FastQCFastQC Report
Mon 5 Dec 2016
JM103_1_CGATGT_L002_R1_001.fastq

Summary

[OK]Basic Statistics

MeasureValue
FilenameJM103_1_CGATGT_L002_R1_001.fastq
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences4277442
Sequences flagged as poor quality0
Sequence length50
%GC52

[OK]Per base sequence quality

Per base quality graph

[OK]Per tile sequence quality

Per base quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[FAIL]Per base sequence content

Per base sequence content

[FAIL]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[OK]Sequence Length Distribution

Sequence length distribution

[FAIL]Sequence Duplication Levels

Duplication level graph

[FAIL]Overrepresented sequences

SequenceCountPercentagePossible Source
AACATTCAACGCTGTCGGTGAGTGGAATTCTCGGGTGCCAAGGAACTCCA4276819.998522481426985RNA PCR Primer, Index 1 (100% over 28bp)
TGGAATTCTCGGGTGCCAAGGAACTCCAGTCACCGATGTATCTCGTATGC2175185.085235521603799RNA PCR Primer, Index 2 (100% over 50bp)
AACATTCAACGCTGTCGGTGAGTTGGAATTCTCGGGTGCCAAGGAACTCC1916004.4793126359165125RNA PCR Primer, Index 1 (100% over 27bp)
TTCAAGTAATCCAGGATAGGCTTGGAATTCTCGGGTGCCAAGGAACTCCA1243162.9063164386565616RNA PCR Primer, Index 1 (100% over 28bp)
AACCCGTAGATCCGAACTTGTGTGGAATTCTCGGGTGCCAAGGAACTCCA1031912.4124465042424887RNA PCR Primer, Index 1 (100% over 28bp)
TGGAATTCTCGGGTGCCAAGGAACTCCAGTCCCCGATGTATCTCGTATGC869622.033037502320312RNA PCR Primer, Index 2 (98% over 50bp)
TAAAGCTAGAGAACCGAAAGTATGGAATTCTCGGGTGCCAAGGAACTCCA761631.7805735296936815RNA PCR Primer, Index 1 (100% over 28bp)
TGAGGTAGTAGGTTGTATAGTTTGGAATTCTCGGGTGCCAAGGAACTCCA721801.687457129751847RNA PCR Primer, Index 1 (100% over 28bp)
TCACAGTGAACCGGTCTCTTTTGGAATTCTCGGGTGCCAAGGAACTCCAG641451.4996112162362458RNA PCR Primer, Index 1 (100% over 29bp)
TCCCTGAGACCCTTAACCTGTGTGGAATTCTCGGGTGCCAAGGAACTCCA486431.1371983535954433RNA PCR Primer, Index 1 (100% over 28bp)
TCTTTGGTTATCTAGCTGTATGATGGAATTCTCGGGTGCCAAGGAACTCC383440.8964236101857138RNA PCR Primer, Index 1 (100% over 27bp)
TCTTTGGTTATCTAGCTGTATGTGGAATTCTCGGGTGCCAAGGAACTCCA363730.8503446686126896RNA PCR Primer, Index 1 (100% over 28bp)
CCACGTTCCCGTGGTGGAATTCTCGGGTGCCAAGGAACTCCAGTCACCGA339800.7944000175806006RNA PCR Primer, Index 2 (100% over 36bp)
AACATTCAACGCTGTCGGTGATGGAATTCTCGGGTGCCAAGGAACTCCAG336680.7871059385492544RNA PCR Primer, Index 1 (100% over 29bp)
