FastQCFastQC Report
Mon 5 Dec 2016
JM100_5_ATGAGC_L001_R1_001.fastq

Summary

[OK]Basic Statistics

MeasureValue
FilenameJM100_5_ATGAGC_L001_R1_001.fastq
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences9577170
Sequences flagged as poor quality0
Sequence length50
%GC52

[OK]Per base sequence quality

Per base quality graph

[FAIL]Per tile sequence quality

Per base quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[FAIL]Per base sequence content

Per base sequence content

[WARN]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[OK]Sequence Length Distribution

Sequence length distribution

[FAIL]Sequence Duplication Levels

Duplication level graph

[FAIL]Overrepresented sequences

SequenceCountPercentagePossible Source
AACATTCAACGCTGTCGGTGAGTGGAATTCTCGGGTGCCAAGGAACTCCA4850735.06488868841213RNA PCR Primer, Index 1 (100% over 28bp)
AACATTCAACGCTGTCGGTGAGTTGGAATTCTCGGGTGCCAAGGAACTCC4745234.954730886055066RNA PCR Primer, Index 1 (100% over 27bp)
TAGCTTATCAGACTGGTGTTGGCTGGAATTCTCGGGTGCCAAGGAACTCC2462232.570936926043915RNA PCR Primer, Index 1 (100% over 27bp)
TTCAAGTAATCCAGGATAGGCTTGGAATTCTCGGGTGCCAAGGAACTCCA2315392.4176139715594482RNA PCR Primer, Index 1 (100% over 28bp)
TACCCTGTAGAACCGAATTTGTTGGAATTCTCGGGTGCCAAGGAACTCCA1696701.771608940845782RNA PCR Primer, Index 1 (100% over 28bp)
TCCTTCATTCCACCGGAGTCTGTGGAATTCTCGGGTGCCAAGGAACTCCA1608391.6794000732993148RNA PCR Primer, Index 1 (100% over 28bp)
CCTGTCTGAGGGTCGCTTGGAATTCTCGGGTGCCAAGGAACTCCAGTCAC1126401.1761303182464131RNA PCR Primer, Index 1 (100% over 33bp)
AAGCTGCCAGCTGAAGAACTGTTGGAATTCTCGGGTGCCAAGGAACTCCA1107821.1567300152341455RNA PCR Primer, Index 1 (100% over 28bp)
TATTGCACTTGTCCCGGCCTGTTGGAATTCTCGGGTGCCAAGGAACTCCA938010.9794229401796146RNA PCR Primer, Index 1 (100% over 28bp)
AACATTCAACGCTGTCGGTGATGGAATTCTCGGGTGCCAAGGAACTCCAG756490.7898888711383426RNA PCR Primer, Index 1 (100% over 29bp)
TACCCTGTAGAACCGAATTTGCGTGGAATTCTCGGGTGCCAAGGAACTCC643120.6715136099703775RNA PCR Primer, Index 1 (100% over 27bp)
AACAGTAAGAGTTTATGTGCTGTGGAATTCTCGGGTGCCAAGGAACTCCA595450.6217389897015506RNA PCR Primer, Index 1 (100% over 28bp)
TGAGGTAGTAGGTTGTATAGTTTGGAATTCTCGGGTGCCAAGGAACTCCA589000.6150042235858818RNA PCR Primer, Index 1 (100% over 28bp)
CCTTTCTGAGGGTCGCTTGGAATTCTCGGGTGCCAAGGAACTCCAGTCAC532340.5558426967465337RNA PCR Primer, Index 1 (100% over 33bp)
ACAGTAGTCTGCACATTGGTTTGGAATTCTCGGGTGCCAAGGAACTCCAG517150.5399820615066873RNA PCR Primer, Index 1 (100% over 29bp)
