FastQCFastQC Report
Mon 5 Dec 2016
JM101_1_ATCACG_L001_R1_001.fastq

Summary

[OK]Basic Statistics

MeasureValue
FilenameJM101_1_ATCACG_L001_R1_001.fastq
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences2126388
Sequences flagged as poor quality0
Sequence length50
%GC52

[OK]Per base sequence quality

Per base quality graph

[FAIL]Per tile sequence quality

Per base quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[FAIL]Per base sequence content

Per base sequence content

[FAIL]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[OK]Sequence Length Distribution

Sequence length distribution

[FAIL]Sequence Duplication Levels

Duplication level graph

[FAIL]Overrepresented sequences

SequenceCountPercentagePossible Source
AACATTCAACGCTGTCGGTGAGTGGAATTCTCGGGTGCCAAGGAACTCCA1918189.020837213152069RNA PCR Primer, Index 1 (100% over 28bp)
AACATTCAACGCTGTCGGTGAGTTGGAATTCTCGGGTGCCAAGGAACTCC1104205.192843450960032RNA PCR Primer, Index 1 (100% over 27bp)
TGGAATTCTCGGGTGCCAAGGAACTCCAGTCACATCACGATCTCGTATGC501612.358976818906051RNA PCR Primer, Index 1 (100% over 50bp)
TTCAAGTAATCCAGGATAGGCTTGGAATTCTCGGGTGCCAAGGAACTCCA490352.3060231716883277RNA PCR Primer, Index 1 (100% over 28bp)
AACCCGTAGATCCGAACTTGTGTGGAATTCTCGGGTGCCAAGGAACTCCA412681.940755873340143RNA PCR Primer, Index 1 (100% over 28bp)
TCACAGTGAACCGGTCTCTTTTGGAATTCTCGGGTGCCAAGGAACTCCAG322721.5176910328688837RNA PCR Primer, Index 1 (100% over 29bp)
TGAGGTAGTAGGTTGTATAGTTTGGAATTCTCGGGTGCCAAGGAACTCCA291121.3690822182969429RNA PCR Primer, Index 1 (100% over 28bp)
TAAAGCTAGAGAACCGAAAGTATGGAATTCTCGGGTGCCAAGGAACTCCA264311.2429998664401793RNA PCR Primer, Index 1 (100% over 28bp)
TCCCTGAGACCCTTAACCTGTTGGAATTCTCGGGTGCCAAGGAACTCCAG221191.0402146738977083RNA PCR Primer, Index 1 (100% over 29bp)
AACATTCAACGCTGTCGGTGATGGAATTCTCGGGTGCCAAGGAACTCCAG220761.0381924653449888RNA PCR Primer, Index 1 (100% over 29bp)
TGGAATTCTCGGGTGCCAAGGAACTCCAGTCACATCACGATCTCGTCTGC216071.0161362836885837RNA PCR Primer, Index 1 (98% over 50bp)
TATTGCACTCGTCCCGGCCTCCTGGAATTCTCGGGTGCCAAGGAACTCCA214511.008799899171741RNA PCR Primer, Index 1 (100% over 28bp)
AACATTCAACGATGTCGGTGAGTGGAATTCTCGGGTGCCAAGGAACTCCA187790.8831408002678721RNA PCR Primer, Index 1 (100% over 28bp)
TCCCTGAGACCCTTAACCTGTGTGGAATTCTCGGGTGCCAAGGAACTCCA172110.809400730252428RNA PCR Primer, Index 1 (100% over 28bp)
TAAAGCTAGAGAACCGAAAGTTGGAATTCTCGGGTGCCAAGGAACTCCAG150430.7074437967106662RNA PCR Primer, Index 1 (100% over 29bp)
TGGAATTCTCGGGTGCCAAGGCACTCCAGTCACATCACGATCTCGTATGC148790.699731187346806RNA PCR Primer, Index 1 (98% over 50bp)
AACATTCATTGCTGTCGGTGGGTGGAATTCTCGGGTGCCAAGGAACTCCA136320.641087139317942RNA PCR Primer, Index 1 (100% over 28bp)
