FastQCFastQC Report
Mon 5 Dec 2016
JM101_3_CGATGT_L005_R1_001.fastq

Summary

[OK]Basic Statistics

MeasureValue
FilenameJM101_3_CGATGT_L005_R1_001.fastq
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences10574364
Sequences flagged as poor quality0
Sequence length50
%GC52

[OK]Per base sequence quality

Per base quality graph

[OK]Per tile sequence quality

Per base quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[FAIL]Per base sequence content

Per base sequence content

[FAIL]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[OK]Sequence Length Distribution

Sequence length distribution

[FAIL]Sequence Duplication Levels

Duplication level graph

[FAIL]Overrepresented sequences

SequenceCountPercentagePossible Source
TGGAATTCTCGGGTGCCAAGGAACTCCAGTCACCGATGTATCTCGTATGC450956042.646158199207065RNA PCR Primer, Index 2 (100% over 50bp)
TGGAGTGTGACAATGGTGTTTGTGGAATTCTCGGGTGCCAAGGAACTCCA2635382.492234993991128RNA PCR Primer, Index 1 (100% over 28bp)
AAGCTGCCAGCTGAAGAACTGTTGGAATTCTCGGGTGCCAAGGAACTCCA1220221.1539417406096482RNA PCR Primer, Index 1 (100% over 28bp)
TTGCGGCCCCGGGTTCCTCCCGGGGCTACGCCTGTCTGAGGGTCGCTTGG1163251.1000661600073536No Hit
TTCAAGTAATCCAGGATAGGCTTGGAATTCTCGGGTGCCAAGGAACTCCA1131891.0704095300672456RNA PCR Primer, Index 1 (100% over 28bp)
TGGAGTGTGACAATGGTGTTTTGGAATTCTCGGGTGCCAAGGAACTCCAG1039070.982631201271301RNA PCR Primer, Index 1 (100% over 29bp)
TAGCTTATCAGACTGGTGTTGGCTGGAATTCTCGGGTGCCAAGGAACTCC992130.9382408246964072RNA PCR Primer, Index 1 (100% over 27bp)
GTTCTACAGTCCGACTGGAATTCTCGGGTGCCAAGGAACTCCAGTCACCG902830.8537913013019033RNA PCR Primer, Index 2 (100% over 35bp)
ACCACGTTCCCGTGGTGGAATTCTCGGGTGCCAAGGAACTCCAGTCACCG822990.7782879424237713RNA PCR Primer, Index 2 (100% over 35bp)
ATGACCTATGAATTGACAGCCATGGAATTCTCGGGTGCCAAGGAACTCCA805530.7617763110859433RNA PCR Primer, Index 1 (100% over 28bp)
AACATTCAACGCTGTCGGTGAGTTGGAATTCTCGGGTGCCAAGGAACTCC750560.7097920971890129RNA PCR Primer, Index 1 (100% over 27bp)
TGGAGTGTGACAATGGTGTTTGTTGGAATTCTCGGGTGCCAAGGAACTCC749980.7092436008444574RNA PCR Primer, Index 1 (100% over 27bp)
ATGACCTATGAATTGACAGCCTGGAATTCTCGGGTGCCAAGGAACTCCAG748070.7074373456408348RNA PCR Primer, Index 1 (100% over 29bp)
AACATTCAACGCTGTCGGTGAGTGGAATTCTCGGGTGCCAAGGAACTCCA648720.6134837045518765RNA PCR Primer, Index 1 (100% over 28bp)