TAACGGAACCCATAATGCAGCTGTGGAATTCTCGGGTGCCAAGGAACTCC513980.5366721066870485RNA PCR Primer, Index 1 (100% over 27bp)
GCATCGATGGTTCAGTGGTAGAATGCTCGCCTTGGAATTCTCGGGTGCCA507820.5302401440091384No Hit
CTACGCCTGTCTGAGGGTCGCTTGGAATTCTCGGGTGCCAAGGAACTCCA484400.5057861560356557RNA PCR Primer, Index 1 (100% over 28bp)
CTGTCTGAGGGTCGCTTGGAATTCTCGGGTGCCAAGGAACTCCAGTCACA472740.493611369538183RNA PCR Primer, Index 1 (100% over 34bp)
TACCCTGTAGAACCGAATTTGCTGGAATTCTCGGGTGCCAAGGAACTCCA450170.47004490888226896RNA PCR Primer, Index 1 (100% over 28bp)
GCATCGATGGTTCAGTGGTAGAATGCTCTGGAATTCTCGGGTGCCAAGGA432130.45120844675410376RNA PCR Primer, Index 1 (100% over 22bp)
TCCTTCATTCCACCGGAGTCTGTTGGAATTCTCGGGTGCCAAGGAACTCC426880.445726660380885RNA PCR Primer, Index 1 (100% over 27bp)
TTGGTCCCCTTCAACCAGCTGTTGGAATTCTCGGGTGCCAAGGAACTCCA415870.4342305712439061RNA PCR Primer, Index 1 (100% over 28bp)
TTTGGTCCCCTTCAACCAGCTGTTGGAATTCTCGGGTGCCAAGGAACTCC388460.40561042562677707RNA PCR Primer, Index 1 (100% over 27bp)
TGGAATTCTCGGGTGCCAAGGAACTCCAGTCACATGAGCATCTCGTATGC384750.4017366299230357RNA PCR Primer, Index 26 (100% over 50bp)
TTCACAGTGGTTAAGTTCTGTGGAATTCTCGGGTGCCAAGGAACTCCAGT384440.4014129434895695RNA PCR Primer, Index 1 (100% over 30bp)
ATGACCTATGAATTGACAGCCTGGAATTCTCGGGTGCCAAGGAACTCCAG357860.3736594421943017RNA PCR Primer, Index 1 (100% over 29bp)
TTCCCTTTGTCATCCTATGCCTTGGAATTCTCGGGTGCCAAGGAACTCCA335380.35018695501907143RNA PCR Primer, Index 1 (100% over 28bp)
GCATTGGTGGTTCAGTGGTAGAATTCTCGCCTTGGAATTCTCGGGTGCCA331650.3462922763196226No Hit
TTCACAGTGGCTAAGTTCTGTGGAATTCTCGGGTGCCAAGGAACTCCAGT319890.3340130748436124RNA PCR Primer, Index 1 (100% over 30bp)
ACCCTGTAGAACCGAATTTGCGTGGAATTCTCGGGTGCCAAGGAACTCCA319690.3338042448865375RNA PCR Primer, Index 1 (100% over 28bp)
AACATTCATTGCTGTCGGTGGGTTGGAATTCTCGGGTGCCAAGGAACTCC310030.32371775795981483RNA PCR Primer, Index 1 (100% over 27bp)
TTCACAGTGGCTAAGTTCTGCTGGAATTCTCGGGTGCCAAGGAACTCCAG303760.31717093880551356RNA PCR Primer, Index 1 (100% over 29bp)
AACATTCATTGCTGTCGGTGGGTGGAATTCTCGGGTGCCAAGGAACTCCA296770.3098723318057422RNA PCR Primer, Index 1 (100% over 28bp)
TGTCTGAGGGTCGCTTGGAATTCTCGGGTGCCAAGGAACTCCAGTCACAT293180.3061238340762459RNA PCR Primer, Index 1 (100% over 35bp)
GTTTCCGTAGTGTAGTGGTTATCACGTTCGCCTTGGAATTCTCGGGTGCC293030.30596721160843965No Hit
TTCAAGTAATCCAGGATAGGTTTGGAATTCTCGGGTGCCAAGGAACTCCA273450.2855227588107969RNA PCR Primer, Index 1 (100% over 28bp)