TCTTTGGTTATCTAGCTGTATTGGAATTCTCGGGTGCCAAGGAACTCCAG332890.7782455028028433RNA PCR Primer, Index 1 (100% over 29bp)
TAAAGCTAGAGAACCGAAAGTTGGAATTCTCGGGTGCCAAGGAACTCCAG322980.7550774504949453RNA PCR Primer, Index 1 (100% over 29bp)
TGAGGTAGTAGTTTGTGCTGTTTGGAATTCTCGGGTGCCAAGGAACTCCA317580.7424530829406921RNA PCR Primer, Index 1 (100% over 28bp)
AGCTACATCTGGCTACTGGGTCTCTGGAATTCTCGGGTGCCAAGGAACTC309270.7230255839822024RNA PCR Primer, Index 1 (100% over 26bp)
TATTGCACTTGTCCCGGCCTGTTGGAATTCTCGGGTGCCAAGGAACTCCA308010.7200798982195434RNA PCR Primer, Index 1 (100% over 28bp)
TCCCTGAGACCCTTAACCTGTGATGGAATTCTCGGGTGCCAAGGAACTCC253550.5927608135890563RNA PCR Primer, Index 1 (100% over 27bp)
TCCCTGAGACCCTTAACCTGTTGGAATTCTCGGGTGCCAAGGAACTCCAG249980.5844147039281888RNA PCR Primer, Index 1 (100% over 29bp)
AACATTCATTGCTGTCGGTGGGTGGAATTCTCGGGTGCCAAGGAACTCCA248800.5816560458330001RNA PCR Primer, Index 1 (100% over 28bp)
TGAGGTAGTAGTTTGTATAGTTTGGAATTCTCGGGTGCCAAGGAACTCCA237910.5561969045985895RNA PCR Primer, Index 1 (100% over 28bp)
GGAATTCTCGGGTGCCAAGGAACTCCAGTCACCGATGTATCTCGTATGCC224730.5253840963828382RNA PCR Primer, Index 2 (100% over 50bp)
TGGAATTCTCGGGTGCCAAGGAACTCCAGTCCCCGCTGTATCTCGTATGC208540.4875343721785123RNA PCR Primer, Index 2 (97% over 35bp)
AACCCGTAGATCCGAACTTGTTGGAATTCTCGGGTGCCAAGGAACTCCAG208140.4865992338411602RNA PCR Primer, Index 1 (100% over 29bp)
TTAAAGGGAATTTGCGACTGTTTGGAATTCTCGGGTGCCAAGGAACTCCA207770.4857342308791095RNA PCR Primer, Index 1 (100% over 28bp)
TGAGGTAGTTGGTTGTATAGTTTGGAATTCTCGGGTGCCAAGGAACTCCA207170.48433152337308144RNA PCR Primer, Index 1 (100% over 28bp)
TTGCATAGTCACAAAAGTGATCTGGAATTCTCGGGTGCCAAGGAACTCCA201510.4710993158995493RNA PCR Primer, Index 1 (100% over 28bp)
TAGCTTATCAGACTGGTGTTGGCTGGAATTCTCGGGTGCCAAGGAACTCC200500.4687380915977353RNA PCR Primer, Index 1 (100% over 27bp)
TCCCTGAGACCCTAACTTGTGATGGAATTCTCGGGTGCCAAGGAACTCCA195770.45768008075854677RNA PCR Primer, Index 1 (100% over 28bp)
AGCTACATTGTCTGCTGGGTTTCTGGAATTCTCGGGTGCCAAGGAACTCC195750.45763332384167926RNA PCR Primer, Index 1 (100% over 27bp)
TGGAATTCTCGGGTGCCAAGGAACTCCAGTCACCGCTGTATCTCGTATGC191460.44760396517357803RNA PCR Primer, Index 2 (98% over 50bp)
TATTGCACTCGTCCCGGCCTCCTGGAATTCTCGGGTGCCAAGGAACTCCA187350.4379954187572853RNA PCR Primer, Index 1 (100% over 28bp)
