FastQCFastQC Report
Mon 5 Dec 2016
JM102_5_ATTCCT_L002_R1_001.fastq

Summary

[OK]Basic Statistics

MeasureValue
FilenameJM102_5_ATTCCT_L002_R1_001.fastq
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences14214297
Sequences flagged as poor quality0
Sequence length50
%GC51

[OK]Per base sequence quality

Per base quality graph

[FAIL]Per tile sequence quality

Per base quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[FAIL]Per base sequence content

Per base sequence content

[WARN]Per sequence GC content

Per sequence GC content graph

[WARN]Per base N content

N content graph

[OK]Sequence Length Distribution

Sequence length distribution

[FAIL]Sequence Duplication Levels

Duplication level graph

[FAIL]Overrepresented sequences

SequenceCountPercentagePossible Source
AACATTCAACGCTGTCGGTGAGTGGAATTCTCGGGTGCCAAGGAACTCCA6427514.521862741435612RNA PCR Primer, Index 1 (100% over 28bp)
AACATTCAACGCTGTCGGTGAGTTGGAATTCTCGGGTGCCAAGGAACTCC5351253.7646955034075904RNA PCR Primer, Index 1 (100% over 27bp)
TAGCTTATCAGACTGGTGTTGGCTGGAATTCTCGGGTGCCAAGGAACTCC4759063.348079753785924RNA PCR Primer, Index 1 (100% over 27bp)
TACCCTGTAGAACCGAATTTGTTGGAATTCTCGGGTGCCAAGGAACTCCA2879862.0260305521968482RNA PCR Primer, Index 1 (100% over 28bp)
TTCAAGTAATCCAGGATAGGCTTGGAATTCTCGGGTGCCAAGGAACTCCA2816061.9811461657231448RNA PCR Primer, Index 1 (100% over 28bp)
CCTGTCTGAGGGTCGCTTGGAATTCTCGGGTGCCAAGGAACTCCAGTCAC1972371.387595883215329RNA PCR Primer, Index 1 (100% over 33bp)
AAGCTGCCAGCTGAAGAACTGTTGGAATTCTCGGGTGCCAAGGAACTCCA1965881.383030057694728RNA PCR Primer, Index 1 (100% over 28bp)
TCCTTCATTCCACCGGAGTCTGTGGAATTCTCGGGTGCCAAGGAACTCCA1952431.3735677536497233RNA PCR Primer, Index 1 (100% over 28bp)
TATTGCACTTGTCCCGGCCTGTTGGAATTCTCGGGTGCCAAGGAACTCCA1438071.0117067344237987RNA PCR Primer, Index 1 (100% over 28bp)
AACAGTAAGAGTTTATGTGCTGTGGAATTCTCGGGTGCCAAGGAACTCCA1359690.9565650696619046RNA PCR Primer, Index 1 (100% over 28bp)
TGAGGTAGTAGGTTGTATAGTTTGGAATTCTCGGGTGCCAAGGAACTCCA1342890.9447459835685155RNA PCR Primer, Index 1 (100% over 28bp)
GCATTGGTGGTTCAGTGGTAGAATTCTCGCCTTGGAATTCTCGGGTGCCA1170280.823311909129238No Hit
TACCCTGTAGAACCGAATTTGCGTGGAATTCTCGGGTGCCAAGGAACTCC1053740.741324034526646RNA PCR Primer, Index 1 (100% over 27bp)
CTACGCCTGTCTGAGGGTCGCTTGGAATTCTCGGGTGCCAAGGAACTCCA1008240.7093140096903843RNA PCR Primer, Index 1 (100% over 28bp)
GCATCGATGGTTCAGTGGTAGAATGCTCTGGAATTCTCGGGTGCCAAGGA968460.6813281022621098RNA PCR Primer, Index 1 (100% over 22bp)
GCATCGATGGTTCAGTGGTAGAATGCTCGCCTTGGAATTCTCGGGTGCCA942570.6631140463717622No Hit
