FastQCFastQC Report
Mon 5 Dec 2016
JM103_3_TTAGGC_L007_R1_001.fastq

Summary

[OK]Basic Statistics

MeasureValue
FilenameJM103_3_TTAGGC_L007_R1_001.fastq
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences11281090
Sequences flagged as poor quality0
Sequence length50
%GC52

[OK]Per base sequence quality

Per base quality graph

[OK]Per tile sequence quality

Per base quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[FAIL]Per base sequence content

Per base sequence content

[FAIL]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[OK]Sequence Length Distribution

Sequence length distribution

[FAIL]Sequence Duplication Levels

Duplication level graph

[FAIL]Overrepresented sequences

SequenceCountPercentagePossible Source
TGGAATTCTCGGGTGCCAAGGAACTCCAGTCACTTAGGCATCTCGTATGC664228158.87978023400221RNA PCR Primer, Index 3 (100% over 50bp)
TGGAGTGTGACAATGGTGTTTGTGGAATTCTCGGGTGCCAAGGAACTCCA1888881.6743772100036431RNA PCR Primer, Index 1 (100% over 28bp)
GTTCTACAGTCCGACTGGAATTCTCGGGTGCCAAGGAACTCCAGTCACTT1182931.0485954814650003RNA PCR Primer, Index 1 (97% over 35bp)
CCGTCGAGCAGCATTCCGGGCTTCACATCGGAGGGCTCCAGCCGGCCCCG1025260.9088306183179108No Hit
CTACAGTCCGACGATCTGGAATTCTCGGGTGCCAAGGAACTCCAGTCACT797820.70721889462809RNA PCR Primer, Index 3 (100% over 34bp)
ACCACGTTCCCGTGGTGGAATTCTCGGGTGCCAAGGAACTCCAGTCACTT661250.5861578978627064RNA PCR Primer, Index 1 (97% over 35bp)
AGTTCTACAGTCCGACGATCTGGAATTCTCGGGTGCCAAGGAACTCCAGT651930.5778962848448155RNA PCR Primer, Index 1 (100% over 30bp)
TCTACAGTCCGACGATCTGGAATTCTCGGGTGCCAAGGAACTCCAGTCAC612300.5427667007354786RNA PCR Primer, Index 1 (100% over 33bp)
TGGAGTGTGACAATGGTGTTTTGGAATTCTCGGGTGCCAAGGAACTCCAG569830.505119629397514RNA PCR Primer, Index 1 (100% over 29bp)
AAGCTGCCAGCTGAAGAACTGTTGGAATTCTCGGGTGCCAAGGAACTCCA531090.4707789761450356RNA PCR Primer, Index 1 (100% over 28bp)
CACCACGTTCCCGTGGTGGAATTCTCGGGTGCCAAGGAACTCCAGTCACT513330.4550358165744622RNA PCR Primer, Index 3 (100% over 34bp)
ACAGTCCGACGATCTGGAATTCTCGGGTGCCAAGGAACTCCAGTCACTTA456340.4045176485605558RNA PCR Primer, Index 3 (100% over 36bp)
TTCAAGTAATCCAGGATAGGCTTGGAATTCTCGGGTGCCAAGGAACTCCA447730.3968854073498217RNA PCR Primer, Index 1 (100% over 28bp)
TTCTACAGTCCGACGATCTGGAATTCTCGGGTGCCAAGGAACTCCAGTCA436990.38736505071761684RNA PCR Primer, Index 1 (100% over 32bp)
ATGACCTATGAATTGACAGCCATGGAATTCTCGGGTGCCAAGGAACTCCA435890.3863899676361061RNA PCR Primer, Index 1 (100% over 28bp)
TGGAGTGTGACAATGGTGTTTGTTGGAATTCTCGGGTGCCAAGGAACTCC421090.3732706679939616RNA PCR Primer, Index 1 (100% over 27bp)
