FastQCFastQC Report
Mon 5 Dec 2016
JM100_3_ATCACG_L004_R1_001.fastq

Summary

[OK]Basic Statistics

MeasureValue
FilenameJM100_3_ATCACG_L004_R1_001.fastq
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences13019600
Sequences flagged as poor quality0
Sequence length50
%GC51

[OK]Per base sequence quality

Per base quality graph

[OK]Per tile sequence quality

Per base quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[FAIL]Per base sequence content

Per base sequence content

[FAIL]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[OK]Sequence Length Distribution

Sequence length distribution

[FAIL]Sequence Duplication Levels

Duplication level graph

[FAIL]Overrepresented sequences

SequenceCountPercentagePossible Source
TGGAATTCTCGGGTGCCAAGGAACTCCAGTCACATCACGATCTCGTATGC593210045.56284371255646RNA PCR Primer, Index 1 (100% over 50bp)
ATGACCTATGAATTGACAGCCTGGAATTCTCGGGTGCCAAGGAACTCCAG8839666.7895019816277RNA PCR Primer, Index 1 (100% over 29bp)
ATGACCTATGAATTGACAGCCATGGAATTCTCGGGTGCCAAGGAACTCCA8648986.643045869304741RNA PCR Primer, Index 1 (100% over 28bp)
TAGCTTATCAGACTGGTGTTGGCTGGAATTCTCGGGTGCCAAGGAACTCC1432691.1004101508494883RNA PCR Primer, Index 1 (100% over 27bp)
TGAGATGAAGCACTGTAGCTCTGGAATTCTCGGGTGCCAAGGAACTCCAG1108840.8516697901625242RNA PCR Primer, Index 1 (100% over 29bp)
TGTAACAGCAACTCCATGTGGATGGAATTCTCGGGTGCCAAGGAACTCCA927810.7126255798949276RNA PCR Primer, Index 1 (100% over 28bp)
TGAGATGAAGCACTGTAGCTCTTGGAATTCTCGGGTGCCAAGGAACTCCA721670.5542950628283511RNA PCR Primer, Index 1 (100% over 28bp)
TTGCGGCCCCGGGTTCCTCCCGGGGCTACGCCTGTCTGAGGGTCGCTTGG686980.527650619066638No Hit
GTTCTACAGTCCGACTGGAATTCTCGGGTGCCAAGGAACTCCAGTCACAT671410.515691726320317RNA PCR Primer, Index 1 (100% over 35bp)
GCATTGGTGGTTCAGTGGTAGAATTCTCGCCTTGGAATTCTCGGGTGCCA667080.512365971304802No Hit
AAGCTGCCAGCTGAAGAACTGTTGGAATTCTCGGGTGCCAAGGAACTCCA620020.4762204676026913RNA PCR Primer, Index 1 (100% over 28bp)
CATGGAATTCTCGGGTGCCAAGGAACTCCAGTCACATCACGATCTCGTAT514720.3953424068327752RNA PCR Primer, Index 1 (100% over 48bp)
TTCAAGTAATCCAGGATAGGCTTGGAATTCTCGGGTGCCAAGGAACTCCA472920.3632369658054011RNA PCR Primer, Index 1 (100% over 28bp)
TGAGAACTGAATTCCATAGATGGTGGAATTCTCGGGTGCCAAGGAACTCC434670.3338581830470982RNA PCR Primer, Index 1 (100% over 27bp)
TAACGGAACCCATAATGCAGCTGTGGAATTCTCGGGTGCCAAGGAACTCC420110.3226750437801469RNA PCR Primer, Index 1 (100% over 27bp)
GTTTCCGTAGTGTAGTGGTTATCACGTTCGCCTTGGAATTCTCGGGTGCC406730.3123982303603797No Hit
TATTGCACTTGTCCCGGCCTGTTGGAATTCTCGGGTGCCAAGGAACTCCA405570.3115072659682325RNA PCR Primer, Index 1 (100% over 28bp)
TGGAGTGTGACAATGGTGTTTGTGGAATTCTCGGGTGCCAAGGAACTCCA391650.3008156932624658RNA PCR Primer, Index 1 (100% over 28bp)
TGTAACAGCAACTCCATGTGGAATGGAATTCTCGGGTGCCAAGGAACTCC379250.2912915911395127RNA PCR Primer, Index 1 (100% over 27bp)
AACATTCAACGCTGTCGGTGAGTTGGAATTCTCGGGTGCCAAGGAACTCC372660.2862299917048143RNA PCR Primer, Index 1 (100% over 27bp)
ACCACGTTCCCGTGGTGGAATTCTCGGGTGCCAAGGAACTCCAGTCACAT369010.2834265261605579RNA PCR Primer, Index 1 (100% over 35bp)