TATTGCACTTGTCCCGGCCTGTTGGAATTCTCGGGTGCCAAGGAACTCCA626480.5924517067882286RNA PCR Primer, Index 1 (100% over 28bp)
CTACAGTCCGACGATCTGGAATTCTCGGGTGCCAAGGAACTCCAGTCACC605180.5723086513761017RNA PCR Primer, Index 2 (100% over 34bp)
TGAGGTAGTAGGTTGTATAGTTTGGAATTCTCGGGTGCCAAGGAACTCCA562270.5317293787125165RNA PCR Primer, Index 1 (100% over 28bp)
CACCACGTTCCCGTGGTGGAATTCTCGGGTGCCAAGGAACTCCAGTCACC561720.5312092528685414RNA PCR Primer, Index 2 (100% over 34bp)
AGTTCTACAGTCCGACGATCTGGAATTCTCGGGTGCCAAGGAACTCCAGT550580.5206743403196636RNA PCR Primer, Index 1 (100% over 30bp)
CCTGTCTGAGGGTCGCTTGGAATTCTCGGGTGCCAAGGAACTCCAGTCAC472110.44646656763470594RNA PCR Primer, Index 1 (100% over 33bp)
CATGGAATTCTCGGGTGCCAAGGAACTCCAGTCACCGATGTATCTCGTAT454160.4294915514540638RNA PCR Primer, Index 2 (100% over 48bp)
TCTACAGTCCGACGATCTGGAATTCTCGGGTGCCAAGGAACTCCAGTCAC430230.4068613488243832RNA PCR Primer, Index 1 (100% over 33bp)
TAGTTCTACAGTCCGACGATCTGGAATTCTCGGGTGCCAAGGAACTCCAG417040.3943877854025074RNA PCR Primer, Index 1 (100% over 29bp)
TGGAATTCTCGGGTGCCAAGGAACTCCAGTCACCGATGGATCTCGTATGC381210.3605039508759108RNA PCR Primer, Index 2 (98% over 50bp)
TGGACAACTCTTAGCGGTGGAATTCTCGGGTGCCAAGGAACTCCAGTCAC365550.34569454957291046RNA PCR Primer, Index 1 (100% over 33bp)
ACAGTCCGACGATCTGGAATTCTCGGGTGCCAAGGAACTCCAGTCACCGA359600.3400677336244525RNA PCR Primer, Index 2 (100% over 36bp)
TTCAAGTAATCCAGGATAGGTTTGGAATTCTCGGGTGCCAAGGAACTCCA338050.31968825737415507RNA PCR Primer, Index 1 (100% over 28bp)
CAGAGTTCTACAGTCCGACGATCTGGAATTCTCGGGTGCCAAGGAACTCC329310.31142298487171427RNA PCR Primer, Index 1 (100% over 27bp)
AGAGTTCTACAGTCCGACGATCTGGAATTCTCGGGTGCCAAGGAACTCCA321350.3038953453843654RNA PCR Primer, Index 1 (100% over 28bp)
TTCTACAGTCCGACGATCTGGAATTCTCGGGTGCCAAGGAACTCCAGTCA317510.30026392131006646RNA PCR Primer, Index 1 (100% over 32bp)
TGAGGTAGTAGTTTGTATAGTTTGGAATTCTCGGGTGCCAAGGAACTCCA311000.2941075226841066RNA PCR Primer, Index 1 (100% over 28bp)
GGACAACTCTTAGCGGTGGAATTCTCGGGTGCCAAGGAACTCCAGTCACC307070.29039098710806627RNA PCR Primer, Index 2 (100% over 34bp)
TACAGTCCGACGATCTGGAATTCTCGGGTGCCAAGGAACTCCAGTCACCG304760.2882064585633708RNA PCR Primer, Index 2 (100% over 35bp)
TAACGGAACCCATAATGCAGCTGTGGAATTCTCGGGTGCCAAGGAACTCC302370.2859462753504608RNA PCR Primer, Index 1 (100% over 27bp)
