FastQCFastQC Report
Mon 5 Dec 2016
JG7_5_GTCCGC_L002_R1_001.fastq

Summary

[OK]Basic Statistics

MeasureValue
FilenameJG7_5_GTCCGC_L002_R1_001.fastq
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences10060042
Sequences flagged as poor quality0
Sequence length50
%GC51

[OK]Per base sequence quality

Per base quality graph

[FAIL]Per tile sequence quality

Per base quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[FAIL]Per base sequence content

Per base sequence content

[FAIL]Per sequence GC content

Per sequence GC content graph

[WARN]Per base N content

N content graph

[OK]Sequence Length Distribution

Sequence length distribution

[FAIL]Sequence Duplication Levels

Duplication level graph

[FAIL]Overrepresented sequences

SequenceCountPercentagePossible Source
TTCAAGTAATCCAGGATAGGCTTGGAATTCTCGGGTGCCAAGGAACTCCA6233996.196783273867047RNA PCR Primer, Index 1 (100% over 28bp)
AACATTCAACGCTGTCGGTGAGTGGAATTCTCGGGTGCCAAGGAACTCCA5968265.932639247430577RNA PCR Primer, Index 1 (100% over 28bp)
AACATTCAACGCTGTCGGTGAGTTGGAATTCTCGGGTGCCAAGGAACTCC3642383.6206409476222863RNA PCR Primer, Index 1 (100% over 27bp)
TTCCCTTTGTCATCCTATGCCTTGGAATTCTCGGGTGCCAAGGAACTCCA3614413.592837882784187RNA PCR Primer, Index 1 (100% over 28bp)
TACCCTGTAGAACCGAATTTGTTGGAATTCTCGGGTGCCAAGGAACTCCA2872602.8554552754352316RNA PCR Primer, Index 1 (100% over 28bp)
TACCCTGTAGAACCGAATTTGCTGGAATTCTCGGGTGCCAAGGAACTCCA2008131.9961447477058247RNA PCR Primer, Index 1 (100% over 28bp)
TCCTTCATTCCACCGGAGTCTGTGGAATTCTCGGGTGCCAAGGAACTCCA1940421.928838865682668RNA PCR Primer, Index 1 (100% over 28bp)
TAGCTTATCAGACTGGTGTTGGCTGGAATTCTCGGGTGCCAAGGAACTCC1867631.8564833029524133RNA PCR Primer, Index 1 (100% over 27bp)
TACCCTGTAGAACCGAATTTGCGTGGAATTCTCGGGTGCCAAGGAACTCC1668881.6589195154453629RNA PCR Primer, Index 1 (100% over 27bp)
AAGCTGCCAGCTGAAGAACTGTTGGAATTCTCGGGTGCCAAGGAACTCCA1560201.5508881573257847RNA PCR Primer, Index 1 (100% over 28bp)
AACAGTAAGAGTTTATGTGCTGTGGAATTCTCGGGTGCCAAGGAACTCCA1386891.3786125346196367RNA PCR Primer, Index 1 (100% over 28bp)
TCCTTCATTCCACCGGAGTCTGTTGGAATTCTCGGGTGCCAAGGAACTCC843640.838604848767033RNA PCR Primer, Index 1 (100% over 27bp)
AACATTCAACGCTGTCGGTGATGGAATTCTCGGGTGCCAAGGAACTCCAG821950.817044302598339RNA PCR Primer, Index 1 (100% over 29bp)
ACCCTGTAGAACCGAATTTGCGTGGAATTCTCGGGTGCCAAGGAACTCCA797830.793068259555974RNA PCR Primer, Index 1 (100% over 28bp)