TCCCTGAGACCCTTAACCTGTGATGGAATTCTCGGGTGCCAAGGAACTCC135710.638218424859433RNA PCR Primer, Index 1 (100% over 27bp)
TAGCTTATCAGACTGGTGTTGGCTGGAATTCTCGGGTGCCAAGGAACTCC118570.5576122513859183RNA PCR Primer, Index 1 (100% over 27bp)
TTAAAGGGAATTTGCGACTGTTTGGAATTCTCGGGTGCCAAGGAACTCCA116790.5492412485397774RNA PCR Primer, Index 1 (100% over 28bp)
TTGCGGCCCCGGGTTCCTCCCGGGGCTACGCCTGTCTGAGGGTCGCTTGG116340.5471249837753035No Hit
TAAAGCTAGAGAACCGAAAGTCTGGAATTCTCGGGTGCCAAGGAACTCCA106790.5022131426625809RNA PCR Primer, Index 1 (100% over 28bp)
CCACGTTCCCGTGGTGGAATTCTCGGGTGCCAAGGAACTCCAGTCACATC102740.48316675978231627RNA PCR Primer, Index 1 (100% over 36bp)
TATTGCACTTGTCCCGGCCTGTTGGAATTCTCGGGTGCCAAGGAACTCCA101340.4765828249595088RNA PCR Primer, Index 1 (100% over 28bp)
AGCTACATCTGGCTACTGGGTCTCTGGAATTCTCGGGTGCCAAGGAACTC99480.4678355972663502RNA PCR Primer, Index 1 (100% over 26bp)
AACATTCAACGATGTCGGTGAGTTGGAATTCTCGGGTGCCAAGGAACTCC98610.46374415205503416RNA PCR Primer, Index 1 (100% over 27bp)
TGAGGTAGTAGTTTGTATAGTTTGGAATTCTCGGGTGCCAAGGAACTCCA95150.4474724274215242RNA PCR Primer, Index 1 (100% over 28bp)
TACCCTGTAGAACCGAATTTGTTGGAATTCTCGGGTGCCAAGGAACTCCA93180.4382078905637165RNA PCR Primer, Index 1 (100% over 28bp)
TGGAATTCTCGGGTGCCAAGGCACTCCAGTCACATCACGATCTCGTCTGC92140.43331696755248805RNA PCR Primer, Index 1 (97% over 46bp)
TGAGGTAGTAGTTTGTGCTGTTTGGAATTCTCGGGTGCCAAGGAACTCCA91490.43026014067047036RNA PCR Primer, Index 1 (100% over 28bp)
TGGAATTCTCGGGTGCCAAGGAACTCCATTCACATCACGATCTCGTATGC85440.4018081366147665RNA PCR Primer, Index 1 (98% over 50bp)
AACCCGTAGATCCGAACTTGTTGGAATTCTCGGGTGCCAAGGAACTCCAG85130.4003502653325734RNA PCR Primer, Index 1 (100% over 29bp)
AACATTCATTGCTGTCGGTGGGTTGGAATTCTCGGGTGCCAAGGAACTCC84330.39658801686239764RNA PCR Primer, Index 1 (100% over 27bp)
TTCAAGTAATCAAGGATAGGCTTGGAATTCTCGGGTGCCAAGGAACTCCA79580.37424966657072933RNA PCR Primer, Index 1 (100% over 28bp)
ACCTTGGCTTTAGACTGCTTACTTGGAATTCTCGGGTGCCAAGGAACTCC78240.367947900383185RNA PCR Primer, Index 1 (100% over 27bp)
CCCTGAGACCCTTAACCTGTGATGGAATTCTCGGGTGCCAAGGAACTCCA73180.3441516788093236RNA PCR Primer, Index 1 (100% over 28bp)
AAGCTGCCAGCTGAAGAACTGTTGGAATTCTCGGGTGCCAAGGAACTCCA72270.3398721211744987RNA PCR Primer, Index 1 (100% over 28bp)
TACCCTGTAGATCCGGATTTGTTGGAATTCTCGGGTGCCAAGGAACTCCA69050.32472907108204146RNA PCR Primer, Index 1 (100% over 28bp)
AGCTGGTGTTGTGAATCAGGCCGTGGAATTCTCGGGTGCCAAGGAACTCC67720.3184743330003743RNA PCR Primer, Index 1 (100% over 27bp)
TCTTTGGTTATCTAGCTGTATGATGGAATTCTCGGGTGCCAAGGAACTCC67700.31838027678861996RNA PCR Primer, Index 1 (100% over 27bp)
CCTGTCTGAGGGTCGCTTGGAATTCTCGGGTGCCAAGGAACTCCAGTCAC63970.30083879329642566RNA PCR Primer, Index 1 (100% over 33bp)
