 29bp)
ATGACCTATGAATTGACAGCCATGGAATTCTCGGGTGCCAAGGAACTCCA3476193.397069864897629RNA PCR Primer, Index 1 (100% over 28bp)
TTGCGGCCCCGGGTTCCTCCCGGGGCTACGCCTGTCTGAGGGTCGCTTGG3069842.9999686306149367No Hit
TTCAAGTAATCCAGGATAGGCTTGGAATTCTCGGGTGCCAAGGAACTCCA2714442.652657744275405RNA PCR Primer, Index 1 (100% over 28bp)
GCATTGGTGGTTCAGTGGTAGAATTCTCGCCTGGAATTCTCGGGTGCCAA2711712.649989880685909No Hit
CCTGTCTGAGGGTCGCTTGGAATTCTCGGGTGCCAAGGAACTCCAGTCAC1851441.8093001333834073RNA PCR Primer, Index 1 (100% over 33bp)
TGAGGTAGTAGGTTGTATAGTTTGGAATTCTCGGGTGCCAAGGAACTCCA1807391.7662527373697425RNA PCR Primer, Index 1 (100% over 28bp)
AAGCTGCCAGCTGAAGAACTGTTGGAATTCTCGGGTGCCAAGGAACTCCA1163301.1368226057365713RNA PCR Primer, Index 1 (100% over 28bp)
GTTTCCGTAGTGTAGTGGTTATCACGTTCGCCTGGAATTCTCGGGTGCCA1111061.0857716189544184No Hit
GCTTACGGCCTGGAATTCTCGGGTGCCAAGGAACTCCAGTCACACTGATA1043351.019602738498454RNA PCR Primer, Index 25 (100% over 40bp)
TAGCTTATCAGACTGGTGTTGGCTGGAATTCTCGGGTGCCAAGGAACTCC1003560.9807183823716956RNA PCR Primer, Index 1 (100% over 27bp)
GCATTGTGGTTCAGTGGTAGAATTCTCGCCTGGAATTCTCGGGTGCCAAG987030.9645646149232081No Hit
GCATTGGTGGTTCAGTGGTAGAATTCTCGCCTTGGAATTCTCGGGTGCCA877820.8578402989492624No Hit
GTTTCCGTAGTGTAGTGGTTATCACGTTCGCCTTGGAATTCTCGGGTGCC861290.841686531500775No Hit
GATCCATGATGACATTAAAACATAACGTGACTGTTGGATGAAGCTTGCGG741530.7246523397505713No Hit
AACATTCAACGCTGTCGGTGAGTTGGAATTCTCGGGTGCCAAGGAACTCC737180.7204013483167588RNA PCR Primer, Index 1 (100% over 27bp)
TATTGCACTTGTCCCGGCCTGTTGGAATTCTCGGGTGCCAAGGAACTCCA728970.7123782127600691RNA PCR Primer, Index 1 (100% over 28bp)
AACATTCAACGCTGTCGGTGAGTGGAATTCTCGGGTGCCAAGGAACTCCA701810.6858363903825179RNA PCR Primer, Index 1 (100% over 28bp)
CTACGCCTGTCTGAGGGTCGCTTGGAATTCTCGGGTGCCAAGGAACTCCA672100.6568026075092835RNA PCR Primer, Index 1 (100% over 28bp)
ATCCATGATGACATTAAAACATAACGTGACTGTTGGATGAAGCTTGCGGA640240.6256677599043947No Hit
TCAGTAACTGGAATCTGTCCCTTGGAATTCTCGGGTGCCAAGGAACTCCA590220.5767862446126013RNA PCR Primer, Index 1 (100% over 28bp)
GCCCGGCTAGCTCAGTCGGTAGAGCATGAGACTCTGGAATTCTCGGGTGC535630.5234387452167796No Hit
TGAGGTAGTAGTTTGTATAGTTTGGAATTCTCGGGTGCCAAGGAACTCCA500110.4887272013710278RNA PCR Primer, Index 1 (100% over 28bp)
TGTAAACATCCTTGACTGGAAGCTTGGAATTCTCGGGTGCCAAGGAACTC469460.4587748134523259RNA PCR Primer, Index 1 (100% over 26bp)
TCCCTGGTGGTCTAGTGGTTAGGATTCGGCGCTCTGGAATTCTCGGGTGC465850.45524697918196655No Hit
CTGTCTGAGGGTCGCTTGGAATTCTCGGGTGCCAAGGAACTCCAGTCACA444440.4343242834123285RNA PCR Primer, Index 1 (100% over 34bp)
TGGAATTCTCGGGTGCCAAGGAACTCCAGTCACACTGATATCTCGTATGC442320.4322525358629762RNA PCR Primer, Index 25 (100% over 50bp)
