FastQCFastQC Report
Mon 5 Dec 2016
JM104_3_GCCAAT_L004_R1_001.fastq

Summary

[OK]Basic Statistics

MeasureValue
FilenameJM104_3_GCCAAT_L004_R1_001.fastq
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences13196782
Sequences flagged as poor quality0
Sequence length50
%GC52

[OK]Per base sequence quality

Per base quality graph

[OK]Per tile sequence quality

Per base quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[FAIL]Per base sequence content

Per base sequence content

[FAIL]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[OK]Sequence Length Distribution

Sequence length distribution

[FAIL]Sequence Duplication Levels

Duplication level graph

[FAIL]Overrepresented sequences

SequenceCountPercentagePossible Source
TGGAATTCTCGGGTGCCAAGGAACTCCAGTCACGCCAATATCTCGTATGC246406818.671733760548594RNA PCR Primer, Index 6 (100% over 50bp)
TTGCGGCCCCGGGTTCCTCCCGGGGCTACGCCTGTCTGAGGGTCGCTTGG3360112.54615860139237No Hit
TCAGTAACTGGAATCTGTCCCTTGGAATTCTCGGGTGCCAAGGAACTCCA2804982.125503020357539RNA PCR Primer, Index 1 (100% over 28bp)
TTCAAGTAATCCAGGATAGGCTTGGAATTCTCGGGTGCCAAGGAACTCCA2183701.6547215828828572RNA PCR Primer, Index 1 (100% over 28bp)
CCTGTCTGAGGGTCGCTTGGAATTCTCGGGTGCCAAGGAACTCCAGTCAC2081791.5774982113063625RNA PCR Primer, Index 1 (100% over 33bp)
ATGACCTATGAATTGACAGCCTGGAATTCTCGGGTGCCAAGGAACTCCAG1914781.4509446318049355RNA PCR Primer, Index 1 (100% over 29bp)
AAGCTGCCAGCTGAAGAACTGTTGGAATTCTCGGGTGCCAAGGAACTCCA1865641.413708281306761RNA PCR Primer, Index 1 (100% over 28bp)
TGAGGTAGTAGGTTGTATAGTTTGGAATTCTCGGGTGCCAAGGAACTCCA1768691.340243401762642RNA PCR Primer, Index 1 (100% over 28bp)
ATGACCTATGAATTGACAGCCATGGAATTCTCGGGTGCCAAGGAACTCCA1714481.2991652055781477RNA PCR Primer, Index 1 (100% over 28bp)
TGGAGTGTGACAATGGTGTTTGTGGAATTCTCGGGTGCCAAGGAACTCCA1545111.1708233113193807RNA PCR Primer, Index 1 (100% over 28bp)
GCATTGGTGGTTCAGTGGTAGAATTCTCGCCTTGGAATTCTCGGGTGCCA1238530.9385091001730574No Hit
TATTGCACTTGTCCCGGCCTGTTGGAATTCTCGGGTGCCAAGGAACTCCA1075720.8151381147313034RNA PCR Primer, Index 1 (100% over 28bp)
TCCCTGGTGGTCTAGTGGTTAGGATTCGGCGCTCTGGAATTCTCGGGTGC1033570.7831985100610135No Hit
ACCACGTTCCCGTGGTGGAATTCTCGGGTGCCAAGGAACTCCAGTCACGC985250.7465835231649655RNA PCR Primer, Index 5 (97% over 35bp)
TAGCTTATCAGACTGGTGTTGGCTGGAATTCTCGGGTGCCAAGGAACTCC980960.7433327306611566RNA PCR Primer, Index 1 (100% over 27bp)
TCAGTAACTGGAATCTGTCCCTGTGGAATTCTCGGGTGCCAAGGAACTCC931480.7058387415962467RNA PCR Primer, Index 1 (100% over 27bp)