TTCACGTAATCCAGGATAGGCTTGGAATTCTCGGGTGCCAAGGAACTCCA764460.7598974238874947RNA PCR Primer, Index 1 (100% over 28bp)
TTGGTCCCCTTCAACCAGCTGTTGGAATTCTCGGGTGCCAAGGAACTCCA741490.7370645172256736RNA PCR Primer, Index 1 (100% over 28bp)
TACCCTGTAGATCCGGATTTGTTGGAATTCTCGGGTGCCAAGGAACTCCA706490.7022734099917277RNA PCR Primer, Index 1 (100% over 28bp)
TGAGGTAGTAGGTTGTATAGTTTGGAATTCTCGGGTGCCAAGGAACTCCA680200.676140318300858RNA PCR Primer, Index 1 (100% over 28bp)
TATTGCACTTGTCCCGGCCTGTTGGAATTCTCGGGTGCCAAGGAACTCCA659700.6557626697781183RNA PCR Primer, Index 1 (100% over 28bp)
GCATTGGTGGTTCAGTGGTAGAATTCTCGCCTTGGAATTCTCGGGTGCCA635460.6316673429395225No Hit
TTCACAGTGGCTAAGTTCTGTGGAATTCTCGGGTGCCAAGGAACTCCAGT593780.5902361043820692RNA PCR Primer, Index 1 (100% over 30bp)
TAACGGAACCCATAATGCAGCTGTGGAATTCTCGGGTGCCAAGGAACTCC537750.534540511858698RNA PCR Primer, Index 1 (100% over 27bp)
TTTGGTCCCCTTCAACCAGCTGTTGGAATTCTCGGGTGCCAAGGAACTCC535010.5318168651780977RNA PCR Primer, Index 1 (100% over 27bp)
CCTGTCTGAGGGTCGCTTGGAATTCTCGGGTGCCAAGGAACTCCAGTCAC475950.47310935679990207RNA PCR Primer, Index 1 (100% over 33bp)
TTCACAGTGGTTAAGTTCTGTGGAATTCTCGGGTGCCAAGGAACTCCAGT456250.4535269335853668RNA PCR Primer, Index 1 (100% over 30bp)
AAGCTGCCAGCTGAAGAACTTGGAATTCTCGGGTGCCAAGGAACTCCAGT411070.40861658430451886RNA PCR Primer, Index 1 (100% over 30bp)
TTCAAGTAATCCAGGATAGGCTGGAATTCTCGGGTGCCAAGGAACTCCAG393700.391350254800129RNA PCR Primer, Index 1 (100% over 29bp)
TTCAAGTAATCCAGGATAGGTTTGGAATTCTCGGGTGCCAAGGAACTCCA343760.3417083149354645RNA PCR Primer, Index 1 (100% over 28bp)
ACAGTAGTCTGCACATTGGTTTGGAATTCTCGGGTGCCAAGGAACTCCAG333460.3314697890923318RNA PCR Primer, Index 1 (100% over 29bp)
CATTGCACTTGTCTCGGTCTGATGGAATTCTCGGGTGCCAAGGAACTCCA330420.3284479329211548RNA PCR Primer, Index 1 (100% over 28bp)
AAGCTGCCAGCTGAAGAACTGCTGGAATTCTCGGGTGCCAAGGAACTCCA304660.3028416779969706RNA PCR Primer, Index 1 (100% over 28bp)
TTCACAGTGGCTAAGTTCTGCTGGAATTCTCGGGTGCCAAGGAACTCCAG302730.3009231969409273RNA PCR Primer, Index 1 (100% over 29bp)
TTCCATTTGTCATCCTATGCCTTGGAATTCTCGGGTGCCAAGGAACTCCA280980.279303008874118RNA PCR Primer, Index 1 (100% over 28bp)
TTGTTCCCCTTCAACCAGCTGTTGGAATTCTCGGGTGCCAAGGAACTCCA269250.2676430177925698RNA PCR Primer, Index 1 (100% over 28bp)
GCATTGGTGGTTCAGTGGTAGAATTCTCGCCTGGAATTCTCGGGTGCCAA252190.25068483809510933No Hit
TTCAAGTAATCCAGGATAGGCTTTGGAATTCTCGGGTGCCAAGGAACTCC241870.24042643161927157RNA PCR Primer, Index 1 (100% over 27bp)