GTTTCCGTAGTGTAGTGGTTATCACGTTCGCCTCTGGAATTCTCGGGTGC439280.4292817280563578No Hit
AGAGATGATGACTTCTGTTACCGCCCCAGTCTGAGAAGTCATGACTGATC433560.4236919186307469No Hit
TCCCTGGTGGTCTAGTGGTTAGGATTCGTGGAATTCTCGGGTGCCAAGGA418440.4089160587504606RNA PCR Primer, Index 1 (100% over 22bp)
TTCACAGTGGCTAAGTTCTGTGGAATTCTCGGGTGCCAAGGAACTCCAGT404640.39543015489146927RNA PCR Primer, Index 1 (100% over 30bp)
TCCCATATGGTCTAGCGGTTAGGATTCCTGGAATTCTCGGGTGCCAAGGA401680.3925375262376566RNA PCR Primer, Index 1 (100% over 22bp)
TTCAGTGATGTTTGACAAATGTCTGACCTGAACTGCAATGTGGACAGATC389700.38083019810499597No Hit
TGTCTGAGGGTCGCTTGGAATTCTCGGGTGCCAAGGAACTCCAGTCACAC379400.37076463218125605RNA PCR Primer, Index 5 (100% over 35bp)
GCATTGGTGGTTCAGTGGTAGAATTCTCGCCTGGCATTCTCGGGTGCCAA370520.3620867462198181No Hit
TCCCATATGGTCTAGCGGTTAGGATTCCTTGGAATTCTCGGGTGCCAAGG352070.3440566791039926Illumina Small RNA Adapter 2 (100% over 21bp)
TTCAAGTAATCCAGGATAGGTTTGGAATTCTCGGGTGCCAAGGAACTCCA351790.34378305206917253RNA PCR Primer, Index 1 (100% over 28bp)
GCATTGGTGGTTCAGTGGTAGAATTCTCGCCTGCCATGGAATTCTCGGGT343990.33616058467061216No Hit
CCACGTTCCCGTGGTGGAATTCTCGGGTGCCAAGGAACTCCAGTCACACT338710.3310007605854329RNA PCR Primer, Index 8 (100% over 36bp)
TGGAGTGTGACAATGGTGTTTGTGGAATTCTCGGGTGCCAAGGAACTCCA338440.3307369059447135RNA PCR Primer, Index 1 (100% over 28bp)
CCTGTCTGAGGGTCGCTTGGAATTCTCGGGTGCCCAGGAACTCCAGTCAC335210.3275804226501814RNA PCR Primer, Index 1 (96% over 33bp)
TTCACAGTGGCTAAGTTCTGCTGGAATTCTCGGGTGCCAAGGAACTCCAG322060.3147297244077367RNA PCR Primer, Index 1 (100% over 29bp)
CCGTCGAGCAGCATTCCGGGCTTCACATCGGAGGGCTCCAGCCGGCCCCG312530.30541663282975207No Hit
TTGCGGCCCCGGGTTCCTCCCGGGGCTACGCCTGTCTGAGGGTCGCTTTG311670.3045762069370903No Hit
TGTAAACATCCTACACTCTCAGCTTGGAATTCTCGGGTGCCAAGGAACTC290800.284181220448891RNA PCR Primer, Index 1 (100% over 26bp)
GTTACATGATGAAACATGTGTTGGTAGGGACATCTGAATGAATGTGATGA280020.2736465796083166No Hit
CTTCGAACGCACCTTGCGGCCCCGGGTTCCTCCCGGGGCTACGCCTGTCT279700.27333386299709356No Hit
GCATTGTGGTTCAGTGGTAGAATTCTCGCCTTGGAATTCTCGGGTGCCAA272580.2663759183973821No Hit
GGACAACTCTTAGCGGTGGAATTCTCGGGTGCCAAGGAACTCCAGTCACA270340.2641869021188212RNA PCR Primer, Index 1 (100% over 34bp)
TAAGATGATGATTAACTCACCATCTTTCGGCTGAAGAATGATGTATACTC265510.2594668357681742No Hit
GAGAGAGGCATGATCGTAGCGATATGGAATTCTCGGGTGCCAAGGAACTC259160.253261365514218RNA PCR Primer, Index 1 (100% over 26bp)
TCCCTGTGGTCTAGTGGTTAGGATTCGGCGCTCTGGAATTCTCGGGTGCC256280.2504469160132111No Hit
TGAGGTAGTAGATTGAATAGTTTGGAATTCTCGGGTGCCAAGGAACTCCA252030.24629364852040578RNA PCR Primer, Index 1 (100% over 28bp)