TACAGTAGTCTGCACATTGGTTTGGAATTCTCGGGTGCCAAGGAACTCCA259890.27136408772111176RNA PCR Primer, Index 1 (100% over 28bp)
ATGACCTATGAATTGACAGCCATGGAATTCTCGGGTGCCAAGGAACTCCA254970.2662268707770667RNA PCR Primer, Index 1 (100% over 28bp)
CCACGTTCCCGTGGTGGAATTCTCGGGTGCCAAGGAACTCCAGTCACATG237670.248163079490079RNA PCR Primer, Index 15 (100% over 36bp)
AAGCTGCCAGCTGAAGAACTGCTGGAATTCTCGGGTGCCAAGGAACTCCA233190.24348528845159895RNA PCR Primer, Index 1 (100% over 28bp)
ACATTAGTCTGCACATTGGTTTGGAATTCTCGGGTGCCAAGGAACTCCAG228230.23830630551613888RNA PCR Primer, Index 1 (100% over 29bp)
AAGCTGCCAGCTGAAGAACTTGGAATTCTCGGGTGCCAAGGAACTCCAGT218670.2283242335679538RNA PCR Primer, Index 1 (100% over 30bp)
CACCACGTTCCCGTGGTGGAATTCTCGGGTGCCAAGGAACTCCAGTCACA211930.22128666401452624RNA PCR Primer, Index 1 (100% over 34bp)
TATGTGCCCTTGGACTACATCGTGGAATTCTCGGGTGCCAAGGAACTCCA211190.2205139931733487RNA PCR Primer, Index 1 (100% over 28bp)
TTAGGTAGTAGGTTGTATAGTTTGGAATTCTCGGGTGCCAAGGAACTCCA210550.2198457373107087RNA PCR Primer, Index 1 (100% over 28bp)
CCTGTCTGAGGGTCGCTTTGGAATTCTCGGGTGCCAAGGAACTCCAGTCA208660.21787229421634993RNA PCR Primer, Index 1 (100% over 32bp)
TTCACAGTGGTTAAGTTCTGCCTGGAATTCTCGGGTGCCAAGGAACTCCA197230.20593766216951354RNA PCR Primer, Index 1 (100% over 28bp)
TTCACAGTGGCTAAGTTCAGTTGGAATTCTCGGGTGCCAAGGAACTCCAG191450.199902476410046RNA PCR Primer, Index 1 (100% over 29bp)
ACAGTAGTCTGCACATTGGTTATGGAATTCTCGGGTGCCAAGGAACTCCA188480.19680135154748218RNA PCR Primer, Index 1 (100% over 28bp)
TGAGGTAGTAGTTTGTATAGTTTGGAATTCTCGGGTGCCAAGGAACTCCA187550.19583029224708343RNA PCR Primer, Index 1 (100% over 28bp)
GTTTCCGTAGTGTAGTGGTTATCACGTCTGCCTTGGAATTCTCGGGTGCC186560.19479658395956218No Hit
TTGTTCCCCTTCAACCAGCTGTTGGAATTCTCGGGTGCCAAGGAACTCCA184620.19277093337593465RNA PCR Primer, Index 1 (100% over 28bp)
GCATTGGTGGTTCAGTGGTAGAATTCTCGCCTGGAATTCTCGGGTGCCAA181850.18987863847044587No Hit
TGATGTAGTAGGTTGTATAGTTTGGAATTCTCGGGTGCCAAGGAACTCCA180760.1887405152043871RNA PCR Primer, Index 1 (100% over 28bp)
TACCATGTAGAACCGAATTTGTTGGAATTCTCGGGTGCCAAGGAACTCCA179840.1877798974018421RNA PCR Primer, Index 1 (100% over 28bp)
TTGAATTCTCGGGTGCCAAGGAACTCCAGTCACATGAGCATCTCGTATGC176660.18445950108434955RNA PCR Primer, Index 26 (98% over 50bp)
GCATCGATGGTTCAGTGGTAGAATGCTCGCCTGGAATTCTCGGGTGCCAA172950.18058570538060825No Hit
GCATCGATGGTTCAGTGGTAGAATGCTGGAATTCTCGGGTGCCAAGGAAC168300.17573040887861446RNA PCR Primer, Index 1 (100% over 24bp)
TTCAGTCATTGTTTCTGGTTGTTGGAATTCTCGGGTGCCAAGGAACTCCA168010.1754276054408557RNA PCR Primer, Index 1 (100% over 28bp)