TACCATGTAGAACCGAATTTGTTGGAATTCTCGGGTGCCAAGGAACTCCA236390.23497913825807087RNA PCR Primer, Index 1 (100% over 28bp)
TGGAATTCTCGGGTGCCAAGGAACTCCAGTCACGTCCGCATCTCGTATGC235760.23435289832785988RNA PCR Primer, Index 18 (100% over 50bp)
AGCCTGTGATGATACAAGTTATCCCTGTCTGAACTCTGGTGTGGAATTCT234720.23331910542719403No Hit
TTCCCTTTGTCATCCTATGCCTGTGGAATTCTCGGGTGCCAAGGAACTCC225630.22428335786272066RNA PCR Primer, Index 1 (100% over 27bp)
TCCTTCATTCCACCGGAGTCTTGGAATTCTCGGGTGCCAAGGAACTCCAG223630.22229529459220942RNA PCR Primer, Index 1 (100% over 29bp)
TATGTGCCCTTGGACTACATCGTGGAATTCTCGGGTGCCAAGGAACTCCA222170.22084400840473628RNA PCR Primer, Index 1 (100% over 28bp)
TTCCAGTGATGACAGCCTATAATCTGACTTGGAATTCTCGGGTGCCAAGG217310.21601301465739406Illumina Small RNA Adapter 2 (100% over 21bp)
ACCCTGTAGAACCGAATTTGTGTGGAATTCTCGGGTGCCAAGGAACTCCA216890.21559552137058674RNA PCR Primer, Index 1 (100% over 28bp)
TCCCTGGTGGTCTAGTGGTTAGGATTTGGCGCTCTGGAATTCTCGGGTGC212310.21104285648111606No Hit
TTCACAGTGGCTAAGTTCAGTTGGAATTCTCGGGTGCCAAGGAACTCCAG209670.2084186129640413RNA PCR Primer, Index 1 (100% over 29bp)
CCTTTCTGAGGGTCGCTTGGAATTCTCGGGTGCCAAGGAACTCCAGTCAC203560.2023450796726296RNA PCR Primer, Index 1 (100% over 33bp)
TTTTGTCCCCTTCAACCAGCTGTTGGAATTCTCGGGTGCCAAGGAACTCC197650.19647035270826899RNA PCR Primer, Index 1 (100% over 27bp)
TACCCTGTAGAACCGAATTTGTGGAATTCTCGGGTGCCAAGGAACTCCAG196150.19497930525538562RNA PCR Primer, Index 1 (100% over 29bp)
TATTGCACTTGTCCCGGCCTGTTTGGAATTCTCGGGTGCCAAGGAACTCC189360.1882298304520001RNA PCR Primer, Index 1 (100% over 27bp)
TAGCTTATCAGACTGGTGTTGGTGGAATTCTCGGGTGCCAAGGAACTCCA185800.18469107783049016RNA PCR Primer, Index 1 (100% over 28bp)
GTTTCCGTAGTGTAGTGGTTATCACGTTCGCCTTGGAATTCTCGGGTGCC183250.1821562971605884No Hit
ACCCTGTAGAACCGAATTTGCTGGAATTCTCGGGTGCCAAGGAACTCCAG182110.18102310109639702RNA PCR Primer, Index 1 (100% over 29bp)
TTAGGTAGTAGGTTGTATAGTTTGGAATTCTCGGGTGCCAAGGAACTCCA177670.17660960063586215RNA PCR Primer, Index 1 (100% over 28bp)
TTTGGTCCCCTTCAACCAGCTGTGGAATTCTCGGGTGCCAAGGAACTCCA171150.17012851437399568RNA PCR Primer, Index 1 (100% over 28bp)
GCATTGTGGTTCAGTGGTAGAATTCTCGCCTTGGAATTCTCGGGTGCCAA170420.16940287128025905No Hit
TTCACAGTGGTTAAGTTCTGCCTGGAATTCTCGGGTGCCAAGGAACTCCA169740.16872692976828527RNA PCR Primer, Index 1 (100% over 28bp)
TCCAGTGATGACAGCCTATAATCTGACTTGGAATTCTCGGGTGCCAAGGA168880.16787206256196543RNA PCR Primer, Index 1 (100% over 22bp)