GTTCTACAGTCCGACGTGGAATTCTCGGGTGCCAAGGAACTCCAGTCACC279870.2646683999151155RNA PCR Primer, Index 2 (100% over 34bp)
GTTTCCGTAGTGTAGTGGTTATCACGTTCGCCTTGGAATTCTCGGGTGCC278460.2633349863878338No Hit
TGTAAACATCCTTGACTGGAAGCTTGGAATTCTCGGGTGCCAAGGAACTC266750.2522610343279274RNA PCR Primer, Index 1 (100% over 26bp)
TAGCAGCACGTAAATATTGGAGTGGAATTCTCGGGTGCCAAGGAACTCCA260800.24663421837946947RNA PCR Primer, Index 1 (100% over 28bp)
TGTAAACATCCTACACTCTCAGCTTGGAATTCTCGGGTGCCAAGGAACTC259080.24500764301285638RNA PCR Primer, Index 1 (100% over 26bp)
AACTCTTAGCGGTGGATCACTCGGCTCGTGCGTCGATGAAGAACGCAGCT235180.22240581088375624No Hit
GCATTGGTGGTTCAGTGGTAGAATTCTCGCCTTGGAATTCTCGGGTGCCA231200.2186419911400818No Hit
GTTTCCGTAGTGTAGTGGTTATCACGTCTGCCTTGGAATTCTCGGGTGCC229450.2169870452728883No Hit
GCATCGATGGTTCAGTGGTAGAATGCTCGCCTTGGAATTCTCGGGTGCCA224550.21235319684474643No Hit
TGAGAACTGAATTCCATAGATGGTGGAATTCTCGGGTGCCAAGGAACTCC210780.19933113707831504RNA PCR Primer, Index 1 (100% over 27bp)
GCATCGATGGTTCAGTGGTAGAATGCTGGAATTCTCGGGTGCCAAGGAAC195340.18472978611290475RNA PCR Primer, Index 1 (100% over 24bp)
TCCCTGGTGGTCTAGTGGTTAGGATTCGGCGCTCTGGAATTCTCGGGTGC189420.17913134066502723No Hit
GCATTGGTGGTTCAGTGGTAGAATTCTCGCCTGGAATTCTCGGGTGCCAA185020.17497033391322636No Hit
TAGCTTATCAGACTGGTGTTGGTGGAATTCTCGGGTGCCAAGGAACTCCA182520.17260612553152133RNA PCR Primer, Index 1 (100% over 28bp)
GATCCATGATGACATTAAAACATAACGTGACTGTTGGATGAAGCTTGCGG174720.16522979538060162No Hit
TCCCTGGTGGTCTAGTGGTTAGGATTCGGCGCTTGGAATTCTCGGGTGCC163610.15472325333230444No Hit
TGGAATTCTCGGGTGCCAAGGAACTCCAGTCACCGTTGTATCTCGTATGC162210.1533992966385496RNA PCR Primer, Index 2 (98% over 50bp)
CTGGACAACTCTTAGCGGTGGAATTCTCGGGTGCCAAGGAACTCCAGTCA159320.15066627174929859RNA PCR Primer, Index 1 (100% over 32bp)
TGAGGTAGTAGATTGAATAGTTTGGAATTCTCGGGTGCCAAGGAACTCCA153180.144859775963831RNA PCR Primer, Index 1 (100% over 28bp)
AGCCTGTGATGATACAAGTTATCCCTGTCTGAACTCTGGTGTGGAATTCT152100.14383843794293444No Hit
AACATTCAACGCTGTCGGTGATGGAATTCTCGGGTGCCAAGGAACTCCAG145670.13775769398518908RNA PCR Primer, Index 1 (100% over 29bp)
TGAGGTAGTAGTTTGTGCTGTTTGGAATTCTCGGGTGCCAAGGAACTCCA144990.1371146293053653RNA PCR Primer, Index 1 (100% over 28bp)
TTCACAGTGGTTAAGTTCTGCCTGGAATTCTCGGGTGCCAAGGAACTCCA140020.1324145830425357RNA PCR Primer, Index 1 (100% over 28bp)