TGGAATTCTCGGGTGCCAAGGAACTCCATTCACATCACGATCTCGTCTGC59460.2796291175458101RNA PCR Primer, Index 1 (97% over 46bp)
TGAGATGAAGCACTGTAGCTCTGGAATTCTCGGGTGCCAAGGAACTCCAG58850.2767604030873011RNA PCR Primer, Index 1 (100% over 29bp)
ACCATCGACCGTTGACTGTGCCTGGAATTCTCGGGTGCCAAGGAACTCCA58780.2764312063461607RNA PCR Primer, Index 1 (100% over 28bp)
TGAGGTAGTTGGTTGTATAGTTTGGAATTCTCGGGTGCCAAGGAACTCCA57890.27224570492309025RNA PCR Primer, Index 1 (100% over 28bp)
AACCCGTAGATACGAACTTGTGTGGAATTCTCGGGTGCCAAGGAACTCCA55240.2597832568656332RNA PCR Primer, Index 1 (100% over 28bp)
TAAAGGGAATTTGCGACTGTTTGGAATTCTCGGGTGCCAAGGAACTCCAG54340.2555507273366855RNA PCR Primer, Index 1 (100% over 29bp)
TCTTTGGTTATCTAGCTGTCTGATGGAATTCTCGGGTGCCAAGGAACTCC51870.243934785185018RNA PCR Primer, Index 1 (100% over 27bp)
TTCCCTTTGTCATCCTATGCCTGTGGAATTCTCGGGTGCCAAGGAACTCC51410.24177149231466694RNA PCR Primer, Index 1 (100% over 27bp)
TACCCTGTAGAACCGAATTTGCGTGGAATTCTCGGGTGCCAAGGAACTCC51120.24040767724422824RNA PCR Primer, Index 1 (100% over 27bp)
TCCCTGAGACCCTAACTTGTGATGGAATTCTCGGGTGCCAAGGAACTCCA51110.24036064913835103RNA PCR Primer, Index 1 (100% over 28bp)
TTCACAGTGGCTAAGTTCTGCTGGAATTCTCGGGTGCCAAGGAACTCCAG50740.23862060922089476RNA PCR Primer, Index 1 (100% over 29bp)
AGCTACATCTGGCTACTGGGTCTCTGGAATTCTCGGGTGCCAAGGACCTC46490.21863366422308628RNA PCR Primer, Index 1 (96% over 26bp)
TCACAGTGAACCGGTCTCTTTTTGGAATTCTCGGGTGCCAAGGAACTCCA46460.21849257990545468RNA PCR Primer, Index 1 (100% over 28bp)
TCACAGTGAACAGGTCTCTTTTGGAATTCTCGGGTGCCAAGGAACTCCAG45930.21600009029396328RNA PCR Primer, Index 1 (100% over 29bp)
AAGGTCCAACCTCACATGTCCTTGGAATTCTCGGGTGCCAAGGAACTCCA45530.21411896605887543RNA PCR Primer, Index 1 (100% over 28bp)
TCTTTGGTTATCTAGCTGTATTGGAATTCTCGGGTGCCAAGGAACTCCAG45170.21242595424729635RNA PCR Primer, Index 1 (100% over 29bp)
TCTTTGGTTATCTAGCTGTATGTGGAATTCTCGGGTGCCAAGGAACTCCA41570.19549583613150562RNA PCR Primer, Index 1 (100% over 28bp)
TGGAATTCTCGGGTGCCAAGGCACTCCATTCACATCACGATCTCGTATGC41440.19488447075510207RNA PCR Primer, Index 1 (96% over 28bp)
TACCCTGTAGAACCGAATGTGTTGGAATTCTCGGGTGCCAAGGAACTCCA39620.18632535548545232RNA PCR Primer, Index 1 (100% over 28bp)
TGGAATTCTCGGGTGCCAAGGAACTCCAGTCACATCACTATCTCGTCTGC38750.18223391027413624RNA PCR Primer, Index 1 (97% over 46bp)
TTGCATAGTCACAAAAGTGATCTGGAATTCTCGGGTGCCAAGGAACTCCA38110.17922411149799566RNA PCR Primer, Index 1 (100% over 28bp)
CCTGTCTGAGGGTCGCTTGGAATTCTCGGGTGCCCAGGAACTCCAGTCAC37030.17414507606325846RNA PCR Primer, Index 1 (96% over 33bp)
TATGGCTTTTTATTCCTATCTGTGGAATTCTCGGGTGCCAAGGAACTCCA36610.17216989561641619RNA PCR Primer, Index 1 (100% over 28bp)
TACCCTGTAGATCCGGATTTGTGTGGAATTCTCGGGTGCCAAGGAACTCC36200.17024174327545114RNA PCR Primer, Index 1 (100% over 27bp)