AACATTCAACGCTGTCGGTGAGTTGGAATTCTCGGGTGCCAAGGAACTCC919450.6967228828967548RNA PCR Primer, Index 1 (100% over 27bp)
CATGGAATTCTCGGGTGCCAAGGAACTCCAGTCACGCCAATATCTCGTAT844370.6398302252776472RNA PCR Primer, Index 6 (100% over 48bp)
AACATTCAACGCTGTCGGTGAGTGGAATTCTCGGGTGCCAAGGAACTCCA826040.6259404754886457RNA PCR Primer, Index 1 (100% over 28bp)
GATCCATGATGACATTAAAACATAACGTGACTGTTGGATGAAGCTTGCGG693510.5255144776961534No Hit
TCAGTAACTGGAATCTGTCCCTGCTGGAATTCTCGGGTGCCAAGGAACTC692890.5250446661921065RNA PCR Primer, Index 1 (100% over 26bp)
CCGTCGAGCAGCATTCCGGGCTTCACATCGGAGGGCTCCAGCCGGCCCCG680460.5156257032964551No Hit
ATCCATGATGACATTAAAACATAACGTGACTGTTGGATGAAGCTTGCGGA656210.49725001140429537No Hit
TGAGATGAAGCACTGTAGCTCTTGGAATTCTCGGGTGCCAAGGAACTCCA628080.4759342088093901RNA PCR Primer, Index 1 (100% over 28bp)
TGAGATGAAGCACTGTAGCTCTGGAATTCTCGGGTGCCAAGGAACTCCAG613840.4651436994261177RNA PCR Primer, Index 1 (100% over 29bp)
TGGAGTGTGACAATGGTGTTTGTTGGAATTCTCGGGTGCCAAGGAACTCC597040.45241332318742555RNA PCR Primer, Index 1 (100% over 27bp)
TCCCTGTGGTCTAGTGGTTAGGATTCGGCGCTCTGGAATTCTCGGGTGCC596610.4520874861765543No Hit
CCACGTTCCCGTGGTGGAATTCTCGGGTGCCAAGGAACTCCAGTCACGCC596220.4517919595852989RNA PCR Primer, Index 6 (100% over 36bp)
TGGAGTGTGACAATGGTGTTTTGGAATTCTCGGGTGCCAAGGAACTCCAG568900.43108994298761627RNA PCR Primer, Index 1 (100% over 29bp)
TTCAAGTAATCCAGGATAGGTTTGGAATTCTCGGGTGCCAAGGAACTCCA566190.4290364120586367RNA PCR Primer, Index 1 (100% over 28bp)
CTACGCCTGTCTGAGGGTCGCTTGGAATTCTCGGGTGCCAAGGAACTCCA525440.3981576720749043RNA PCR Primer, Index 1 (100% over 28bp)
TGAGGTAGTAGTTTGTATAGTTTGGAATTCTCGGGTGCCAAGGAACTCCA525220.3979909647670167RNA PCR Primer, Index 1 (100% over 28bp)
TCCCTGGTGGTCTAGTGGTTAGGATTCGGCGCTTGGAATTCTCGGGTGCC516540.39141360371035905No Hit
GGACAACTCTTAGCGGTGGAATTCTCGGGTGCCAAGGAACTCCAGTCACG500980.3796228504797609RNA PCR Primer, Index 6 (100% over 34bp)
TGTCTGAGGGTCGCTTGGAATTCTCGGGTGCCAAGGAACTCCAGTCACGC494280.374545855194092RNA PCR Primer, Index 5 (97% over 35bp)
CACCACGTTCCCGTGGTGGAATTCTCGGGTGCCAAGGAACTCCAGTCACG480700.36425546773448253RNA PCR Primer, Index 6 (100% over 34bp)
CTGTCTGAGGGTCGCTTGGAATTCTCGGGTGCCAAGGAACTCCAGTCACG479580.3634067759852364RNA PCR Primer, Index 6 (100% over 34bp)
TTTGTTCGTTCGGCTCGCGTTATGGAATTCTCGGGTGCCAAGGAACTCCA459300.34803939323995803RNA PCR Primer, Index 1 (100% over 28bp)
TTCAGTGATGTTTGACAAATGTCTGACCTGAACTGCAATGTGGACAGATC440240.3335964782929657No Hit
AGAGATGATGACTTCTGTTACCGCCCCAGTCTGAGAAGTCATGACTGATC406020.30766591431153445No Hit