CCTTTCTGAGGGTCGCTTGGAATTCTCGGGTGCCAAGGAACTCCAGTCAC915140.6438165742561873RNA PCR Primer, Index 1 (100% over 33bp)
AACATTCAACGCTGTCGGTGATGGAATTCTCGGGTGCCAAGGAACTCCAG800150.5629191510491163RNA PCR Primer, Index 1 (100% over 29bp)
TTGGTCCCCTTCAACCAGCTGTTGGAATTCTCGGGTGCCAAGGAACTCCA796150.5601050829316427RNA PCR Primer, Index 1 (100% over 28bp)
ACAGTAGTCTGCACATTGGTTTGGAATTCTCGGGTGCCAAGGAACTCCAG788120.5544558411858146RNA PCR Primer, Index 1 (100% over 29bp)
TTCCCTTTGTCATCCTATGCCTTGGAATTCTCGGGTGCCAAGGAACTCCA783130.5509452912092663RNA PCR Primer, Index 1 (100% over 28bp)
GCATCGATGGTTCAGTGGTAGAATGCTGGAATTCTCGGGTGCCAAGGAAC772920.5437623823394151RNA PCR Primer, Index 1 (100% over 24bp)
GTTTCCGTAGTGTAGTGGTTATCACGTTCGCCTTGGAATTCTCGGGTGCC744440.5237262173430033No Hit
TACCCTGTAGAACCGAATTTGCTGGAATTCTCGGGTGCCAAGGAACTCCA730920.5142146671059427RNA PCR Primer, Index 1 (100% over 28bp)
CTGTCTGAGGGTCGCTTGGAATTCTCGGGTGCCAAGGAACTCCAGTCACA691360.4863835334241292RNA PCR Primer, Index 1 (100% over 34bp)
TTTGGTCCCCTTCAACCAGCTGTTGGAATTCTCGGGTGCCAAGGAACTCC672850.4733614332105203RNA PCR Primer, Index 1 (100% over 27bp)
GCCCGGCTAGCTCAGTCGGTAGAGCATGAGACTCTGGAATTCTCGGGTGC621110.43696146211099995No Hit
GTTTCCGTAGTGTAGTGGTTATCACGTCTGCCTTGGAATTCTCGGGTGCC592900.4171152467125177No Hit
GTTTCCGTAGTGTAGTGGTTATCACGTTCGCCTCTGGAATTCTCGGGTGC588680.4141464048485831No Hit
TAACGGAACCCATAATGCAGCTGTGGAATTCTCGGGTGCCAAGGAACTCC491890.3460529915760167RNA PCR Primer, Index 1 (100% over 27bp)
TGTCTGAGGGTCGCTTGGAATTCTCGGGTGCCAAGGAACTCCAGTCACAT485390.34148013088512225RNA PCR Primer, Index 1 (100% over 35bp)
TTCACAGTGGCTAAGTTCTGCTGGAATTCTCGGGTGCCAAGGAACTCCAG484520.3408680710695717RNA PCR Primer, Index 1 (100% over 29bp)
TTCACAGTGGTTAAGTTCTGTGGAATTCTCGGGTGCCAAGGAACTCCAGT482750.3396228459275897RNA PCR Primer, Index 1 (100% over 30bp)
TACAGTAGTCTGCACATTGGTTTGGAATTCTCGGGTGCCAAGGAACTCCA472490.33240476120627RNA PCR Primer, Index 1 (100% over 28bp)
TATGTGCCCTTGGACTACATCGTGGAATTCTCGGGTGCCAAGGAACTCCA462420.32532034472053034RNA PCR Primer, Index 1 (100% over 28bp)
GCATCGATGGTTCAGTGGTAGAATGCTCGCCTGGAATTCTCGGGTGCCAA452470.31832035027831485No Hit
TTCACAGTGGCTAAGTTCTGTGGAATTCTCGGGTGCCAAGGAACTCCAGT446520.31413442395357294RNA PCR Primer, Index 1 (100% over 30bp)
TGAGGTAGTAGTTTGTATAGTTTGGAATTCTCGGGTGCCAAGGAACTCCA443730.31217161144163513RNA PCR Primer, Index 1 (100% over 28bp)
ACCCTGTAGAACCGAATTTGCGTGGAATTCTCGGGTGCCAAGGAACTCCA439850.3094419653676858RNA PCR Primer, Index 1 (100% over 28bp)
TCCTTCATTCCACCGGAGTCTGTTGGAATTCTCGGGTGCCAAGGAACTCC422290.2970882063319769RNA PCR Primer, Index 1 (100% over 27bp)
GCATTGGTGGTTCAGTGGTAGAATTCTCGCCTGGAATTCTCGGGTGCCAA397340.2795354564492356No Hit