TGAGATGAAGCACTGTAGCTCTGGAATTCTCGGGTGCCAAGGAACTCCAG250710.24500369249911094RNA PCR Primer, Index 1 (100% over 29bp)
GCCCGGCTAGCTCAGTCGGTAGAGCATGAGACTTGGAATTCTCGGGTGCC238040.23262206917350073No Hit
CTGGACAACTCTTAGCGGTGGAATTCTCGGGTGCCAAGGAACTCCAGTCA233190.2278824580346523RNA PCR Primer, Index 1 (100% over 32bp)
TGAGGTAGTAGTTTGTGCTGTTTGGAATTCTCGGGTGCCAAGGAACTCCA231910.22663159158976035RNA PCR Primer, Index 1 (100% over 28bp)
TTCACAGTGGTTAAGTTCTGTGGAATTCTCGGGTGCCAAGGAACTCCAGT227360.22218515227393348RNA PCR Primer, Index 1 (100% over 30bp)
TACGCCTGTCTGAGGGTCGCTTGGAATTCTCGGGTGCCAAGGAACTCCAG220880.21585264089666795RNA PCR Primer, Index 1 (100% over 29bp)
TCCCTGTGGTCTAGTGGTTAGGATTCGTGGAATTCTCGGGTGCCAAGGAA213130.20827903546861123RNA PCR Primer, Index 1 (100% over 23bp)
TGCCTGTGATGAGACTCTCGACGGGCGGACTGAATGGGTTTTCACCCTCC211530.20671545241249628No Hit
TCGCTGCGATCCATTGAAAGTCAGCCCTCGATCCAAGTTTTTGTTGGAAT210540.20574798539652514No Hit
CTTGCGGCCCCGGGTTCCTCCCGGGGCTACGCCTGTCTGAGGGTCGCTTG207990.20325602490084194No Hit
TGAGATGAAGCACTGTAGCTCTTGGAATTCTCGGGTGCCAAGGAACTCCA206670.2019660688795471RNA PCR Primer, Index 1 (100% over 28bp)
ATGACCTATGAATTGACAGCCATTGGAATTCTCGGGTGCCAAGGAACTCC203820.1991809365608424RNA PCR Primer, Index 1 (100% over 27bp)
ACAGTAGTCTGCACATTGGTTTGGAATTCTCGGGTGCCAAGGAACTCCAG203580.19894639910242512RNA PCR Primer, Index 1 (100% over 29bp)
CCTGTCTGAGGGTCGCTTTGGAATTCTCGGGTGCCAAGGAACTCCAGTCA199060.19452927696890043RNA PCR Primer, Index 1 (100% over 32bp)
TCCCTGGTGGTCTAGTGGTTAGGATTCGGCTGGAATTCTCGGGTGCCAAG197630.1931318246124977No Hit
TTACATGATGAAACATGTGTTGGTAGGGACATCTGAATGAATGTGATGAA192740.1883531238972464No Hit
GAGAGAGGCATGATCGTAGCGATTGGAATTCTCGGGTGCCAAGGAACTCC189290.18498164793249855RNA PCR Primer, Index 1 (100% over 27bp)
GAGAGAGGCATGATCGTAGCGTGGAATTCTCGGGTGCCAAGGAACTCCAG187830.18355487839379367RNA PCR Primer, Index 1 (100% over 29bp)
TCCCATATGGTCTAGCGGTTAGGATTCCTGTGGAATTCTCGGGTGCCAAG182000.17785757263307486No Hit
TGTAAACATCCCCGACTGGAAGCTTGGAATTCTCGGGTGCCAAGGAACTC181710.17757417320415403RNA PCR Primer, Index 1 (100% over 26bp)
TGAGGTAGTAGGTTGTATAGTTGGAATTCTCGGGTGCCAAGGAACTCCAG179590.17550242565480173RNA PCR Primer, Index 1 (100% over 29bp)
TGAGGTAGTAGGTTGTATAGTTTTGGAATTCTCGGGTGCCAAGGAACTCC175740.17174005392602512RNA PCR Primer, Index 1 (100% over 27bp)
TACACTGATGACTTCTTAGGACACCTTTGGATTCTTGATGAAAACAAATT174050.1700885193230037No Hit
GCTTACGGCCTGGAATTCTCGGGTGCCACGGAACTCCAGTCACACTGATA169220.16536845297235675RNA PCR Primer, Index 25 (97% over 40bp)
CATTATTACTTTTGGTACGCGTGGAATTCTCGGGTGCCAAGGAACTCCAG166690.16289603726487498RNA PCR Primer, Index 1 (100% over 29bp)
TACCCTGTAGATCCGGATTTGTTGGAATTCTCGGGTGCCAAGGAACTCCA163120.1594072925709185RNA PCR Primer, Index 1 (100% over 28bp)