GCATTGGTGGTTCAGTGGTAGAATTCTCGCCTGCTGGAATTCTCGGGTGC392720.2975876997892365No Hit
GCATTGGTGGTTCAGTGGTAGAATTCTCGCCTGTGGAATTCTCGGGTGCC389640.2952537974788096No Hit
GCATTGTGGTTCAGTGGTAGAATTCTCGCCTTGGAATTCTCGGGTGCCAA389270.2949734260973622No Hit
TGTAAACATCCTACACTCTCAGCTTGGAATTCTCGGGTGCCAAGGAACTC374180.28353882029725125RNA PCR Primer, Index 1 (100% over 26bp)
CCTGTCTGAGGGTCGCTTGGAATTCTCGGGTGCCCAGGAACTCCAGTCAC357940.2712327899331822RNA PCR Primer, Index 1 (96% over 33bp)
GCCCGGCTAGCTCAGTCGGTAGAGCATGAGACTCTGGAATTCTCGGGTGC347740.2635036329311191No Hit
AGCCTGTGATGATACAAGTTATCCCTGTCTGAACTCTGGTGTGGAATTCT347700.2634733225115032No Hit
TAGCAGCACGTAAATATTGGAGTGGAATTCTCGGGTGCCAAGGAACTCCA338440.25645646037041453RNA PCR Primer, Index 1 (100% over 28bp)
GTTTCCGTAGTGTAGTGGTTATCACGTTCGCCTCTGGAATTCTCGGGTGC313660.23767915541834367No Hit
TGGACAACTCTTAGCGGTGGAATTCTCGGGTGCCAAGGAACTCCAGTCAC310740.23546649478638051RNA PCR Primer, Index 1 (100% over 33bp)
GTTTCCGTAGTGTAGTGGTTATCACGTTCGCCTTGGAATTCTCGGGTGCC310000.23490575202348574No Hit
TCCCTGTGGTCTAGTGGTTAGGATTCGGCGCTTGGAATTCTCGGGTGCCA306240.23205657257958798No Hit
TGAGGTAGTAGATTGAATAGTTTGGAATTCTCGGGTGCCAAGGAACTCCA301180.22822230449817235RNA PCR Primer, Index 1 (100% over 28bp)
TTGCGGCCCCGGGTTCCTCCCGGGGCTACGCCTGTCTGAGGGTCGCTTTG292750.22183438356411433No Hit
TGTAAACATCCTTGACTGGAAGCTTGGAATTCTCGGGTGCCAAGGAACTC266740.2021250332088535RNA PCR Primer, Index 1 (100% over 26bp)
CCTGTCTGAGGGTCGCTTTGGAATTCTCGGGTGCCAAGGAACTCCAGTCA261150.19788915206752677RNA PCR Primer, Index 1 (100% over 32bp)
AACATTCAACGCTGTCGGTGATGGAATTCTCGGGTGCCAAGGAACTCCAG259220.19642667432105795RNA PCR Primer, Index 1 (100% over 29bp)
CTGGACAACTCTTAGCGGTGGAATTCTCGGGTGCCAAGGAACTCCAGTCA256450.19432767776265458RNA PCR Primer, Index 1 (100% over 32bp)
GCCCGGCTAGCTCAGTCGGTAGAGCATGAGACTTGGAATTCTCGGGTGCC252290.1911753941225975No Hit
TGGACGTGATGAGCAGGTGTTACCGCCCCAGTCTGATGTTTGGTGACTGA250110.18952347625352908No Hit
TCGCTGCGATCCATTGAAAGTCAGCCCTCGATCCAAGTTTTTGTTGGAAT248000.1879246016187886No Hit
GTTCTACAGTCCGACTGGAATTCTCGGGTGCCAAGGAACTCCAGTCACGC245390.18594684673884893RNA PCR Primer, Index 5 (97% over 35bp)
GTCGCTTGGAATTCTCGGGTGCCAAGGAACTCCAGTCACGCCAATATCTC241530.1830218912459113RNA PCR Primer, Index 6 (100% over 44bp)
TAGCTTATCAGACTGGTGTTGGTGGAATTCTCGGGTGCCAAGGAACTCCA232180.17593683066068683RNA PCR Primer, Index 1 (100% over 28bp)
CCTTGCGGCCCCGGGTTCCTCCCGGGGCTACGCCTGTCTGAGGGTCGCTT225410.17080679214069006No Hit
TGAGGTAGTAGGTTGTATAGTTGGAATTCTCGGGTGCCAAGGAACTCCAG220090.16677550633177088RNA PCR Primer, Index 1 (100% over 29bp)