AAGGTCCAACCTCACATGTCCTTGGAATTCTCGGGTGCCAAGGAACTCCA176100.4116946530192578RNA PCR Primer, Index 1 (100% over 28bp)
ACCTTGGCTTTAGACTGCTTACTTGGAATTCTCGGGTGCCAAGGAACTCC167280.3910748526806442RNA PCR Primer, Index 1 (100% over 27bp)
TACCCTGTAGAACCGAATTTGTTGGAATTCTCGGGTGCCAAGGAACTCCA165580.3871005147468978RNA PCR Primer, Index 1 (100% over 28bp)
AACATTCATTGCTGTCGGTGGGTTGGAATTCTCGGGTGCCAAGGAACTCC150720.35236012551426765RNA PCR Primer, Index 1 (100% over 27bp)
TCACAGTGAACCGGTCTCTTTTTGGAATTCTCGGGTGCCAAGGAACTCCA150700.35231336859740003RNA PCR Primer, Index 1 (100% over 28bp)
AGCTACATTGTCTGCTGGGTTTTGGAATTCTCGGGTGCCAAGGAACTCCA149730.3500456581293212RNA PCR Primer, Index 1 (100% over 28bp)
CCTGTCTGAGGGTCGCTTGGAATTCTCGGGTGCCAAGGAACTCCAGTCAC135750.31736257323886563RNA PCR Primer, Index 1 (100% over 33bp)
TTGCGGCCCCGGGTTCCTCCCGGGGCTACGCCTGTCTGAGGGTCGCTTGG130140.3042472580575026No Hit
TGAGGTAGTTGGTTGTATTGTTTGGAATTCTCGGGTGCCAAGGAACTCCA128380.30013264937315337RNA PCR Primer, Index 1 (100% over 28bp)
AGCTGGTGTTGTGAATCAGGCCGTGGAATTCTCGGGTGCCAAGGAACTCC127000.29690642210928864RNA PCR Primer, Index 1 (100% over 27bp)
CCACGTTCCCGTGGTGGAATTCTCGGGTGCCCAGGAACTCCAGTCACCGA126980.2968596651924211RNA PCR Primer, Index 2 (97% over 36bp)
GGAATACCAGGTGCTGTAAGCTTTGGAATTCTCGGGTGCCAAGGAACTCC106100.24804544398264197RNA PCR Primer, Index 1 (100% over 27bp)
AGCTACATCTGGCTACTGGGTCTTGGAATTCTCGGGTGCCAAGGAACTCC101890.23820311298201122RNA PCR Primer, Index 1 (100% over 27bp)
TACCCTGTAGATCCGGATTTGTTGGAATTCTCGGGTGCCAAGGAACTCCA101670.23768878689646755RNA PCR Primer, Index 1 (100% over 28bp)
TGAGGTAGTAGGTTGTATAGTTGGAATTCTCGGGTGCCAAGGAACTCCAG100400.2347197226753747RNA PCR Primer, Index 1 (100% over 29bp)
AAGCTGCCAGCTGAAGAACTGTTGGAATTCTCGGGTGCCAAGGAACTCCA97780.2285945665657185RNA PCR Primer, Index 1 (100% over 28bp)
TCTTTGGTTATCTAGCTGTATGTTGGAATTCTCGGGTGCCAAGGAACTCC95220.22260968120666513RNA PCR Primer, Index 1 (100% over 27bp)
TCCCTGAGACCCTAACTTGTGTGGAATTCTCGGGTGCCAAGGAACTCCAG93950.21964061698557222RNA PCR Primer, Index 1 (100% over 29bp)
TACCCTGTAGAACCGAATTTGCGTGGAATTCTCGGGTGCCAAGGAACTCC91470.21384275929398924RNA PCR Primer, Index 1 (100% over 27bp)
CCCTGAGACCCTTAACCTGTGATGGAATTCTCGGGTGCCAAGGAACTCCA88580.20708638480662042RNA PCR Primer, Index 1 (100% over 28bp)
