FastQCFastQC Report
Mon 5 Dec 2016
JG73_1_CGTACG_L008_R1_001.fastq

Summary

[OK]Basic Statistics

MeasureValue
FilenameJG73_1_CGTACG_L008_R1_001.fastq
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences18779293
Sequences flagged as poor quality0
Sequence length50
%GC51

[OK]Per base sequence quality

Per base quality graph

[FAIL]Per tile sequence quality

Per base quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[FAIL]Per base sequence content

Per base sequence content

[FAIL]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[OK]Sequence Length Distribution

Sequence length distribution

[FAIL]Sequence Duplication Levels

Duplication level graph

[FAIL]Overrepresented sequences

SequenceCountPercentagePossible Source
AACATTCAACGCTGTCGGTGAGTGGAATTCTCGGGTGCCAAGGAACTCCA12342666.57248385229412RNA PCR Primer, Index 1 (100% over 28bp)
AACATTCAACGCTGTCGGTGAGTTGGAATTCTCGGGTGCCAAGGAACTCC9805785.221591675469359RNA PCR Primer, Index 1 (100% over 27bp)
TTCAAGTAATCCAGGATAGGCTTGGAATTCTCGGGTGCCAAGGAACTCCA8484254.517875087203762RNA PCR Primer, Index 1 (100% over 28bp)
TCACAGTGAACCGGTCTCTTTTGGAATTCTCGGGTGCCAAGGAACTCCAG5775223.075312792659447RNA PCR Primer, Index 1 (100% over 29bp)
AACTCTTAGCGGTGGATCACTCGGCTCGTGCGTCGATGAAGAACGCAGCT4123162.1955885133694863No Hit
AACATTCAACGCTGTCGGTGATGGAATTCTCGGGTGCCAAGGAACTCCAG3185871.6964802668556267RNA PCR Primer, Index 1 (100% over 29bp)
TGAGGTAGTAGGTTGTATAGTTTGGAATTCTCGGGTGCCAAGGAACTCCA3093911.6475114371984079RNA PCR Primer, Index 1 (100% over 28bp)
CAACTCTTAGCGGTGGATCACTCGGCTCGTGCGTCGATGAAGAACGCAGC2111101.1241637265045068No Hit
TCCCTGAGACCCTTAACCTGTGTGGAATTCTCGGGTGCCAAGGAACTCCA1449180.7716903932432387RNA PCR Primer, Index 1 (100% over 28bp)
TTAAAGGGAATTTGCGACTGTTTGGAATTCTCGGGTGCCAAGGAACTCCA1387780.7389948066734994RNA PCR Primer, Index 1 (100% over 28bp)
TAAAGCTAGAGAACCGAAAGTATGGAATTCTCGGGTGCCAAGGAACTCCA1350000.718876903406321RNA PCR Primer, Index 1 (100% over 28bp)
TCTTTGGTTATCTAGCTGTATTGGAATTCTCGGGTGCCAAGGAACTCCAG1331370.7089564021393138RNA PCR Primer, Index 1 (100% over 29bp)
TCTTTGGTTATCTAGCTGTATGATGGAATTCTCGGGTGCCAAGGAACTCC1256620.6691519217470008RNA PCR Primer, Index 1 (100% over 27bp)
TTGCATAGTCACAAAAGTGATCTGGAATTCTCGGGTGCCAAGGAACTCCA1234800.657532740982315RNA PCR Primer, Index 1 (100% over 28bp)
CCTGTCTGAGGGTCGCTTGGAATTCTCGGGTGCCAAGGAACTCCAGTCAC1208590.6435758790280337RNA PCR Primer, Index 1 (100% over 33bp)