GTTTCCGTAGTGTAGTGGTTATCACGTTCGCCTCTGGAATTCTCGGGTGC163410.17062451642813065No Hit
TAGCTTATCAGACTGGTGTTGGTGGAATTCTCGGGTGCCAAGGAACTCCA160790.16788884399044812RNA PCR Primer, Index 1 (100% over 28bp)
TTTTTGTTGGAATTCTCGGGTGCCAAGGAACTCCAGTCACATGAGCATCT159420.16645835878448434RNA PCR Primer, Index 26 (100% over 43bp)
CATTGCACTTGTCTCGGTCTGATGGAATTCTCGGGTGCCAAGGAACTCCA156920.16384798432104683RNA PCR Primer, Index 1 (100% over 28bp)
ACCCTGTAGAACCGAATTTGTGTGGAATTCTCGGGTGCCAAGGAACTCCA154850.16168659426532056RNA PCR Primer, Index 1 (100% over 28bp)
GCCCGGCTAGCTCAGTCGGTAGAGCATGAGACTCTGGAATTCTCGGGTGC150340.15697747873327925No Hit
TGTAAACATCCTTGACTGGAAGCTTGGAATTCTCGGGTGCCAAGGAACTC145080.15148525086220668RNA PCR Primer, Index 1 (100% over 26bp)
TTTTGTCCCCTTCAACCAGCTGTTGGAATTCTCGGGTGCCAAGGAACTCC143800.15014873913692667RNA PCR Primer, Index 1 (100% over 27bp)
TTTCTGAGGGTCGCTTGGAATTCTCGGGTGCCAAGGAACTCCAGTCACAT142860.14916723833867415RNA PCR Primer, Index 1 (100% over 35bp)
TACCCTGTAGATCCGGATTTGTTGGAATTCTCGGGTGCCAAGGAACTCCA141050.14727732722714537RNA PCR Primer, Index 1 (100% over 28bp)
AACATTCATTGCTGTCGGTGGGTTTGGAATTCTCGGGTGCCAAGGAACTC140280.14647333189240663RNA PCR Primer, Index 1 (100% over 26bp)
GTTTCCGTAGTGTAGTGGTTATCACGTCTGCCTGTGGAATTCTCGGGTGC138450.14456253778517036No Hit
AACATTCAACGCTGTCGGTGAGTTTGGAATTCTCGGGTGCCAAGGAACTC137560.1436332444761866RNA PCR Primer, Index 1 (100% over 26bp)
TTCACAGTGGTTAAGTTCTGCTGGAATTCTCGGGTGCCAAGGAACTCCAG137130.14318426006847534RNA PCR Primer, Index 1 (100% over 29bp)
TCCTTCATTCCACCGGAGTCTTGGAATTCTCGGGTGCCAAGGAACTCCAG127390.1330142411589227RNA PCR Primer, Index 1 (100% over 29bp)
ACCACGTTCCCGTGGTGGAATTCTCGGGTGCCAAGGAACTCCAGTCACAT126770.1323668682919902RNA PCR Primer, Index 1 (100% over 35bp)
TTCAAGTAATCCAGGATAGGCTGGAATTCTCGGGTGCCAAGGAACTCCAG124770.13027856872124022RNA PCR Primer, Index 1 (100% over 29bp)
AACACTCAACGCTGTCGGTGAGTGGAATTCTCGGGTGCCAAGGAACTCCA124410.1299026747985052RNA PCR Primer, Index 1 (100% over 28bp)
TCCCTGAGACCCTTAACCTGTGATGGAATTCTCGGGTGCCAAGGAACTCC123670.12913000395732768RNA PCR Primer, Index 1 (100% over 27bp)
TTATGTAGTAGGTTGTATAGTTTGGAATTCTCGGGTGCCAAGGAACTCCA121990.12737583231789767RNA PCR Primer, Index 1 (100% over 28bp)
AACACTCAACGCTGTCGGTGAGTTGGAATTCTCGGGTGCCAAGGAACTCC121720.12709391187584643RNA PCR Primer, Index 1 (100% over 27bp)
TTTGTTGGAATTCTCGGGTGCCAAGGAACTCCAGTCACATGAGCATCTCG119630.12491163882441265RNA PCR Primer, Index 26 (100% over 45bp)