TAAAGGGAATTTGCGACTGTTTGGAATTCTCGGGTGCCAAGGAACTCCAG88360.20657205872107676RNA PCR Primer, Index 1 (100% over 29bp)
ACCATCGACCGTTGACTGTACCTGGAATTCTCGGGTGCCAAGGAACTCCA85180.19913770893912763RNA PCR Primer, Index 1 (100% over 28bp)
TAACAGTCTACAGTCATGGCTTGGAATTCTCGGGTGCCAAGGAACTCCAG83260.19464904491983762RNA PCR Primer, Index 1 (100% over 29bp)
TGAGATGAAGCACTGTAGCTCTGGAATTCTCGGGTGCCAAGGAACTCCAG83220.19455553108610238RNA PCR Primer, Index 1 (100% over 29bp)
TCCACCACGTTCCCGTGGTGGAATTCTCGGGTGCCAAGGAACTCCAGTCA83120.19432174650176437RNA PCR Primer, Index 1 (100% over 32bp)
CTTTGGTTATCTAGCTGTATGATGGAATTCTCGGGTGCCAAGGAACTCCA81870.1913994391975391RNA PCR Primer, Index 1 (100% over 28bp)
CACCACGTTCCCGTGGTGGAATTCTCGGGTGCCAAGGAACTCCAGTCACC80320.18777577814029972RNA PCR Primer, Index 2 (100% over 34bp)
TTCACAGTGGCTAAGTTCTGCTGGAATTCTCGGGTGCCAAGGAACTCCAG78510.18354427716378152RNA PCR Primer, Index 1 (100% over 29bp)
AGCAGCATTGTACAGGGCTATGATGGAATTCTCGGGTGCCAAGGAACTCC78150.18270265266016464RNA PCR Primer, Index 1 (100% over 27bp)
ACCATCGACCGTTGACTGTGCCTGGAATTCTCGGGTGCCAAGGAACTCCA75240.1758995212559282RNA PCR Primer, Index 1 (100% over 28bp)
TGTAAACATCCTTGACTGGAAGCTTGGAATTCTCGGGTGCCAAGGAACTC73550.1719485617806156RNA PCR Primer, Index 1 (100% over 26bp)
CAGGCTGGTTAGATGGTTGTCTTGGAATTCTCGGGTGCCAAGGAACTCCA72950.17054585427458746RNA PCR Primer, Index 1 (100% over 28bp)
TCCAGCATCAGTGATTTTGTTGTGGAATTCTCGGGTGCCAAGGAACTCCA72110.1685820637661481RNA PCR Primer, Index 1 (100% over 28bp)
GGAATCCCAGGTGCTGTAAGCTTTGGAATTCTCGGGTGCCAAGGAACTCC71880.16804435922217065RNA PCR Primer, Index 1 (100% over 27bp)
TACCCTGTAGAACCGAATGTGTTGGAATTCTCGGGTGCCAAGGAACTCCA71760.16776381772096502RNA PCR Primer, Index 1 (100% over 28bp)
TGGAATTCTCGGGTGCCAAGGAACTCCAGTCACCGATGGATCTCGTATGC70600.16505191654264395RNA PCR Primer, Index 2 (98% over 50bp)
AACCCGTAGATCCGAACTTGTGATGGAATTCTCGGGTGCCAAGGAACTCC68670.16053987406492012RNA PCR Primer, Index 1 (100% over 27bp)
CATTGCACTTGTCTCGGTCTGATGGAATTCTCGGGTGCCAAGGAACTCCA68510.1601658187299793RNA PCR Primer, Index 1 (100% over 28bp)
TAAAGCTAGAGAACCGAAAGTATTGGAATTCTCGGGTGCCAAGGAACTCC68500.16014244027154548RNA PCR Primer, Index 1 (100% over 27bp)
TACCCTGTAGAACCGAATTTGCTGGAATTCTCGGGTGCCAAGGAACTCCA67870.15866959739021594RNA PCR Primer, Index 1 (100% over 28bp)