AACATTCATTGCTGTCGGTGGGTGGAATTCTCGGGTGCCAAGGAACTCCA167390.1663909554254346RNA PCR Primer, Index 1 (100% over 28bp)
TGAGATGAAGCACTGTAGCTCTGGAATTCTCGGGTGCCAAGGAACTCCAG165330.16434325025680807RNA PCR Primer, Index 1 (100% over 29bp)
GTTTCCGTAGTGTAGTGGTTATCACGTTCGCCTCTGGAATTCTCGGGTGC160950.15998939169438856No Hit
TTATGTAGTAGGTTGTATAGTTTGGAATTCTCGGGTGCCAAGGAACTCCA160200.15924386796794684RNA PCR Primer, Index 1 (100% over 28bp)
TACCATGTAGAACCGAATTTGCTGGAATTCTCGGGTGCCAAGGAACTCCA157290.15635123590935307RNA PCR Primer, Index 1 (100% over 28bp)
TGAGATGAAGCACTGTAGCTCTTGGAATTCTCGGGTGCCAAGGAACTCCA154250.15332937973817604RNA PCR Primer, Index 1 (100% over 28bp)
CATTATTACTTTTGGTACGCGTGGAATTCTCGGGTGCCAAGGAACTCCAG153200.15228564652115767RNA PCR Primer, Index 1 (100% over 29bp)
CTACGCCTGTCTGAGGGTCGCTTGGAATTCTCGGGTGCCAAGGAACTCCA149360.14846856504177616RNA PCR Primer, Index 1 (100% over 28bp)
TGATGTAGTAGGTTGTATAGTTTGGAATTCTCGGGTGCCAAGGAACTCCA146850.14597354563728462RNA PCR Primer, Index 1 (100% over 28bp)
AACATTCAACGCTGTCGGTGAGATGGAATTCTCGGGTGCCAAGGAACTCC145060.14419422901017712RNA PCR Primer, Index 1 (100% over 27bp)
TTCACAGTGGTTAAGTTCTGCCTTGGAATTCTCGGGTGCCAAGGAACTCC139800.13896562260873266RNA PCR Primer, Index 1 (100% over 27bp)
CCCAGTGTTCAGACTACCTGTTTGGAATTCTCGGGTGCCAAGGAACTCCA139390.13855806963827785RNA PCR Primer, Index 1 (100% over 28bp)
TACAGTAGTCTGCACATTGGTTTGGAATTCTCGGGTGCCAAGGAACTCCA136510.13569525852874173RNA PCR Primer, Index 1 (100% over 28bp)
ACCCTGTAGAACCGAATTTGTTGGAATTCTCGGGTGCCAAGGAACTCCAG131140.13035730864741918RNA PCR Primer, Index 1 (100% over 29bp)
AACACTCAACGCTGTCGGTGAGTGGAATTCTCGGGTGCCAAGGAACTCCA130990.13020820390213084RNA PCR Primer, Index 1 (100% over 28bp)
TACCATGTAGAACCGAATTTGCGTGGAATTCTCGGGTGCCAAGGAACTCC130890.13010880073860526RNA PCR Primer, Index 1 (100% over 27bp)
TACCCTGTAGAACCGAATGTGTTGGAATTCTCGGGTGCCAAGGAACTCCA129790.1290153659398241RNA PCR Primer, Index 1 (100% over 28bp)
TCCCTGGTGGTCTAGTGGTTAGGATTCGGCGCTCTGGAATTCTCGGGTGC129330.12855811138760653No Hit
TGGACGGAGAACTGATAAGGGCTGGAATTCTCGGGTGCCAAGGAACTCCA128540.1277728263957546RNA PCR Primer, Index 1 (100% over 28bp)
TCCCTGAGACCCTTAACCTGTGTGGAATTCTCGGGTGCCAAGGAACTCCA127340.1265799884334479RNA PCR Primer, Index 1 (100% over 28bp)
AACATTCAACGCTGTCGGTGGTGGAATTCTCGGGTGCCAAGGAACTCCAG127180.126420943371807RNA PCR Primer, Index 1 (100% over 29bp)