TACCCTGTAGAACCGAATGTGTTGGAATTCTCGGGTGCCAAGGAACTCCA117320.12249965282019636RNA PCR Primer, Index 1 (100% over 28bp)
TACCCTGTAGAACCGAATTTGTGTGGAATTCTCGGGTGCCAAGGAACTCC112370.11733111138259006RNA PCR Primer, Index 1 (100% over 27bp)
TGAGATGAAGCACTGTAGCTCTGGAATTCTCGGGTGCCAAGGAACTCCAG109470.11430307700500253RNA PCR Primer, Index 1 (100% over 29bp)
AACCCGTAGATCCGAACTTGTGTGGAATTCTCGGGTGCCAAGGAACTCCA104560.10917630155881121RNA PCR Primer, Index 1 (100% over 28bp)
CATTATTACTTTTGGTACGCGTGGAATTCTCGGGTGCCAAGGAACTCCAG102530.10705667749449994RNA PCR Primer, Index 1 (100% over 29bp)
CCCAGTGTTCAGACTACCTGTTCTGGAATTCTCGGGTGCCAAGGAACTCC102110.10661813458464245RNA PCR Primer, Index 1 (100% over 27bp)
AGCTACATCTGGCTACTGGGTCTCTGGAATTCTCGGGTGCCAAGGAACTC101670.10615870867907744RNA PCR Primer, Index 1 (100% over 26bp)
CTACGCCTGTCTGAGGGTCGCTTTGGAATTCTCGGGTGCCAAGGAACTCC101380.10585590524131867RNA PCR Primer, Index 1 (100% over 27bp)
GCATTGGTGGTTCAGTGGTAGAATTCTCGCCTGCTGGAATTCTCGGGTGC99010.10338127024997991No Hit
ACCACAGGGTAGAACCACGGACTGGAATTCTCGGGTGCCAAGGAACTCCA97910.10223270548606739RNA PCR Primer, Index 1 (100% over 28bp)
GTTTCCGTAGTGTAGTGGTTATCACGTTCGCCTGGAATTCTCGGGTGCCA97740.10205520002255362No Hit
CCTTTCTGAGGGTCGCTTTGGAATTCTCGGGTGCCAAGGAACTCCAGTCA97700.10201343403113863RNA PCR Primer, Index 1 (100% over 32bp)
TCCCTGAGACCCTTAACCTGTGTGGAATTCTCGGGTGCCAAGGAACTCCA97570.10187769455903989RNA PCR Primer, Index 1 (100% over 28bp)
TACCCTGTAGATCCGGATTTGTGTGGAATTCTCGGGTGCCAAGGAACTCC96600.10086486926722611RNA PCR Primer, Index 1 (100% over 27bp)
TGGACGGAGAACTGATAAGGGCTGGAATTCTCGGGTGCCAAGGAACTCCA96510.10077089578654236RNA PCR Primer, Index 1 (100% over 28bp)
TTCAAGTAATCCAGGATGGGCTTGGAATTCTCGGGTGCCAAGGAACTCCA95800.10002954943892611RNA PCR Primer, Index 1 (100% over 28bp)

[WARN]Adapter Content

Adapter graph

[FAIL]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
TGCTCGC117050.043.9619224
TACGCAT207.933182E-443.9165616
AATACGC207.933182E-443.9165615
TATGCGC1450.043.9149551
ATACTAG207.934612E-443.9149551
GCGTAGG254.4963494E-543.9149551
AACATTC1339550.043.888731
TTTCGCA207.963863E-443.8821532
CCAGATA302.577619E-643.880093
CGCAGTA207.965706E-443.880093
ACTATAA207.965911E-443.879865
CGTATAA351.4790203E-743.8798564
CTACGCA700.043.86107310
TAGCTTA302600.043.8278851
AGCTTAT308900.043.825332
TCCTTCA256250.043.8206941
TTCAACG1267100.043.7967455
TCGGTGA1287150.043.7954415
GCTTATC310400.043.795273
TCAACGC1334750.043.7943846