TTCCCTTTGTCATCCTATGCCTTGGAATTCTCGGGTGCCAAGGAACTCCA67870.15866959739021594RNA PCR Primer, Index 1 (100% over 28bp)
CTTTTTGCGGTCTGGGCTTGCTGGAATTCTCGGGTGCCAAGGAACTCCAG67290.15731364680105542RNA PCR Primer, Index 1 (100% over 29bp)
TATGGCTTTTTATTCCTATCTGTGGAATTCTCGGGTGCCAAGGAACTCCA65780.15378349957755125RNA PCR Primer, Index 1 (100% over 28bp)
TGGAATTCTCGGGTGCCAAGGAACTCCAGTAACCGATGTATCTCGTATGC64030.14969226935163588RNA PCR Primer, Index 2 (98% over 50bp)
TCCAGCATCAGTGATTTTGTTTGGAATTCTCGGGTGCCAAGGAACTCCAG63940.14948186322573165RNA PCR Primer, Index 1 (100% over 29bp)
ACCACGTTCCCGTGGTGGAATTCTCGGGTGCCAAGGAACTCCAGTCACCG62510.14613874366969792RNA PCR Primer, Index 2 (100% over 35bp)
TGAGATGAAGCACTGTAGCTCTTGGAATTCTCGGGTGCCAAGGAACTCCA62280.14560103912572045RNA PCR Primer, Index 1 (100% over 28bp)
AACATTCATTGCTGTCGGTGGGTTTGGAATTCTCGGGTGCCAAGGAACTC61740.14433860237029514RNA PCR Primer, Index 1 (100% over 26bp)
CCACGTTCCCGTGGTGGAATTCTCGGGTGCCAAGGACCTCCAGTCACCGA61730.14431522391186136RNA PCR Primer, Index 2 (97% over 36bp)
ACCGTGGCTTTAGATTGTTACTTGGAATTCTCGGGTGCCAAGGAACTCCA61010.1426319749046276RNA PCR Primer, Index 1 (100% over 28bp)
CCCTGCGACCCTTAACCTGTGATGGAATTCTCGGGTGCCAAGGAACTCCA60200.1407383197714896RNA PCR Primer, Index 1 (100% over 28bp)
CTGGACAACTCTTAGCGGTGGAATTCTCGGGTGCCAAGGAACTCCAGTCA59610.13935899072389527RNA PCR Primer, Index 1 (100% over 32bp)
TAGCTTATCAGACTGGTGTTGGTGGAATTCTCGGGTGCCAAGGAACTCCA57910.13538465279014888RNA PCR Primer, Index 1 (100% over 28bp)
AACATTCAACGCTGTCGGTGAGTTGGAATTCTCGGGTGCCAAGGAAATCC57090.13346761919857708RNA PCR Primer, Index 1 (96% over 27bp)
CACCACGTTCCCGTGGTGGAATTCTCGGGTGCCAAGGAACTCCAGTCCCC56720.13260261623652642RNA PCR Primer, Index 2 (97% over 34bp)
TAAGGCACGCGGTGAATGCCATGGAATTCTCGGGTGCCAAGGAACTCCAG55260.12918936130519126RNA PCR Primer, Index 1 (100% over 29bp)
TGAGGTAGTAGGTTGTGTGGTTTGGAATTCTCGGGTGCCAAGGAACTCCA55180.12900233363772085RNA PCR Primer, Index 1 (100% over 28bp)
TTCACCGTGGCTAAGTTCTGCTGGAATTCTCGGGTGCCAAGGAACTCCAG55100.12881530597025045RNA PCR Primer, Index 1 (100% over 29bp)
CCACCACGTTCCCGTGGTGGAATTCTCGGGTGCCAAGGAACTCCAGTCAC54570.12757624767325892RNA PCR Primer, Index 1 (100% over 33bp)
TAAAGCTAGAGAACCGAAAGTAATGGAATTCTCGGGTGCCAAGGAACTCC54260.12685151546181106RNA PCR Primer, Index 1 (100% over 27bp)