TTAGGTAGTAGGTTGTATAGTTTGGAATTCTCGGGTGCCAAGGAACTCCA375150.26392441356755103RNA PCR Primer, Index 1 (100% over 28bp)
AACATTCATTGCTGTCGGTGGGTGGAATTCTCGGGTGCCAAGGAACTCCA361660.2544339688413715RNA PCR Primer, Index 1 (100% over 28bp)
AACATTCATTGCTGTCGGTGGGTTGGAATTCTCGGGTGCCAAGGAACTCC360900.25389929589905147RNA PCR Primer, Index 1 (100% over 27bp)
TAGCTTATCAGACTGGTGTTGGTGGAATTCTCGGGTGCCAAGGAACTCCA358360.2521123626444558RNA PCR Primer, Index 1 (100% over 28bp)
AAGCTGCCAGCTGAAGAACTGCTGGAATTCTCGGGTGCCAAGGAACTCCA356810.2510219112489348RNA PCR Primer, Index 1 (100% over 28bp)
CCACGTTCCCGTGGTGGAATTCTCGGGTGCCAAGGAACTCCAGTCACATT351540.24731437650416338RNA PCR Primer, Index 8 (97% over 36bp)
TTCAAGTAATCCAGGATAGGTTTGGAATTCTCGGGTGCCAAGGAACTCCA347300.24433146429964142RNA PCR Primer, Index 1 (100% over 28bp)
TTATGTAGTAGGTTGTATAGTTTGGAATTCTCGGGTGCCAAGGAACTCCA345880.2433324701179383RNA PCR Primer, Index 1 (100% over 28bp)
ACAGTAGTCTGCACATTGGTTATGGAATTCTCGGGTGCCAAGGAACTCCA332160.23368021647500403RNA PCR Primer, Index 1 (100% over 28bp)
GTTTCCGTAGTGTAGTGGTTATCACGTCTGCCTGTGGAATTCTCGGGTGC329640.23190735356099565No Hit
GCCCGGCTAGCTCAGTCGGTAGAGCATGAGACTTGGAATTCTCGGGTGCC325900.2292761998711579No Hit
TGATGTAGTAGGTTGTATAGTTTGGAATTCTCGGGTGCCAAGGAACTCCA319280.22461891713673915RNA PCR Primer, Index 1 (100% over 28bp)
ACATTAGTCTGCACATTGGTTTGGAATTCTCGGGTGCCAAGGAACTCCAG313490.2205455535366962RNA PCR Primer, Index 1 (100% over 29bp)
ACAACACTGAGACACGAGACGAACACTGGAATTCTCGGGTGCCAAGGAAC308290.2168872649839806RNA PCR Primer, Index 1 (100% over 24bp)
TTGTTCCCCTTCAACCAGCTGTTGGAATTCTCGGGTGCCAAGGAACTCCA307670.21645108442577216RNA PCR Primer, Index 1 (100% over 28bp)
CCTGTCTGAGGGTCGCTTTGGAATTCTCGGGTGCCAAGGAACTCCAGTCA306640.21572646188552275RNA PCR Primer, Index 1 (100% over 32bp)
ACCCTGTAGAACCGAATTTGTGTGGAATTCTCGGGTGCCAAGGAACTCCA302690.21294756961951758RNA PCR Primer, Index 1 (100% over 28bp)
TTGCGGCCCCGGGTTCCTCCCGGGGCTACGCCTGTCTGAGGGTCGCTTGG297010.20895159289270512No Hit
GCATTGGTGGTTCAGTGGTAGAATTCTCGCCTGCTGGAATTCTCGGGTGC296650.2086983267621325No Hit
TTCAGTCATTGTTTCTGGTTGTTGGAATTCTCGGGTGCCAAGGAACTCCA294970.20751641815279365RNA PCR Primer, Index 1 (100% over 28bp)
GCATTGTGGTTCAGTGGTAGAATTCTCGCCTTGGAATTCTCGGGTGCCAA291170.20484305344119375No Hit
TTCACAGTGGTTAAGTTCTGCCTGGAATTCTCGGGTGCCAAGGAACTCCA282170.19851140017687827RNA PCR Primer, Index 1 (100% over 28bp)
AAGCTGCCAGCTGAAGAACTTGGAATTCTCGGGTGCCAAGGAACTCCAGT279020.19629532153436782RNA PCR Primer, Index 1 (100% over 30bp)
TGTAAACATCCTTGACTGGAAGCTTGGAATTCTCGGGTGCCAAGGAACTC259100.18228126230934952RNA PCR Primer, Index 1 (100% over 26bp)