TCACAGTGAACCGGTCTCTTTTTGGAATTCTCGGGTGCCAAGGAACTCCA1139800.6069451070389071RNA PCR Primer, Index 1 (100% over 28bp)
AACATTCATTGCTGTCGGTGGGTGGAATTCTCGGGTGCCAAGGAACTCCA1110300.5912363154459542RNA PCR Primer, Index 1 (100% over 28bp)
AGCTACATCTGGCTACTGGGTCTCTGGAATTCTCGGGTGCCAAGGAACTC1101110.5863426274886919RNA PCR Primer, Index 1 (100% over 26bp)
TCCCTGAGACCCTTAACCTGTGATGGAATTCTCGGGTGCCAAGGAACTCC1095150.5831689190855055RNA PCR Primer, Index 1 (100% over 27bp)
TAGCTTATCAGACTGGTGTTGGCTGGAATTCTCGGGTGCCAAGGAACTCC1094970.583073068831718RNA PCR Primer, Index 1 (100% over 27bp)
TCACAGTGAACCGGTCTCTTTGGAATTCTCGGGTGCCAAGGAACTCCAGT1087040.5788503326509683RNA PCR Primer, Index 1 (100% over 30bp)
AAGCTGCCAGCTGAAGAACTGTTGGAATTCTCGGGTGCCAAGGAACTCCA1009300.5374536730429629RNA PCR Primer, Index 1 (100% over 28bp)
TTCACAGTGGCTAAGTTCTGCTGGAATTCTCGGGTGCCAAGGAACTCCAG996160.5304566045164746RNA PCR Primer, Index 1 (100% over 29bp)
AACATTCATTGCTGTCGGTGGGTTGGAATTCTCGGGTGCCAAGGAACTCC981390.5225915586917995RNA PCR Primer, Index 1 (100% over 27bp)
TGAGGTAGTAGTTTGTGCTGTTTGGAATTCTCGGGTGCCAAGGAACTCCA934250.4974894422276706RNA PCR Primer, Index 1 (100% over 28bp)
TAACAGTCTACAGTCATGGCTTGGAATTCTCGGGTGCCAAGGAACTCCAG889560.4736919542178718RNA PCR Primer, Index 1 (100% over 29bp)
TTCACAGTGGCTAAGTTCTGTGGAATTCTCGGGTGCCAAGGAACTCCAGT826100.43989941474367533RNA PCR Primer, Index 1 (100% over 30bp)
TGAGGTAGTAGTTTGTATAGTTTGGAATTCTCGGGTGCCAAGGAACTCCA773330.4117993153416372RNA PCR Primer, Index 1 (100% over 28bp)
TCCAGCATCAGTGATTTTGTTTGGAATTCTCGGGTGCCAAGGAACTCCAG756870.4030343421341793RNA PCR Primer, Index 1 (100% over 29bp)
TCTTTGGTTATCTAGCTGTATGTGGAATTCTCGGGTGCCAAGGAACTCCA745600.39703305124426147RNA PCR Primer, Index 1 (100% over 28bp)
TATTGCACTCGTCCCGGCCTCCTGGAATTCTCGGGTGCCAAGGAACTCCA744220.3962981992985572RNA PCR Primer, Index 1 (100% over 28bp)
ACCTTGGCTTTAGACTGCTTACTTGGAATTCTCGGGTGCCAAGGAACTCC734930.39135126120030184RNA PCR Primer, Index 1 (100% over 27bp)
TCCAGCATCAGTGATTTTGTTGTGGAATTCTCGGGTGCCAAGGAACTCCA723460.38524347002839776RNA PCR Primer, Index 1 (100% over 28bp)
TTCCCTTTGTCATCCTATGCCTGTGGAATTCTCGGGTGCCAAGGAACTCC664710.35395901219497455RNA PCR Primer, Index 1 (100% over 27bp)
TCCCTGAGACCCTAACTTGTGATGGAATTCTCGGGTGCCAAGGAACTCCA629080.334985986959147RNA PCR Primer, Index 1 (100% over 28bp)
TAAAGCTAGAGAACCGAAAGTTGGAATTCTCGGGTGCCAAGGAACTCCAG621950.33118925190634174RNA PCR Primer, Index 1 (100% over 29bp)
AAGCTGCCAGCTGAAGAACTTGGAATTCTCGGGTGCCAAGGAACTCCAGT582040.3099371206360112RNA PCR Primer, Index 1 (100% over 30bp)