GCATCGATGGTTCAGTGGTAGAATGCTCTGGAATTCTCGGGTGCCAAGGA134990.12765779577854516RNA PCR Primer, Index 1 (100% over 22bp)
TGAGATGAAGCACTGTAGCTCTGGAATTCTCGGGTGCCAAGGAACTCCAG133600.12634329591831717RNA PCR Primer, Index 1 (100% over 29bp)
TCACAGTGAACCGGTCTCTTTTGGAATTCTCGGGTGCCAAGGAACTCCAG130950.12383723503370983RNA PCR Primer, Index 1 (100% over 29bp)
TCGCTGCGATCCATTGAAAGTCAGCCCTCGATCCAAGTTTTTGTTGGAAT130070.12300503368334965No Hit
CATTATTACTTTTGGTACGCGTGGAATTCTCGGGTGCCAAGGAACTCCAG129930.12287263801397418RNA PCR Primer, Index 1 (100% over 29bp)
CTCGCTGCGATCCATTGAAAGTCAGCCCTCGATCCAAGTTTTTGTTGGAA127970.12101909864271743No Hit
GCATCGATGGTTCAGTGGTAGAATGCTCGCCTGGAATTCTCGGGTGCCAA127700.12076376413749329No Hit
TGTCTGAGGGTCGCTTGGAATTCTCGGGTGCCAAGGAACTCCAGTCACCG126880.11998830378829403RNA PCR Primer, Index 2 (100% over 35bp)
TGGAATTCTCGGGTGCCAAGGAACTCCAGTCAACGATGTATCTCGTATGC125420.11860760609337828RNA PCR Primer, Index 2 (98% over 50bp)
GTGGGCTCTGGTAGTCCAGTGGCAAGATCGTCTGACTTACGTTTTGGAAT121970.11534499852662533No Hit
CAACTCTTAGCGGTGGATCACTCGGCTCGTGCGTCGATGAAGAACGCAGC120330.11379407782822683No Hit
TGAATTCTCGGGTGCCAAGGAACTCCAGTCACCGATGTATCTCGTATGCC118960.11249849163505246RNA PCR Primer, Index 2 (98% over 50bp)
TTGCGGCCCCGGGTTCCTCCCGGGGCTACGCCTGTCTGAGGGTCGCTTTG116950.11059766809616162No Hit
TGGACGTGATGAGCAGGTGTTACCGCCCCAGTCTGATGTTTGGTGACTGA116300.10998297391691832No Hit
TGTAAACATCCTACACTCAGCTTGGAATTCTCGGGTGCCAAGGAACTCCA116110.10980329407990874RNA PCR Primer, Index 1 (100% over 28bp)
ACAGTAGTCTGCACATTGGTTTGGAATTCTCGGGTGCCAAGGAACTCCAG112040.10595436283449293RNA PCR Primer, Index 1 (100% over 29bp)
CCACGTTCCCGTGGTGGAATTCTCGGGTGCCAAGGAACTCCAGTCACCGA109460.10351449978457333RNA PCR Primer, Index 2 (100% over 36bp)

[OK]Adapter Content

Adapter graph

[FAIL]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
TAGTATG551.8189894E-1244.01392443
CTAGTAT502.7284841E-1144.00955642
CACGTCA351.4475518E-744.00018727
TTCGCCA750.044.00018727
CATGCGA3000.043.9999825
ACGTCAC351.4476063E-743.9999828
GCTATGT408.3236955E-943.99977517
AAAGTGC3750.043.9997752
ATTATCT408.3236955E-943.99977537
CCAGTAG3400.043.99977517
AATTGCC600.043.9997717
TAGGCTA650.043.9997717
TAGGCGT302.529785E-643.9997717
ACGAGGT700.043.999772
TAGACGC850.043.99956520
CGTTTCT207.859796E-443.99956520
CGATAAA1050.043.99956520
TATAAGC1150.043.9993616
ATAGATT2200.043.99935516
CGTTAGG302.5299505E-643.99935516