CATTGCACTTGTCTCGGTCTGATGGAATTCTCGGGTGCCAAGGAACTCCA257910.18144407704440113RNA PCR Primer, Index 1 (100% over 28bp)
TTCACAGTGGCTAAGTTCAGTTGGAATTCTCGGGTGCCAAGGAACTCCAG254680.17917171703954124RNA PCR Primer, Index 1 (100% over 29bp)
TACCCTGTAGATCCGGATTTGTTGGAATTCTCGGGTGCCAAGGAACTCCA254480.17903101363366758RNA PCR Primer, Index 1 (100% over 28bp)
TTTTGTCCCCTTCAACCAGCTGTTGGAATTCTCGGGTGCCAAGGAACTCC252730.1777998588322729RNA PCR Primer, Index 1 (100% over 27bp)
CACCACGTTCCCGTGGTGGAATTCTCGGGTGCCAAGGAACTCCAGTCACA252000.17728629140083396RNA PCR Primer, Index 1 (100% over 34bp)
TCCCTGGTGGTCTAGTGGTTAGGATTCGGCGCTCTGGAATTCTCGGGTGC241630.16999081980628378No Hit
TTTCTGAGGGTCGCTTGGAATTCTCGGGTGCCAAGGAACTCCAGTCACAT228320.16062700814539052RNA PCR Primer, Index 1 (100% over 35bp)
CCCAGTGTTCAGACTACCTGTTCTGGAATTCTCGGGTGCCAAGGAACTCC226010.15900188380754954RNA PCR Primer, Index 1 (100% over 27bp)
AACCCGTAGATCCGAACTTGTGTGGAATTCTCGGGTGCCAAGGAACTCCA220190.15490741469662553RNA PCR Primer, Index 1 (100% over 28bp)
CATTATTACTTTTGGTACGCGTGGAATTCTCGGGTGCCAAGGAACTCCAG215850.1518541507891667RNA PCR Primer, Index 1 (100% over 29bp)
AAGTTCTGTGATACACTCAGACTTGGAATTCTCGGGTGCCAAGGAACTCC212940.14980691623370468RNA PCR Primer, Index 1 (100% over 27bp)
GTTCTCGTAGTGTAGTGGTTATCACGTGTGCTTGGAATTCTCGGGTGCCA212740.14966621282783102No Hit
TTCACAGTGGTTAAGTTCTGCTGGAATTCTCGGGTGCCAAGGAACTCCAG206450.14524109071310387RNA PCR Primer, Index 1 (100% over 29bp)
TCCCTGGTGGTCTAGTGGTTAGGATTCGGCGCTTGGAATTCTCGGGTGCC190930.13432250641730648No Hit
TACCCTGTAGAACCGAATTTGTGTGGAATTCTCGGGTGCCAAGGAACTCC189140.13306321093473705RNA PCR Primer, Index 1 (100% over 27bp)
TATTTGCCCTTGGACTACATCGTGGAATTCTCGGGTGCCAAGGAACTCCA188700.13275366344181497RNA PCR Primer, Index 1 (100% over 28bp)
TGAGGTAGTAGTTTGTGCTGTTTGGAATTCTCGGGTGCCAAGGAACTCCA188100.1323315532241939RNA PCR Primer, Index 1 (100% over 28bp)
TGAGATGAAGCACTGTAGCTCTGGAATTCTCGGGTGCCAAGGAACTCCAG187680.13203607607185922RNA PCR Primer, Index 1 (100% over 29bp)
AACATTCAACGCTGTCGGTGAGTTTGGAATTCTCGGGTGCCAAGGAACTC187270.13174763408981816RNA PCR Primer, Index 1 (100% over 26bp)
GCATCGATGGTTCAGTGGTAGAATGCTTGGAATTCTCGGGTGCCAAGGAA185740.13067125303488453RNA PCR Primer, Index 1 (100% over 23bp)
TCCAGCATCAGTGATTTTGTTGTGGAATTCTCGGGTGCCAAGGAACTCCA182060.12808231036680887RNA PCR Primer, Index 1 (100% over 28bp)
GTTTCCGTAGTGTAGTGGTTATCACGTTCGCCTGGAATTCTCGGGTGCCA181910.1279767828124036No Hit
CTACGCCTGTCTGAGGGTCGCTTTGGAATTCTCGGGTGCCAAGGAACTCC181900.12796974764210992RNA PCR Primer, Index 1 (100% over 27bp)
TACCCTGTAGATCCGGATTTGTGTGGAATTCTCGGGTGCCAAGGAACTCC181710.12783607940652994RNA PCR Primer, Index 1 (100% over 27bp)