AACCCGTAGATCCGAACTTGTGTGGAATTCTCGGGTGCCAAGGAACTCCA580630.309186293648009RNA PCR Primer, Index 1 (100% over 28bp)
TCCCTGAGACCCTTAACCTGTTGGAATTCTCGGGTGCCAAGGAACTCCAG572880.3050594077210468RNA PCR Primer, Index 1 (100% over 29bp)
CCCTGAGACCCTTAACCTGTGATGGAATTCTCGGGTGCCAAGGAACTCCA554610.2953306069616146RNA PCR Primer, Index 1 (100% over 28bp)
AGCTACATCTGGCTACTGGGTCTTGGAATTCTCGGGTGCCAAGGAACTCC552750.2943401543391436RNA PCR Primer, Index 1 (100% over 27bp)
TGAGGTAGTAGGTTGTATAGTTGGAATTCTCGGGTGCCAAGGAACTCCAG543960.2896594669458536RNA PCR Primer, Index 1 (100% over 29bp)
TAAAGGGAATTTGCGACTGTTTGGAATTCTCGGGTGCCAAGGAACTCCAG530500.28249199796818764RNA PCR Primer, Index 1 (100% over 29bp)
ACAACTCTTAGCGGTGGATCACTCGGCTCGTGCGTCGATGAAGAACGCAG526340.2802767921028763No Hit
CTGTCTGAGGGTCGCTTGGAATTCTCGGGTGCCAAGGAACTCCAGTCACC499740.2661122545987221RNA PCR Primer, Index 2 (100% over 34bp)
CTGGACAACTCTTAGCGGTGGATCACTCGGCTCGTGCGTCGATGAAGAAC477050.2540297976073966No Hit
TACCCTGTAGAACCGAATGTGTTGGAATTCTCGGGTGCCAAGGAACTCCA470950.25078153900681993RNA PCR Primer, Index 1 (100% over 28bp)
TGAGGTAGTTGGTTGTATAGTTTGGAATTCTCGGGTGCCAAGGAACTCCA464680.247442755166555RNA PCR Primer, Index 1 (100% over 28bp)
AGCTGGTGTTGTGAATCAGGCCGTGGAATTCTCGGGTGCCAAGGAACTCC457650.2436992702547428RNA PCR Primer, Index 1 (100% over 27bp)
TATTGCACTTGTCCCGGCCTGTTGGAATTCTCGGGTGCCAAGGAACTCCA443150.23597799981074902RNA PCR Primer, Index 1 (100% over 28bp)
TCTTTGGTTATCTAGCTGTATGTTGGAATTCTCGGGTGCCAAGGAACTCC442910.23585019947236566RNA PCR Primer, Index 1 (100% over 27bp)
TACGACCTCAGATCAGACGAGACAACCCGCTGAATTTAAGCATATTACTA440910.2347851966525044No Hit
AACATTCAACGCTGTCGGTGGTGGAATTCTCGGGTGCCAAGGAACTCCAG432990.23056778548585402RNA PCR Primer, Index 1 (100% over 29bp)
CTACGCCTGTCTGAGGGTCGCTTGGAATTCTCGGGTGCCAAGGAACTCCA419400.22333109132489704RNA PCR Primer, Index 1 (100% over 28bp)
TTCAAGTAATCCAGGATAGGCTGGAATTCTCGGGTGCCAAGGAACTCCAG412390.2195982564412835RNA PCR Primer, Index 1 (100% over 29bp)
TTGCGGCCCCGGGTTCCTCCCGGGGCTACGCCTGTCTGAGGGTCGCTTGG397660.21175451067300563No Hit
TTCAAGTAATCCAGGATAGGCTTTGGAATTCTCGGGTGCCAAGGAACTCC386740.20593959527656341RNA PCR Primer, Index 1 (100% over 27bp)
AGCTACATTGTCTGCTGGGTTTTGGAATTCTCGGGTGCCAAGGAACTCCA366220.1950126663447873RNA PCR Primer, Index 1 (100% over 28bp)
TTCAAGTAATCCAGGATAGGTTTGGAATTCTCGGGTGCCAAGGAACTCCA362620.19309566126903713RNA PCR Primer, Index 1 (100% over 28bp)
ACCGTGGCTTTAGATTGTTACTTGGAATTCTCGGGTGCCAAGGAACTCCA351480.18716359556241016RNA PCR Primer, Index 1 (100% over 28bp)