GCATTGGTGGTTCAGTGGTAGAATTCTCGCTGGAATTCTCGGGTGCCAAG154420.1509053097032935No Hit
TACCCTGTAGAACCGAATTTGTTGGAATTCTCGGGTGCCAAGGAACTCCA152670.14919514073566778RNA PCR Primer, Index 1 (100% over 28bp)
GCATTGGTGGTTCAGTGGTAGAATTCTTGGAATTCTCGGGTGCCAAGGAA152310.1488433345480419RNA PCR Primer, Index 1 (100% over 23bp)
CCTTGCGGCCCCGGGTTCCTCCCGGGGCTACGCCTGTCTGAGGGTCGCTT149210.14581389237681922No Hit
GAGAGAGGCATGATCGTAGCGATAACTTGGAATTCTCGGGTGCCAAGGAA148590.1452080039425747RNA PCR Primer, Index 1 (100% over 23bp)
GAGAGAGGCATGATCGTAGCTGGAATTCTCGGGTGCCAAGGAACTCCAGT148550.1451689143661718RNA PCR Primer, Index 1 (100% over 30bp)
AACATTCAACGCTGTCGGTGATGGAATTCTCGGGTGCCAAGGAACTCCAG145610.14229583050056058RNA PCR Primer, Index 1 (100% over 29bp)
GCATGTGGTTCAGTGGTAGAATTCTCGCCTGGAATTCTCGGGTGCCAAGG142400.13915889199422998Illumina Small RNA Adapter 2 (100% over 21bp)
CATTGCACTTGTCTCGGTCTGATGGAATTCTCGGGTGCCAAGGAACTCCA141470.1382500593428632RNA PCR Primer, Index 1 (100% over 28bp)
TTCCAGTGATGACAGCCTATAATCTGACTTGGAATTCTCGGGTGCCAAGG141120.13790802554933804Illumina Small RNA Adapter 2 (100% over 21bp)
ACTGGACAACTCTTAGCGGTGGAATTCTCGGGTGCCAAGGAACTCCAGTC140940.1377321224555251RNA PCR Primer, Index 1 (100% over 31bp)
TACCCTGTAGATCCGGATTTGTGTGGAATTCTCGGGTGCCAAGGAACTCC140670.1374682678148057RNA PCR Primer, Index 1 (100% over 27bp)
TACGACCTCAGATCAGACGAGACAACCCGCTGAATTTGGAATTCTCGGGT139690.1365105731929353No Hit
TATTGCACTTGTCCCGGCCTGTTTGGAATTCTCGGGTGCCAAGGAACTCC139460.1362858081286188RNA PCR Primer, Index 1 (100% over 27bp)
TCCCTGGTGGTCTAGTGGTTAGGATTCGGCGCTTGGAATTCTCGGGTGCC137560.1344290532494823No Hit
GAGAGAGGCATGATCGTAGCGATAACTGGAATTCTCGGGTGCCAAGGAAC134340.13128234234905098RNA PCR Primer, Index 1 (100% over 24bp)
GTTTCCGTAGTGTAGTGGTTATCACGTTCGCCTGTGGAATTCTCGGGTGC133810.1307644054617129No Hit
AGCCTGTGATGATACAAGTTATCCCTGTCTGAACTCTGGTGTGGAATTCT132430.12941581507581373No Hit
TCCGAATGATGAAATGTTGTTGATCTCTGTAGTAACCACGGTTACAGTGA130980.12799881793120957No Hit
GCATTGGTGGTTCAGTGGTAGAATTCTCTGGAATTCTCGGGTGCCAAGGA129150.1262104698107781RNA PCR Primer, Index 1 (100% over 22bp)
TCCCTGGTGGTCTAGTGGTTAGGATTCGGCGCTCTCACCGCCGCGGCCCG128740.12580980165264866No Hit
CATGGCTGATGACCTTTGATGCGTTAGACTTCTGATTTAAAAATGAAGTC126800.12391395719710929No Hit
TGGAGTGTGACAATGGTGTTTGTTGGAATTCTCGGGTGCCAAGGAACTCC126260.12338624791567049RNA PCR Primer, Index 1 (100% over 27bp)
TAGCTTATCAGACTGGTGTTGGTGGAATTCTCGGGTGCCAAGGAACTCCA125240.12238946371739721RNA PCR Primer, Index 1 (100% over 28bp)
TCGTACCGTGAGTAATAATGCATGGAATTCTCGGGTGCCAAGGAACTCCA122960.12016135786243343RNA PCR Primer, Index 1 (100% over 28bp)