TTTTTGTTGGAATTCTCGGGTGCCAAGGAACTCCAGTCACATTCCTATCT176890.12444512732497429RNA PCR Primer, Index 27 (100% over 43bp)
AAGTTCTGTGATACACTTTGACTTGGAATTCTCGGGTGCCAAGGAACTCC173440.12201799357365334RNA PCR Primer, Index 1 (100% over 27bp)
AACATTCATTGCTGTCGGTGGGTTTGGAATTCTCGGGTGCCAAGGAACTC172890.12163105920750072RNA PCR Primer, Index 1 (100% over 26bp)
TGGAATTCTCGGGTGCCAAGGAACTCCAGTCACATTCCTATCTCGTATGC172070.12105417524341865RNA PCR Primer, Index 27 (100% over 50bp)
TCCTTCATTCCACCGGAGTCTTGGAATTCTCGGGTGCCAAGGAACTCCAG171740.12082201462372709RNA PCR Primer, Index 1 (100% over 29bp)
TCCCTGAGACCCTTAACCTGTGATGGAATTCTCGGGTGCCAAGGAACTCC166200.1169245302810262RNA PCR Primer, Index 1 (100% over 27bp)
GCATTGATGGTTCAGTGGTAGAATGCTCGCCTTGGAATTCTCGGGTGCCA165040.11610845052695887No Hit
TACGCCTGTCTGAGGGTCGCTTGGAATTCTCGGGTGCCAAGGAACTCCAG157990.11114865546991175RNA PCR Primer, Index 1 (100% over 29bp)
ACCACGTTCCCGTGGTGGAATTCTCGGGTGCCAAGGAACTCCAGTCACAT157730.11096574104227595RNA PCR Primer, Index 1 (100% over 35bp)
TGTAAACATCCTACACTCTCAGCTTGGAATTCTCGGGTGCCAAGGAACTC151500.1065828299493109RNA PCR Primer, Index 1 (100% over 26bp)
ACCACAGGGTAGAACCACGGACTGGAATTCTCGGGTGCCAAGGAACTCCA150860.10613257905051512RNA PCR Primer, Index 1 (100% over 28bp)
CCTTTCTGAGGGTCGCTTTGGAATTCTCGGGTGCCAAGGAACTCCAGTCA149560.10521800691233622RNA PCR Primer, Index 1 (100% over 32bp)
TGGACGGAGAACTGATAAGGGCTGGAATTCTCGGGTGCCAAGGAACTCCA149240.10499288146293834RNA PCR Primer, Index 1 (100% over 28bp)
TTCAAGTAATCCAGGATGGGCTTGGAATTCTCGGGTGCCAAGGAACTCCA148700.10461298226707941RNA PCR Primer, Index 1 (100% over 28bp)
TTTGGTCCCCTTCAACCAGCTGTGGAATTCTCGGGTGCCAAGGAACTCCA148150.1042260479009268RNA PCR Primer, Index 1 (100% over 28bp)
TCCCTGAGACCCTTAACCTGTGTGGAATTCTCGGGTGCCAAGGAACTCCA147420.10371248046948786RNA PCR Primer, Index 1 (100% over 28bp)
AACACTCAACGCTGTCGGTGAGTGGAATTCTCGGGTGCCAAGGAACTCCA143650.10106022126876904RNA PCR Primer, Index 1 (100% over 28bp)

[WARN]Adapter Content

Adapter graph

[FAIL]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
ACGTTCG228500.045.4698424
GTTCGCC229000.045.4061326
TTCGCCT233100.045.299927
TCGCCTC81250.044.96668228
TGCTCGC226150.044.95443724
GCTCGCC225100.044.86250725
ATGCTCG225100.044.66685523
ATGCTCT133100.044.4318223
CGCCTCT82600.044.00864829
CGTTCGC236800.043.9785925
TTCACGA551.8189894E-1243.7349361
AACATTC1663050.043.707321
ACGCGTA254.665617E-543.641052
TCCTTCA292800.043.6229131
CTATACG208.202451E-443.6200143
CGTGTAT700.043.6200144
CGCATAA551.8189894E-1243.6190955
CGTAGCA351.5499973E-743.6190955
TAGCTTA618450.043.611181
AACAGTA156500.043.609181