TAGCAGCACGTAAATATTGGAGTGGAATTCTCGGGTGCCAAGGAACTCCA342680.1824775831550208RNA PCR Primer, Index 1 (100% over 28bp)
AAGCTGCCAGTTGAAGAGCTGTTGGAATTCTCGGGTGCCAAGGAACTCCA326250.1737285849898609RNA PCR Primer, Index 1 (100% over 28bp)
AGAATAATGCCAGCAGTCGGTCTGGAATTCTCGGGTGCCAAGGAACTCCA326140.17367000983476855RNA PCR Primer, Index 1 (100% over 28bp)
ACCATCGACCGTTGACTGTGCCTGGAATTCTCGGGTGCCAAGGAACTCCA314600.16752494356416933RNA PCR Primer, Index 1 (100% over 28bp)
TGTCTGAGGGTCGCTTGGAATTCTCGGGTGCCAAGGAACTCCAGTCACCG312360.16633214040592476RNA PCR Primer, Index 2 (100% over 35bp)
TGTAAACATCCTTGACTGGAAGCTTGGAATTCTCGGGTGCCAAGGAACTC307030.16349390789099463RNA PCR Primer, Index 1 (100% over 26bp)
AGCTACATTGTCTGCTGGGTTTCTGGAATTCTCGGGTGCCAAGGAACTCC292680.15585251265849037RNA PCR Primer, Index 1 (100% over 27bp)
ACCATCGACCGTTGACTGTACCTGGAATTCTCGGGTGCCAAGGAACTCCA286710.15267347924120467RNA PCR Primer, Index 1 (100% over 28bp)
TTGCATAGTCACAAAAATGAGCTGGAATTCTCGGGTGCCAAGGAACTCCA284440.15146470104066218RNA PCR Primer, Index 1 (100% over 28bp)
TTCCCTTTGTCATCCTATGCCTTGGAATTCTCGGGTGCCAAGGAACTCCA277380.14770524108655209RNA PCR Primer, Index 1 (100% over 28bp)
GTACAGTACTGTGATAACTGATGGAATTCTCGGGTGCCAAGGAACTCCAG274800.14633138744893112RNA PCR Primer, Index 1 (100% over 29bp)
TGCTCAGTAGTCAGTGTAGATCCTGGAATTCTCGGGTGCCAAGGAACTCC268060.14274232794599884RNA PCR Primer, Index 1 (100% over 27bp)
AACATTCAACGCTGTCGGTGAGATGGAATTCTCGGGTGCCAAGGAACTCC265430.14134184923788132RNA PCR Primer, Index 1 (100% over 27bp)
TAAATCTAGAGAACCGAAAGTATGGAATTCTCGGGTGCCAAGGAACTCCA262980.14003722078355132RNA PCR Primer, Index 1 (100% over 28bp)
TGAGATGAAGCACTGTAGCTCTTGGAATTCTCGGGTGCCAAGGAACTCCA259840.13836516635636922RNA PCR Primer, Index 1 (100% over 28bp)
TACCCTGTAGAACCGAATTTGTTGGAATTCTCGGGTGCCAAGGAACTCCA247050.13155447332335674RNA PCR Primer, Index 1 (100% over 28bp)
TAGCTTATCAGACTGGTGTTGGTGGAATTCTCGGGTGCCAAGGAACTCCA242450.12910496683767594RNA PCR Primer, Index 1 (100% over 28bp)
AACATTCATTGCTGTCGGTGGGTTTGGAATTCTCGGGTGCCAAGGAACTC235150.12521770654518252RNA PCR Primer, Index 1 (100% over 26bp)
TGAGGTAGTTGGTTGTATTGTTTGGAATTCTCGGGTGCCAAGGAACTCCA233390.12428050406370462RNA PCR Primer, Index 1 (100% over 28bp)
CCACGTTCCCGTGGTGGAATTCTCGGGTGCCAAGGAACTCCAGTCACCGT231890.12348175194880871RNA PCR Primer, Index 12 (97% over 36bp)
CTTTGGTTATCTAGCTGTATGATGGAATTCTCGGGTGCCAAGGAACTCCA229060.12197477295870511RNA PCR Primer, Index 1 (100% over 28bp)