TTTGTTCGTTCGGCTCGCGTTTGGAATTCTCGGGTGCCAAGGAACTCCAG219460.16629811722281992RNA PCR Primer, Index 1 (100% over 29bp)
TGTAACAGCAACTCCATGTGGATGGAATTCTCGGGTGCCAAGGAACTCCA219420.166267806803204RNA PCR Primer, Index 1 (100% over 28bp)
CATTATTACTTTTGGTACGCGTGGAATTCTCGGGTGCCAAGGAACTCCAG218610.16565402080598132RNA PCR Primer, Index 1 (100% over 29bp)
CTACAGTCCGACGATCTGGAATTCTCGGGTGCCAAGGAACTCCAGTCACG214560.16258509081986805RNA PCR Primer, Index 6 (100% over 34bp)
TATTGCACTTGTCCCGGCCTGTTTGGAATTCTCGGGTGCCAAGGAACTCC211190.16003143796722566RNA PCR Primer, Index 1 (100% over 27bp)
TCCCTGGTGGTCTAGTGGTTAGGATTCGGCGCTCTTGGAATTCTCGGGTG209910.15906150453951579No Hit
ACAGTAGTCTGCACATTGGTTTGGAATTCTCGGGTGCCAAGGAACTCCAG206450.1564396532427375RNA PCR Primer, Index 1 (100% over 29bp)
TGAGAACTGAATTCCATAGATGGTGGAATTCTCGGGTGCCAAGGAACTCC203440.15415879416663852RNA PCR Primer, Index 1 (100% over 27bp)
TAAGATGATGATTAACTCACCATCTTTCGGCTGAAGAATGATGTATACTC197210.14943794631145682No Hit
TGAGGTAGTAGGTTGTATAGTTTTGGAATTCTCGGGTGCCAAGGAACTCC196490.14889235875837004RNA PCR Primer, Index 1 (100% over 27bp)
CATTGCACTTGTCTCGGTCTGATGGAATTCTCGGGTGCCAAGGAACTCCA194830.1476344763443088RNA PCR Primer, Index 1 (100% over 28bp)
TGTAAACATCCTACACTCAGCTTGGAATTCTCGGGTGCCAAGGAACTCCA192020.14550516936628943RNA PCR Primer, Index 1 (100% over 28bp)
CTTGCGGCCCCGGGTTCCTCCCGGGGCTACGCCTGTCTGAGGGTCGCTTG188610.14292120609403108No Hit
TTACATGATGAAACATGTGTTGGTAGGGACATCTGAATGAATGTGATGAA187400.1420043159006491No Hit
TGCCTGTGATGAGACTCTCGACGGGCGGACTGAATGGGTTTTCACCCTCC187030.14172394451920173No Hit
CTTCGAACGCACCTTGCGGCCCCGGGTTCCTCCCGGGGCTACGCCTGTCT184830.1400568714403254No Hit
AAATCTCAGCTGGCGACTGTGTGGAATTCTCGGGTGCCAAGGAACTCCAG184500.13980681047849394RNA PCR Primer, Index 1 (100% over 29bp)
CTCGCTGCGATCCATTGAAAGTCAGCCCTCGATCCAAGTTTTTGTTGGAA177510.13451006465060952No Hit
TGGCTGTGATGAGAAACTTGCCCTCACTGAAACGTGATTGAGACATCTTT176810.1339796323073307No Hit
CTCCCGGGGCTACGCCTGTCTGAGGGTCGCTTGGAATTCTCGGGTGCCAA171720.13012263141120312No Hit
TCACAGTGAACCGGTCTCTTTTGGAATTCTCGGGTGCCAAGGAACTCCAG170370.12909965474916535RNA PCR Primer, Index 1 (100% over 29bp)
TACGCCTGTCTGAGGGTCGCTTGGAATTCTCGGGTGCCAAGGAACTCCAG169060.1281069885067435RNA PCR Primer, Index 1 (100% over 29bp)
TAACACTGTCTGGTAACGATGTTGGAATTCTCGGGTGCCAAGGAACTCCA166270.12599283673853215RNA PCR Primer, Index 1 (100% over 28bp)
GCATTGGTGGTTCAGTGGTAGAATTCTCGCCTGGAATTCTCGGGTGCCAA164550.12468948869504702No Hit
GTTACATGATGAAACATGTGTTGGTAGGGACATCTGAATGAATGTGATGA164060.12431818605475184No Hit