TGAGGTAGTAGGTTGTATAGTTTGGAATTCTCGGGTGCCAAGGAACTCCA354110.2719822421579772RNA PCR Primer, Index 1 (100% over 28bp)
CTACAGTCCGACGATCTGGAATTCTCGGGTGCCAAGGAACTCCAGTCACA351580.27003901809579406RNA PCR Primer, Index 1 (100% over 34bp)
TGGAATTCTCGGGTGCCAAGGAACTCCAGTCACATTACGATCTCGTATGC343570.26388675535346706RNA PCR Primer, Index 1 (98% over 50bp)
CCGTCGAGCAGCATTCCGGGCTTCACATCGGAGGGCTCCAGCCGGCCCCG343300.2636793757104673No Hit
GGACAACTCTTAGCGGTGGAATTCTCGGGTGCCAAGGAACTCCAGTCACA317850.24413192417585794RNA PCR Primer, Index 1 (100% over 34bp)
AACATTCAACGCTGTCGGTGAGTGGAATTCTCGGGTGCCAAGGAACTCCA311890.23955421057482565RNA PCR Primer, Index 1 (100% over 28bp)
TGGACAACTCTTAGCGGTGGAATTCTCGGGTGCCAAGGAACTCCAGTCAC307260.23599803373375527RNA PCR Primer, Index 1 (100% over 33bp)
ATGACCTATGAATTGACAGCCATTGGAATTCTCGGGTGCCAAGGAACTCC301700.23172754923346342RNA PCR Primer, Index 1 (100% over 27bp)
AGTTCTACAGTCCGACGATCTGGAATTCTCGGGTGCCAAGGAACTCCAGT292990.22503763556484072RNA PCR Primer, Index 1 (100% over 30bp)
CCTGTCTGAGGGTCGCTTGGAATTCTCGGGTGCCAAGGAACTCCAGTCAC277090.2128252788104089RNA PCR Primer, Index 1 (100% over 33bp)
TGTAAACATCCTTGACTGGAAGCTTGGAATTCTCGGGTGCCAAGGAACTC248980.19123475375587576RNA PCR Primer, Index 1 (100% over 26bp)
TGGAATTCTCGGGTGCCAAGGAACTCCAGTCACATAACGATCTCGTATGC246690.18947586715413683RNA PCR Primer, Index 1 (98% over 50bp)
TCTACAGTCCGACGATCTGGAATTCTCGGGTGCCAAGGAACTCCAGTCAC246220.18911487296076684RNA PCR Primer, Index 1 (100% over 33bp)
ACAGTCCGACGATCTGGAATTCTCGGGTGCCAAGGAACTCCAGTCACATC238840.18344649605210606RNA PCR Primer, Index 1 (100% over 36bp)
CACCACGTTCCCGTGGTGGAATTCTCGGGTGCCAAGGAACTCCAGTCACA238760.18338505023195797RNA PCR Primer, Index 1 (100% over 34bp)
TGGACGTGATGAGCAGGTGTTACCGCCCCAGTCTGATGTTTGGTGACTGA231390.17772435405081569No Hit
TCCCTGGTGGTCTAGTGGTTAGGATTCGGCGCTCTGGAATTCTCGGGTGC228740.17568896125841038No Hit
CAGAGTTCTACAGTCCGACGATCTGGAATTCTCGGGTGCCAAGGAACTCC220000.16897600540723218RNA PCR Primer, Index 1 (100% over 27bp)
ATGACCTATGAATTGACAGCTGGAATTCTCGGGTGCCAAGGAACTCCAGT216040.16593443730990198RNA PCR Primer, Index 1 (100% over 30bp)
ATGACCTATGAATTGACAGCCTTGGAATTCTCGGGTGCCAAGGAACTCCA207980.1597437709299825RNA PCR Primer, Index 1 (100% over 28bp)
TTCTACAGTCCGACGATCTGGAATTCTCGGGTGCCAAGGAACTCCAGTCA207640.15948262619435313RNA PCR Primer, Index 1 (100% over 32bp)
TCAGTAACAAGGATTCATCCTGTTGGAATTCTCGGGTGCCAAGGAACTCC206990.15898337890564995RNA PCR Primer, Index 1 (100% over 27bp)
GCATTGGTGGTTCAGTGGTAGAATTCTCGCCTGCCACGCGGGAGGCCCGG199690.15337644781713725No Hit
TACAGTCCGACGATCTGGAATTCTCGGGTGCCAAGGAACTCCAGTCACAT193060.14828412547236475RNA PCR Primer, Index 1 (100% over 35bp)
GATCCATGATGACATTAAAACATAACGTGACTGTTGGATGAAGCTTGCGG184250.14151740452855696No Hit
TCAGTAACTGGAATCTGTCCCTTGGAATTCTCGGGTGCCAAGGAACTCCA183610.14102583796737228RNA PCR Primer, Index 1 (100% over 28bp)
TGGAATTCTCGGGTGCCAAGGAAATCCAGTCACATCACGATCTCGTATGC182810.1404113797658914RNA PCR Primer, Index 1 (98% over 50bp)
ATGACCTATGAATTGACAGCCAGTGGAATTCTCGGGTGCCAAGGAACTCC182700.1403268917631878RNA PCR Primer, Index 1 (100% over 27bp)