TCCCTGAGACCCTAACTTGTGTGGAATTCTCGGGTGCCAAGGAACTCCAG35680.1677962817698369RNA PCR Primer, Index 1 (100% over 29bp)
TAACAGTCTACAGTCATGGCTTGGAATTCTCGGGTGCCAAGGAACTCCAG34100.16036584104123988RNA PCR Primer, Index 1 (100% over 29bp)
TACCCTGTAGAACCGAATTTGCTGGAATTCTCGGGTGCCAAGGAACTCCA34080.1602717848294855RNA PCR Primer, Index 1 (100% over 28bp)
TGGAATTCTCGGGTGCCAAGGCACTCCATTCACATCACGATCTCGTCTGC33990.15984853187659073RNA PCR Primer, Index 1 (96% over 28bp)
TGAGGTAGTAGGTTGTATAGTTGGAATTCTCGGGTGCCAAGGAACTCCAG33880.15933122271194156RNA PCR Primer, Index 1 (100% over 29bp)
TCTTTGGTTATCTAGCTGTCTTGGAATTCTCGGGTGCCAAGGAACTCCAG33740.1586728292296608RNA PCR Primer, Index 1 (100% over 29bp)
TGGAATTCTCGGGTGCCAAGGAACTCCAGTCACATCACTATCTCGTATGC31470.14799744919553723RNA PCR Primer, Index 1 (98% over 50bp)
CCACGTTCCCGTGGTGGAATTCTCGGGTGCCAAGGAACTCCAGTCACCTC31090.14621038117220375RNA PCR Primer, Index 1 (97% over 36bp)
TCCCTGAGACCCTTAACCTGTGTTGGAATTCTCGGGTGCCAAGGAACTCC30940.1455049595840458RNA PCR Primer, Index 1 (100% over 27bp)
CCCTGAGACCCTTAACCTGTGCTGGAATTCTCGGGTGCCAAGGAACTCCA30620.14400006019597553RNA PCR Primer, Index 1 (100% over 28bp)
TTGCATAGTCACAAAAGTGCTCTGGAATTCTCGGGTGCCAAGGAACTCCA30590.14385897587834395RNA PCR Primer, Index 1 (100% over 28bp)
TCTTTGGTTATCTAGCTGTCTGTGGAATTCTCGGGTGCCAAGGAACTCCA30330.14263624512553683RNA PCR Primer, Index 1 (100% over 28bp)
AACATTCAACGCTGTCGGTGGTGGAATTCTCGGGTGCCAAGGAACTCCAG30080.14146054247860693RNA PCR Primer, Index 1 (100% over 29bp)
AACCCGTAGATCCGAACTTGTGATGGAATTCTCGGGTGCCAAGGAACTCC29990.14103728952571215RNA PCR Primer, Index 1 (100% over 27bp)
TGAGATGAAGCACTGTAGCTCTTGGAATTCTCGGGTGCCAAGGAACTCCA29880.14051998036106297RNA PCR Primer, Index 1 (100% over 28bp)
ACCATCGACCGTTGACTGTGCCTTGGAATTCTCGGGTGCCAAGGAACTCC29840.1403318679375542RNA PCR Primer, Index 1 (100% over 27bp)
TCCAGCATCAGTGATTTTGTTTGGAATTCTCGGGTGCCAAGGAACTCCAG29220.13741612537316802RNA PCR Primer, Index 1 (100% over 29bp)
AGCTACATTGTCTGCTGGGTTTCTGGAATTCTCGGGTGCCAAGGAACTCC28740.1351587762910626RNA PCR Primer, Index 1 (100% over 27bp)
CAGGCTGGTTAGATGGTTGTCTTGGAATTCTCGGGTGCCAAGGAACTCCA28720.1350647200793082RNA PCR Primer, Index 1 (100% over 28bp)
AGAATAATGCCAGCAGTCGGTCTGGAATTCTCGGGTGCCAAGGAACTCCA28690.1349236357616766RNA PCR Primer, Index 1 (100% over 28bp)
TCCAGCATCAGTGATTTTGTTGTGGAATTCTCGGGTGCCAAGGAACTCCA27860.1310203029738693RNA PCR Primer, Index 1 (100% over 28bp)
AGCTACATCTGGCTACTGGGTCTTGGAATTCTCGGGTGCCAAGGAACTCC27580.12970351600930782RNA PCR Primer, Index 1 (100% over 27bp)
GGAATACCAGGTGCTGTAAGCTTTGGAATTCTCGGGTGCCAAGGAACTCC27290.12833970093886912RNA PCR Primer, Index 1 (100% over 27bp)
TCACAGTGAACCGGTCTCTTTGGAATTCTCGGGTGCCAAGGAACTCCAGT27250.12815158851536032RNA PCR Primer, Index 1 (100% over 30bp)