TGCTCAGTAGTCAGTGTAGATCTGGAATTCTCGGGTGCCAAGGAACTCCA229060.12197477295870511RNA PCR Primer, Index 1 (100% over 28bp)
TGGAATTCTCGGGTGCCAAGGAACTCCAGTCACCGTACGATCTCGTATGC227780.12129317115399392RNA PCR Primer, Index 22 (100% over 50bp)
TGTAAACATCCTACACTCTCAGCTTGGAATTCTCGGGTGCCAAGGAACTC223160.11883301464011452RNA PCR Primer, Index 1 (100% over 26bp)
TGAGGTAGTAGGTTGTATAGTTTTGGAATTCTCGGGTGCCAAGGAACTCC222730.11860403903384437RNA PCR Primer, Index 1 (100% over 27bp)
AACATTCAACGCTGTCGGTGTGGAATTCTCGGGTGCCAAGGAACTCCAGT219120.11668170894399486RNA PCR Primer, Index 1 (100% over 30bp)
AACATTCAACGCTGTCGGTGAGTTTGGAATTCTCGGGTGCCAAGGAACTC217050.11557943102543851RNA PCR Primer, Index 1 (100% over 26bp)
AGCAGCATTGTACAGGGCTATGATGGAATTCTCGGGTGCCAAGGAACTCC216580.11532915536277111RNA PCR Primer, Index 1 (100% over 27bp)
ATCTACATCTGGCTACTGGGTCTCTGGAATTCTCGGGTGCCAAGGAACTC215800.11491380426302525RNA PCR Primer, Index 1 (100% over 26bp)
ACTGGACAACTCTTAGCGGTGGATCACTCGGCTCGTGCGTCGATGAAGAA211760.11276249856690557No Hit
TGAGATGAAGCACTGTAGCTCTGGAATTCTCGGGTGCCAAGGAACTCCAG209310.11145787011257559RNA PCR Primer, Index 1 (100% over 29bp)
TAACAGTCTACAGCCATGGTCGTGGAATTCTCGGGTGCCAAGGAACTCCA208300.11092004368854567RNA PCR Primer, Index 1 (100% over 28bp)
CCTTGGCTTTAGACTGCTTACTTGGAATTCTCGGGTGCCAAGGAACTCCA205930.10965801534701014RNA PCR Primer, Index 1 (100% over 28bp)
TCCCTGAGACCCTTAACCTGTGGTGGAATTCTCGGGTGCCAAGGAACTCC201660.10738423432660645RNA PCR Primer, Index 1 (100% over 27bp)
AACTCTTAGCGGTGGATCACTCGGCTCGTGCGTCGCTGAAGAACGCAGCT198400.10564827973023265No Hit
TAAAGCTAGAGAACCGAAAGTAATGGAATTCTCGGGTGCCAAGGAACTCC190660.10152671881736976RNA PCR Primer, Index 1 (100% over 27bp)
TACAGTACTGTGATAACTGAAGTGGAATTCTCGGGTGCCAAGGAACTCCA189490.10090369216775093RNA PCR Primer, Index 1 (100% over 28bp)

[FAIL]Adapter Content

Adapter graph

[WARN]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
ACGATAC254.4137712E-544.0533521
AACATTC3354700.044.023151
TGACCTA2950.043.9692342
CGAGTAA4650.043.9691163
CTAAATC254.4639204E-543.9691163
AATATCC408.378265E-943.9677164
TACAACG207.8889634E-443.966665
CGAATAC408.38736E-943.9622111
TTTGCGC351.4574834E-743.96220811
GCGAACA207.8953797E-443.95940419
CGATAAT4550.043.95928220
CAACATA207.896208E-443.95846638
ATCGTAA502.7284841E-1143.9584668
ACTAGCA254.4703098E-543.9584667
CCTCTTA800.043.9584666
TTCAAGT1096500.043.906711
ACCGGTC980650.043.89272310
TTCAACG3095600.043.8920945
TCCCTGA490250.043.891611
CATTCAA3026950.043.881963