AACATTCATTGCTGTCGGTGGGTTGGAATTCTCGGGTGCCAAGGAACTCC127010.12625195799381353RNA PCR Primer, Index 1 (100% over 27bp)
TTCAAGTAATCCAGGATGGGCTTGGAATTCTCGGGTGCCAAGGAACTCCA126100.12534738920573094RNA PCR Primer, Index 1 (100% over 28bp)
ACATTAGTCTGCACATTGGTTTGGAATTCTCGGGTGCCAAGGAACTCCAG125880.12512870224597472RNA PCR Primer, Index 1 (100% over 29bp)
TCCAGCATCAGTGATTTTGTTTGGAATTCTCGGGTGCCAAGGAACTCCAG125620.12487025402080827RNA PCR Primer, Index 1 (100% over 29bp)
GAATACCAGGTGCTGTAAGCTTTGGAATTCTCGGGTGCCAAGGAACTCCA125020.1242738350396549RNA PCR Primer, Index 1 (100% over 28bp)
AACCCGTAGATCCGAACTTGTGTGGAATTCTCGGGTGCCAAGGAACTCCA124480.12373705795661687RNA PCR Primer, Index 1 (100% over 28bp)
TCCAGCATCAGTGATTTTGTTGTGGAATTCTCGGGTGCCAAGGAACTCCA123110.12237523461631672RNA PCR Primer, Index 1 (100% over 28bp)
TCCCTGTGGTCTAGTGGTTAGGATTTGGCGCTCTGGAATTCTCGGGTGCC122490.12175893500245825No Hit
TTCACAGTGGCTAAGTTCTGCTTGGAATTCTCGGGTGCCAAGGAACTCCA122340.12160983025716988RNA PCR Primer, Index 1 (100% over 28bp)
TATTGCACTTGTCCCGGCCTGTATGGAATTCTCGGGTGCCAAGGAACTCC120890.12016848438604927RNA PCR Primer, Index 1 (100% over 27bp)
TGAGGTAGTAGGTTGTATAGTTGGAATTCTCGGGTGCCAAGGAACTCCAG119390.11867743693316588RNA PCR Primer, Index 1 (100% over 29bp)
GCCCGGCTAGCTCAGTCGGTAGAGCATGAGACTTGGAATTCTCGGGTGCC115840.11514862462800851No Hit
TACCCTGTAGATCCGGATTTGTGTGGAATTCTCGGGTGCCAAGGAACTCC115510.11482059418837416RNA PCR Primer, Index 1 (100% over 27bp)
TATTGCACTTGTCCCGGCCTGTATTGGAATTCTCGGGTGCCAAGGAACTC110430.10977091348127573RNA PCR Primer, Index 1 (100% over 26bp)
TGAGATGAAGCACTGTAGCTTGGAATTCTCGGGTGCCAAGGAACTCCAGT105120.1044926054980685RNA PCR Primer, Index 1 (100% over 30bp)
TCCCTGAGACCCTTAACCTGTGATGGAATTCTCGGGTGCCAAGGAACTCC101700.10109301730549436RNA PCR Primer, Index 1 (100% over 27bp)

[WARN]Adapter Content

Adapter graph

[FAIL]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
ACGTTCG55900.045.4272224
GTTCGCC56300.045.35387826
TTCGCCT57650.045.17085627
TCGCCTC21600.045.05196828
CGTTCGC57400.044.60495425
TTGTACG650.043.732561
TAGCCTA7650.043.732561
AACATTC1333300.043.71781
AACAGTA154300.043.7042161
TATATTA254.6563648E-543.6555713
CGCAAAA800.043.6555713
TATATGA8700.043.6523172
ACCGGTA850.043.6523132
GCGCTAG208.1724965E-443.6523132
TTACACA7100.043.6523132
TTCAAGT859400.043.6460531
GCGATAC208.180103E-443.64406619
ATATTCC208.180303E-443.64385215
GATAAGC2550.043.6438515
TCCTTCA351000.043.6328851