TTGCGGCCCCGGGTTCCTCCCGGGGCTACGCCTGTCTGAGGGTCGCTTGG419630.3719764668130473No Hit
ATGACCTATGAATTGACAGCCTGGAATTCTCGGGTGCCAAGGAACTCCAG395770.35082602833591436RNA PCR Primer, Index 1 (100% over 29bp)
GTTCTACAGTCCGACGTGGAATTCTCGGGTGCCAAGGAACTCCAGTCACT394370.3495850135049007RNA PCR Primer, Index 3 (100% over 34bp)
TATTGCACTTGTCCCGGCCTGTTGGAATTCTCGGGTGCCAAGGAACTCCA393050.3484149138070878RNA PCR Primer, Index 1 (100% over 28bp)
TAGCTTATCAGACTGGTGTTGGCTGGAATTCTCGGGTGCCAAGGAACTCC377730.33483466579913823RNA PCR Primer, Index 1 (100% over 27bp)
AACATTCAACGCTGTCGGTGAGTTGGAATTCTCGGGTGCCAAGGAACTCC375660.332999736727568RNA PCR Primer, Index 1 (100% over 27bp)
CAGAGTTCTACAGTCCGACGATCTGGAATTCTCGGGTGCCAAGGAACTCC357170.31660947656653743RNA PCR Primer, Index 1 (100% over 27bp)
GCATTGGTGGTTCAGTGGTAGAATTCTCGCCTTGGAATTCTCGGGTGCCA356050.3156166647017265No Hit
TACAGTCCGACGATCTGGAATTCTCGGGTGCCAAGGAACTCCAGTCACTT346680.30731072972558504RNA PCR Primer, Index 1 (97% over 35bp)
TAGTTCTACAGTCCGACGATCTGGAATTCTCGGGTGCCAAGGAACTCCAG345040.305856969494969RNA PCR Primer, Index 1 (100% over 29bp)
TGGAATTCTCGGGTGCCAAGGAAATCCAGTCACTTAGGCATCTCGTATGC318500.28233087405560986RNA PCR Primer, Index 3 (98% over 50bp)
AGAGTTCTACAGTCCGACGATCTGGAATTCTCGGGTGCCAAGGAACTCCA314690.27895354083692264RNA PCR Primer, Index 1 (100% over 28bp)
GGACAACTCTTAGCGGTGGAATTCTCGGGTGCCAAGGAACTCCAGTCACT310820.2755230212683349RNA PCR Primer, Index 3 (100% over 34bp)
TGGACAACTCTTAGCGGTGGAATTCTCGGGTGCCAAGGAACTCCAGTCAC302130.2678198649244RNA PCR Primer, Index 1 (100% over 33bp)
TCCCTGGTGGTCTAGTGGTTAGGATTCGGCGCTCTGGAATTCTCGGGTGC275120.2438771430774863No Hit
CATGGAATTCTCGGGTGCCAAGGAACTCCAGTCACTTAGGCATCTCGTAT272750.24177628225641318RNA PCR Primer, Index 3 (100% over 48bp)
CCTGTCTGAGGGTCGCTTGGAATTCTCGGGTGCCAAGGAACTCCAGTCAC271560.24072141965005156RNA PCR Primer, Index 1 (100% over 33bp)
GTTCTACAGTCCGACTGGAATTCTCGGGTGCCCAGGAACTCCAGTCACTT260590.23099718200989444RNA PCR Primer, Index 3 (97% over 35bp)
TGAGGTAGTAGGTTGTATAGTTTGGAATTCTCGGGTGCCAAGGAACTCCA232310.2059286824234183RNA PCR Primer, Index 1 (100% over 28bp)
AACATTCAACGCTGTCGGTGAGTGGAATTCTCGGGTGCCAAGGAACTCCA229910.20380122842739487RNA PCR Primer, Index 1 (100% over 28bp)
TGGAATTCTCGGGTGCCAAGGAACTCCAGTCACTTAGGGATCTCGTATGC226670.20092916553276324RNA PCR Primer, Index 3 (98% over 50bp)
TGGAATTCTCGGGTGCCAAGGAACTCCAGTCACTTAGGAATCTCGTATGC225590.19997181123455268RNA PCR Primer, Index 3 (98% over 50bp)