AGTTCTACAGTCCGACGATCTGGAATTCTCGGGTGCCAAGGAACTCCAGT162240.12293906196222686RNA PCR Primer, Index 1 (100% over 30bp)
TGAGGTAGTAGTTTGTGCTGTTTGGAATTCTCGGGTGCCAAGGAACTCCA161970.12273446662981931RNA PCR Primer, Index 1 (100% over 28bp)
TTCACAGTGGCTAAGTTCTGTGGAATTCTCGGGTGCCAAGGAACTCCAGT160120.12133260972258238RNA PCR Primer, Index 1 (100% over 30bp)
TGAGATGAAGCACTGTAGCTTGGAATTCTCGGGTGCCAAGGAACTCCAGT155190.11759685050491855RNA PCR Primer, Index 1 (100% over 30bp)
ACAGTCCGACGATCTGGAATTCTCGGGTGCCAAGGAACTCCAGTCACGCC153980.11667996031153656RNA PCR Primer, Index 6 (100% over 36bp)
ACTGGACAACTCTTAGCGGTGGAATTCTCGGGTGCCAAGGAACTCCAGTC152800.1157858029328665RNA PCR Primer, Index 1 (100% over 31bp)
TCCTCCCGGGGCTACGCCTGTCTGAGGGTCGCTTGGAATTCTCGGGTGCC152310.11541450029257133No Hit
TCTACAGTCCGACGATCTGGAATTCTCGGGTGCCAAGGAACTCCAGTCAC151650.11491437836890842RNA PCR Primer, Index 1 (100% over 33bp)
TTCACAGTGGCTAAGTTCTGCTGGAATTCTCGGGTGCCAAGGAACTCCAG150330.11391413452158261RNA PCR Primer, Index 1 (100% over 29bp)
TAACGGAACCCATAATGCAGCTGTGGAATTCTCGGGTGCCAAGGAACTCC147160.11151203376701987RNA PCR Primer, Index 1 (100% over 27bp)
TGTAAACATCCCCGACTGGAAGCTGGAATTCTCGGGTGCCAAGGAACTCC146270.11083762693056534RNA PCR Primer, Index 1 (100% over 27bp)
GCATTGTGGTTCAGTGGTAGAATTCTCGCCTGTGGAATTCTCGGGTGCCA143610.10882198402610577No Hit
TGTAAACATCCCCGACTGGAAGCTTGGAATTCTCGGGTGCCAAGGAACTC143230.10853403503975438RNA PCR Primer, Index 1 (100% over 26bp)
GCATTGTGGTTCAGTGGTAGAATTCTCGCCTGCTGGAATTCTCGGGTGCC141900.1075262135875246No Hit
GCATTGGTGGTTCAGTGGTAGAATTCTCGCCTGCCACGCGGGAGGCCCGG136370.10333579807562177No Hit
GCGGCCCCGGGTTCCTCCCGGGGCTACGCCTGTCTGAGGGTCGCTTGGAA133540.10119133588779447No Hit
TTTGTTGGAATTCTCGGGTGCCAAGGAACTCCAGTCACGCCAATATCTCG133050.10082003324749927RNA PCR Primer, Index 6 (100% over 45bp)

[WARN]Adapter Content

Adapter graph

[WARN]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
CTAGATC207.856938E-444.002936
CACGAAG207.862071E-443.9970622
GCACGAA207.8625116E-443.99656321
CAGCGCG254.4483342E-543.99505630
AGCGCGA254.4486325E-543.9945631
TTGGGCA254.4490305E-543.99389312
GTATCTA2200.043.993898
ATTAGGT800.043.99289316
ATAGGCG1950.043.99289316
CGGCCTA408.336428E-943.99289315
GTCTCAC207.865739E-443.9928934
ATAGATA1700.043.99289316
TCGATAG800.043.9928934
CATTACA16200.043.9928937
TACGCGA408.336428E-943.99289316
TTATTAG207.865739E-443.9928933
CTAGGTA800.043.99289316
TCGCGTA254.449628E-543.99289315
TACGTGC254.449628E-543.99289316
TGCGTAG207.865739E-443.9928934