TCCCTGAGACCCTTAACCTGTGTTGGAATTCTCGGGTGCCAAGGAACTCC53550.1251916449130111RNA PCR Primer, Index 1 (100% over 27bp)
TATGGCTTTTTATTCCTATCTGATGGAATTCTCGGGTGCCAAGGAACTCC53470.12500461724554068RNA PCR Primer, Index 1 (100% over 27bp)
AACATTCAACGATGTCGGTGAGTGGAATTCTCGGGTGCCAAGGAACTCCA52220.12208230994131539RNA PCR Primer, Index 1 (100% over 28bp)
TGTAACCATCCTTGACTGGAAGCTTGGAATTCTCGGGTGCCAAGGAACTC51090.11944054413829575RNA PCR Primer, Index 1 (100% over 26bp)
AACATTCAACGCTGTCGGTGAGTTTGGAATTCTCGGGTGCCAAGGAACTC50800.11876256884371549RNA PCR Primer, Index 1 (100% over 26bp)
TTCAAGTAATCCAGGATAGGCTGGAATTCTCGGGTGCCAAGGAACTCCAG49930.11672864295997469RNA PCR Primer, Index 1 (100% over 29bp)
TGAGGTAGTAGATTGAATAGTTTGGAATTCTCGGGTGCCAAGGAACTCCA48880.11427390482442543RNA PCR Primer, Index 1 (100% over 28bp)
TAGCAGCACGTAAATATTGGAGTGGAATTCTCGGGTGCCAAGGAACTCCA48480.11333876648707336RNA PCR Primer, Index 1 (100% over 28bp)
TACCCTGTAGATCCGGATTTGTGTGGAATTCTCGGGTGCCAAGGAACTCC48340.11301146806900011RNA PCR Primer, Index 1 (100% over 27bp)
TGGACAACTCTTAGCGGTGGAATTCTCGGGTGCCAAGGAACTCCAGTCAC47870.11191268052261141RNA PCR Primer, Index 1 (100% over 33bp)
AACATTCAACGCTGTCGGTGAGTTGGAATTATCGGGTGCCAAGGAACTCC46010.1075642872539242RNA PCR Primer, Index 1 (96% over 27bp)
CCTTGGCTTTAGACTGCTTACTTGGAATTCTCGGGTGCCAAGGAACTCCA45430.10620833666476366RNA PCR Primer, Index 1 (100% over 28bp)
AGAATAATGCCAGCAGTCGGTCTGGAATTCTCGGGTGCCAAGGAACTCCA45360.10604468745572704RNA PCR Primer, Index 1 (100% over 28bp)
TGTAAACATCCTACACTCTCAGCTTGGAATTCTCGGGTGCCAAGGAACTC44580.10422116769789047RNA PCR Primer, Index 1 (100% over 26bp)
AGCCTGTGATGATACAAGTTATCCCTGTCTGAACTCTGGTGTGGAATTCT43670.10209372798041447No Hit

[FAIL]Adapter Content

Adapter graph

[FAIL]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
CATTATT4100.044.090321
TAAATGC4600.044.090321
ATTGCCC750.044.090321
ACTTACA254.3913995E-544.0903171
TTATTGC2550.044.0903171
TTACAAT1950.044.0903171
AACATTC785650.044.0594561
CGTTGTA207.8587834E-444.0001234
TAATATA1750.043.9990913
GTTTAAA207.859688E-443.9990927
GCAAAAA351.4475518E-743.9990914
TAACGAT254.4454224E-543.9990914
TAGCAAT254.4454224E-543.9990914
CACTCTA1200.043.9990914
CACTCAG3900.043.9990914
ATATTAG551.8189894E-1243.9990914
GCCTTGC750.043.99857715
ATTCCTA19500.043.99857712
TGGCAAC750.043.99857711
CGTAGAG1150.043.99857715