TGAATTCTCGGGTGCCAAGGAACTCCAGTCACTTAGGCATCTCGTATGCC182220.1615269446480792RNA PCR Primer, Index 3 (98% over 50bp)
GTTTCCGTAGTGTAGTGGTTATCACGTTCGCCTTGGAATTCTCGGGTGCC180820.16028592981706555No Hit
GCATTGGTGGTTCAGTGGTAGAATTCTCGCCTGCCACGCGGGAGGCCCGG177840.15764434110533646No Hit
GCATTGGTGGTTCAGTGGTAGAATTCTCGCCTGGAATTCTCGGGTGCCAA171430.15196226605762386No Hit
GATCCATGATGACATTAAAACATAACGTGACTGTTGGATGAAGCTTGCGG159940.14177708005166167No Hit
TGTAAACATCCTTGACTGGAAGCTTGGAATTCTCGGGTGCCAAGGAACTC156900.139082304990032RNA PCR Primer, Index 1 (100% over 26bp)
TGTAAACATCCTACACTCTCAGCTTGGAATTCTCGGGTGCCAAGGAACTC151140.13397641539957575RNA PCR Primer, Index 1 (100% over 26bp)
TGAGGTAGTAGTTTGTATAGTTTGGAATTCTCGGGTGCCAAGGAACTCCA149500.13252265516895972RNA PCR Primer, Index 1 (100% over 28bp)
ACCACGTTCCCGTGGTGGAATTCTCGGGTGCCCAGGAACTCCAGTCACTT143410.12712424065405029RNA PCR Primer, Index 3 (97% over 35bp)
CAGTCCGACGATCTGGAATTCTCGGGTGCCAAGGAACTCCAGTCACTTAG141780.12567934481508436RNA PCR Primer, Index 3 (100% over 37bp)
GGGAATTCTCGGGTGCCAAGGAACTCCAGTCACTTAGGCATCTCGTATGC141590.12551092137373251RNA PCR Primer, Index 3 (98% over 50bp)
TTCAAGTAATCCAGGATAGGTTTGGAATTCTCGGGTGCCAAGGAACTCCA133700.11851691636180547RNA PCR Primer, Index 1 (100% over 28bp)
TCCCTGTGGTCTAGTGGTTAGGATTCGGCGCTCTGGAATTCTCGGGTGCC133080.11796732407949942No Hit
AACTCTTAGCGGTGGATCACTCGGCTCGTGCGTCGATGAAGAACGCAGCT131530.11659334337373428No Hit
TGGACGTGATGAGCAGGTGTTACCGCCCCAGTCTGATGTTTGGTGACTGA126960.11254231638963966No Hit
TAGCAGCACGTAAATATTGGAGTGGAATTCTCGGGTGCCAAGGAACTCCA120270.10661203837572433RNA PCR Primer, Index 1 (100% over 28bp)
TGAGGTAGTAGTTTGTGCTGTTTGGAATTCTCGGGTGCCAAGGAACTCCA120040.1064081573677721RNA PCR Primer, Index 1 (100% over 28bp)
TGGAATTCTCGGGTGCCAAGGAACTCCAGTCACTTAGGCATCGTATGCCG114200.10123135264411506RNA PCR Primer, Index 3 (97% over 42bp)

[OK]Adapter Content

Adapter graph

[FAIL]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
TTGAGAG1200.044.0530851
TGCATAT1350.044.0530851
GTTGTCG1150.044.0530851
TGTATGC207.8472897E-444.0138244
CAGGTAT207.8572327E-444.00250617
GTATCAT207.8572327E-444.00250618
TATAAGC650.044.00250616
TAATCAT254.4438515E-544.00250218
CGTTAAT1100.044.00250216
GGCTATC1350.044.00250216
TCGCATA254.4450146E-544.00055341
TTTGCCG551.8189894E-1244.00055321
ACACTAT254.4450146E-544.00055341
TACACTA254.4450146E-544.00055340
TCGCGTA700.044.00055341
AATCATA254.4451306E-544.0003619
TTGCGTC302.5295667E-644.0003619
CATCGCA302.5297995E-643.9997839
TAGCAAT207.861007E-443.99821514
ATAAGGG207.8611786E-443.9980215