TAACACTGTCTGGTAACGATGTTGGAATTCTCGGGTGCCAAGGAACTCCA181860.13968171065163293RNA PCR Primer, Index 1 (100% over 28bp)
TAGTTCTACAGTCCGACGATCTGGAATTCTCGGGTGCCAAGGAACTCCAG180400.13856032443393038RNA PCR Primer, Index 1 (100% over 29bp)
TGAGGTAGTAGTTTGTATAGTTTGGAATTCTCGGGTGCCAAGGAACTCCA174850.13429752066115702RNA PCR Primer, Index 1 (100% over 28bp)
GCATTGTGGTTCAGTGGTAGAATTCTCGCCTTGGAATTCTCGGGTGCCAA171460.13169375403238195No Hit
TAGCTTATCAGACTGGTGTTGGTGGAATTCTCGGGTGCCAAGGAACTCCA170910.13127131401886388RNA PCR Primer, Index 1 (100% over 28bp)
TGTAAACATCCTACACTCTCAGCTTGGAATTCTCGGGTGCCAAGGAACTC170700.13111001874097514RNA PCR Primer, Index 1 (100% over 26bp)
TGAATTCTCGGGTGCCAAGGAACTCCAGTCACATCACGATCTCGTATGCC159730.12268426065316906RNA PCR Primer, Index 1 (98% over 50bp)
TGGAATTCTCGGGTGCCAAGGAACTCCAGTCACGTTTCGATCTCGTATGC159710.12266889919813205RNA PCR Primer, Index 21 (100% over 50bp)
AGAGTTCTACAGTCCGACGATCTGGAATTCTCGGGTGCCAAGGAACTCCA156300.12004977111431994RNA PCR Primer, Index 1 (100% over 28bp)
TTCACAGTGGTTAAGTTCTGCCTGGAATTCTCGGGTGCCAAGGAACTCCA156100.11989615656394974RNA PCR Primer, Index 1 (100% over 28bp)
TGAGATGAAGCACTGTAGCTTGGAATTCTCGGGTGCCAAGGAACTCCAGT152860.1174076008479523RNA PCR Primer, Index 1 (100% over 30bp)
TCAGTAACTGGAATCTGTCCCTGTGGAATTCTCGGGTGCCAAGGAACTCC152780.11734615502780422RNA PCR Primer, Index 1 (100% over 27bp)
GTTCTACAGTCCGACGTGGAATTCTCGGGTGCCAAGGAACTCCAGTCACA151420.1163015760852868RNA PCR Primer, Index 1 (100% over 34bp)
TTCAAGTAATCCAGGATAGGTTTGGAATTCTCGGGTGCCAAGGAACTCCA147620.11338289962825279RNA PCR Primer, Index 1 (100% over 28bp)
AGAGATGATGACTTCTGTTACCGCCCCAGTCTGAGAAGTCATGACTGATC146680.1126609112415128No Hit
CTGGACAACTCTTAGCGGTGGAATTCTCGGGTGCCAAGGAACTCCAGTCA140370.10781437217733264RNA PCR Primer, Index 1 (100% over 32bp)
TCAGTAACAAGGATTCATCCTGTGGAATTCTCGGGTGCCAAGGAACTCCA135760.10427355679129928RNA PCR Primer, Index 1 (100% over 28bp)
TTCACAGTGGTTAAGTTCTGTGGAATTCTCGGGTGCCAAGGAACTCCAGT134510.10331346585148546RNA PCR Primer, Index 1 (100% over 30bp)
TCCCTGGTGGTCTAGTGGTTAGGATTCGGCGCTTGGAATTCTCGGGTGCC133680.10267596546744907No Hit
TGGAGTGTGACAATGGTGTTTGTTGGAATTCTCGGGTGCCAAGGAACTCC132280.10160066361485759RNA PCR Primer, Index 1 (100% over 27bp)
TGGAGTGTGACAATGGTGTTTTGGAATTCTCGGGTGCCAAGGAACTCCAG132030.10140864542689484RNA PCR Primer, Index 1 (100% over 29bp)

[FAIL]Adapter Content

Adapter graph

[FAIL]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
GCAGTAA302.5125519E-644.0436171
GCTAGTT551.8189894E-1244.0436171
TTAACCG408.250936E-944.0436171
AGGGGGC207.821225E-444.0436171
TTTCTAT302.5125519E-644.0436171
TATGGCG254.4331155E-544.02060344
GGTATGC302.521605E-644.02060344
CGTACGC650.044.020644
TATATCG207.849253E-444.0116439
CGTTACG6450.043.99845533
GTTACGA6500.043.9984534
TCAATAT1000.043.9984535
ATTTCGA10300.043.9984534
TAAAGAC408.3273335E-943.9976132
CTAGTCG302.5309546E-643.9969332
TGACATA1450.043.996932
GATATGT800.043.996932
GTTTGGC207.8626274E-443.99642623
TTACTTC700.043.99642621
ATCAACC254.447515E-543.99642628