TGAGGTAGTTGGTTGTATTGTTTGGAATTCTCGGGTGCCAAGGAACTCCA26980.12688182965667602RNA PCR Primer, Index 1 (100% over 28bp)
GGAATTCTCGGGTGCCAAGGAACTCCAGTCACATCACGATCTCGTATGCC26430.1242952838334302RNA PCR Primer, Index 1 (100% over 50bp)
CTACGCCTGTCTGAGGGTCGCTTGGAATTCTCGGGTGCCAAGGAACTCCA24890.11705295552834195RNA PCR Primer, Index 1 (100% over 28bp)
CCTGTCTGAGGGTCGCTTGGACTTCTCGGGTGCCAAGGAACTCCAGTCAC24850.11686484310483318RNA PCR Primer, Index 1 (96% over 33bp)
AAGCTGCCAGCTGAAGAACTTGGAATTCTCGGGTGCCAAGGAACTCCAGT24100.11333773516404343RNA PCR Primer, Index 1 (100% over 30bp)
TTCCCTTTGTCATCCTATGCCTTGGAATTCTCGGGTGCCAAGGAACTCCA23810.11197392009360474RNA PCR Primer, Index 1 (100% over 28bp)
AGCTACATTGTCTGCTGGGTTTTGGAATTCTCGGGTGCCAAGGAACTCCA23630.1111274141878152RNA PCR Primer, Index 1 (100% over 28bp)
TCCCTGAGACCCTTAACCTGTGGTGGAATTCTCGGGTGCCAAGGAACTCC23470.11037496449378006RNA PCR Primer, Index 1 (100% over 27bp)
GAATACCAGGTGCTGTAAGCTTTGGAATTCTCGGGTGCCAAGGAACTCCA23430.11018685207027128RNA PCR Primer, Index 1 (100% over 28bp)
TCCCTGAGACCCTAACTTGTGCTGGAATTCTCGGGTGCCAAGGAACTCCA23390.1099987396467625RNA PCR Primer, Index 1 (100% over 28bp)
AACATTCAACGATGTCGGTGATGGAATTCTCGGGTGCCAAGGAACTCCAG23140.10882303699983258RNA PCR Primer, Index 1 (100% over 29bp)
TATGGCTTTTTATTCCTATCTGATGGAATTCTCGGGTGCCAAGGAACTCC22720.10684785655299034RNA PCR Primer, Index 1 (100% over 27bp)
ACCATCGACCGTTGACTGTACCTGGAATTCTCGGGTGCCAAGGAACTCCA22710.10680082844711314RNA PCR Primer, Index 1 (100% over 28bp)
TAAAGCTAGAGAACCGAAAGTATTGGAATTCTCGGGTGCCAAGGAACTCC22550.10604837875307799RNA PCR Primer, Index 1 (100% over 27bp)
TCCCTGAGACCCTAACTTGTTGGAATTCTCGGGTGCCAAGGAACTCCAGT22410.10538998527079724RNA PCR Primer, Index 1 (100% over 30bp)
TAAAGCTAGAGAACCGAAAGTAATGGAATTCTCGGGTGCCAAGGAACTCC22370.10520187284728845RNA PCR Primer, Index 1 (100% over 27bp)
TCCCTGAGACCATTAACCTGTTGGAATTCTCGGGTGCCAAGGAACTCCAG22290.10482564800027089RNA PCR Primer, Index 1 (100% over 29bp)
TAGCTTATCAGACTGGTGTTGGTGGAATTCTCGGGTGCCAAGGAACTCCA21510.10115745574184956RNA PCR Primer, Index 1 (100% over 28bp)

[WARN]Adapter Content

Adapter graph

[FAIL]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
GAGCTTA453.965397E-1044.8685652
GTAGCAC1450.044.8685657
GTCAAAA1150.044.8685658
GCGATAC453.965397E-1044.8685657
GACGAAC453.965397E-1044.8685653
TAGCTGA453.965397E-1044.8685657
AGCACCA406.9976522E-944.868562
CTTAAAA950.044.868563
GGGGATA207.1366975E-444.868568
CGTATAT207.1366975E-444.868567
GATCGCA253.9597035E-544.868565
CCCTAAG207.1366975E-444.868562
GCACGTA3100.044.868566
GGATCCG253.9597035E-544.868568
GTTAGAT3000.044.868568
ATTCGAC800.044.868564
CCTAAGA207.1366975E-444.868563
ACTTACT207.1366975E-444.868567
CGTTCCA406.9976522E-944.868566
TTATATA3550.044.868568