AACTGGACAACTCTTAGCGGTGGAATTCTCGGGTGCCAAGGAACTCCAGT122570.1197802344925054RNA PCR Primer, Index 1 (100% over 30bp)
TTCAAGTAATCCAGGATAGGCTGGAATTCTCGGGTGCCAAGGAACTCCAG122300.11951637985178601RNA PCR Primer, Index 1 (100% over 29bp)
TCCCTGTGGTCTAGTGGTTAGGATTCGGCTGGAATTCTCGGGTGCCAAGG120940.1181873342540883Illumina Small RNA Adapter 2 (100% over 21bp)
TACCCTGTAGAACCGAATTTGCGTGGAATTCTCGGGTGCCAAGGAACTCC115980.11334022678013199RNA PCR Primer, Index 1 (100% over 27bp)
ATCCATGATGACATTAAAACATAACGTGCCTGTTGGATGAAGCTTGCGGA113120.11054532206732652No Hit
GCATTTGTGGTTCAGTGGTAGAATTCTCGCCTGGAATTCTCGGGTGCCAA113080.11050623249092364No Hit
TTCAAGTAATCCAGGATAGGCTTTGGAATTCTCGGGTGCCAAGGAACTCC112880.11031078460890928RNA PCR Primer, Index 1 (100% over 27bp)
AACCCGTAGATCCGAACTTGTGTGGAATTCTCGGGTGCCAAGGAACTCCA112120.10956808265725469RNA PCR Primer, Index 1 (100% over 28bp)
TCAGTAACTGGAATCTGTCCCTGCTGGAATTCTCGGGTGCCAAGGAACTC111480.1089426494348087RNA PCR Primer, Index 1 (100% over 26bp)
TGAGAACTGAATTCCATAGATGGTGGAATTCTCGGGTGCCAAGGAACTCC110460.10794586523653542RNA PCR Primer, Index 1 (100% over 27bp)
TGTAAACATCCTACACTCAGCTTGGAATTCTCGGGTGCCAAGGAACTCCA110110.10760383144301029RNA PCR Primer, Index 1 (100% over 28bp)
GATGGGAGACCGCCTGGGAATACCAGGTGCTGTAAGCTTTGGAATTCTCG108080.10562003544056443No Hit
ATGACCTATGAATTGACAGCTGGAATTCTCGGGTGCCAAGGAACTCCAGT108070.10561026304646373RNA PCR Primer, Index 1 (100% over 30bp)
CATGGAATTCTCGGGTGCCAAGGAACTCCAGTCACACTGATATCTCGTAT107050.10461347884819046RNA PCR Primer, Index 25 (100% over 48bp)
TGTAAACATCCCCGACTGGAAGCTGGAATTCTCGGGTGCCAAGGAACTCC104730.1023462834168238RNA PCR Primer, Index 1 (100% over 27bp)
GCATTGTGGTTCAGTGGTAGAATTCTCGCCTGCCATGGAATTCTCGGGTG104590.10220946989941372No Hit
TGTAACAGCAACTCCATGTGGATGGAATTCTCGGGTGCCAAGGAACTCCA103980.10161335385926991RNA PCR Primer, Index 1 (100% over 28bp)
GCATTGTGGTTCAGTGGTAGAATTCTCGCCTGGACTTCTCGGGTGCCAAG103860.10149608513006128No Hit
GCATTGGTGGTTCAGTGGTAGAATTCTCGCCTGCCTGGAATTCTCGGGTG103200.10085110711941386No Hit

[FAIL]Adapter Content

Adapter graph

[FAIL]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
CCGCTAT408.3309715E-943.99516729
TGGCGCG207.86441E-443.9943112
TAGGGTA254.4487126E-543.9943058
GCTATCC207.865357E-443.9932377
ACCTAGG408.3346094E-943.9932374
GCTATTA351.4493344E-743.993235
AACATTC198800.043.875071
TCAACGC178450.043.869976
TGACCTA893800.043.856812
ACATTCA200400.043.8543972
CCGTAGT309900.043.8441775
CAACGCT179000.043.8211947
TTCAACG178750.043.8209535
CTATGAA894900.043.8187186
CGTAGTG310350.043.8160446
ACCTATG894650.043.813754
GAATTGA896550.043.81274810
TCCCATA132250.043.808111
GACCTAT894750.043.7965623
CCTATGA895250.043.791755