FastQCFastQC Report
Mon 5 Dec 2016
JM106_3_ACTTGA_L007_R1_001.fastq

Summary

[OK]Basic Statistics

MeasureValue
FilenameJM106_3_ACTTGA_L007_R1_001.fastq
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences12340239
Sequences flagged as poor quality0
Sequence length50
%GC52

[OK]Per base sequence quality

Per base quality graph

[OK]Per tile sequence quality

Per base quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[FAIL]Per base sequence content

Per base sequence content

[FAIL]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[OK]Sequence Length Distribution

Sequence length distribution

[FAIL]Sequence Duplication Levels

Duplication level graph

[FAIL]Overrepresented sequences

SequenceCountPercentagePossible Source
CCTGTCTGAGGGTCGCTTGGAATTCTCGGGTGCCAAGGAACTCCAGTCAC4665893.7810369799158674RNA PCR Primer, Index 1 (100% over 33bp)
ATGACCTATGAATTGACAGCCTGGAATTCTCGGGTGCCAAGGAACTCCAG4136843.3523175685657303RNA PCR Primer, Index 1 (100% over 29bp)
TTCAAGTAATCCAGGATAGGCTTGGAATTCTCGGGTGCCAAGGAACTCCA4132003.3483954403152163RNA PCR Primer, Index 1 (100% over 28bp)
TTGCGGCCCCGGGTTCCTCCCGGGGCTACGCCTGTCTGAGGGTCGCTTGG3871153.137013796896478No Hit
TGAGGTAGTAGGTTGTATAGTTTGGAATTCTCGGGTGCCAAGGAACTCCA3694402.9937831836158115RNA PCR Primer, Index 1 (100% over 28bp)
ATGACCTATGAATTGACAGCCATGGAATTCTCGGGTGCCAAGGAACTCCA3554822.880673542870604RNA PCR Primer, Index 1 (100% over 28bp)
AAGCTGCCAGCTGAAGAACTGTTGGAATTCTCGGGTGCCAAGGAACTCCA2816122.2820627704212213RNA PCR Primer, Index 1 (100% over 28bp)
TCAGTAACTGGAATCTGTCCCTTGGAATTCTCGGGTGCCAAGGAACTCCA2800982.2697939642822154RNA PCR Primer, Index 1 (100% over 28bp)
TATTGCACTTGTCCCGGCCTGTTGGAATTCTCGGGTGCCAAGGAACTCCA1701921.3791629157263485RNA PCR Primer, Index 1 (100% over 28bp)
AACATTCAACGCTGTCGGTGAGTGGAATTCTCGGGTGCCAAGGAACTCCA1488581.2062813370146235RNA PCR Primer, Index 1 (100% over 28bp)
AACATTCAACGCTGTCGGTGAGTTGGAATTCTCGGGTGCCAAGGAACTCC1449721.1747908610197906RNA PCR Primer, Index 1 (100% over 27bp)
CTACGCCTGTCTGAGGGTCGCTTGGAATTCTCGGGTGCCAAGGAACTCCA1353511.096826406684668RNA PCR Primer, Index 1 (100% over 28bp)
TAGCTTATCAGACTGGTGTTGGCTGGAATTCTCGGGTGCCAAGGAACTCC1173830.9512214471697024RNA PCR Primer, Index 1 (100% over 27bp)
TGAGGTAGTAGTTTGTATAGTTTGGAATTCTCGGGTGCCAAGGAACTCCA1144500.9274536741144155RNA PCR Primer, Index 1 (100% over 28bp)
CTGTCTGAGGGTCGCTTGGAATTCTCGGGTGCCAAGGAACTCCAGTCACA1123340.910306518374563RNA PCR Primer, Index 1 (100% over 34bp)
TGGAATTCTCGGGTGCCAAGGAACTCCAGTCACACTTGAATCTCGTATGC1100650.8919195163075853RNA PCR Primer, Index 8 (100% over 50bp)
ATCCATGATGACATTAAAACATAACGTGACTGTTGGATGAAGCTTGCGGA822480.6665024883229571No Hit
CCGTCGAGCAGCATTCCGGGCTTCACATCGGAGGGCTCCAGCCGGCCCCG757730.6140318676161782No Hit
GATCCATGATGACATTAAAACATAACGTGACTGTTGGATGAAGCTTGCGG747590.6058148468599353No Hit
TGTCTGAGGGTCGCTTGGAATTCTCGGGTGCCAAGGAACTCCAGTCACAC692300.5610102040973437RNA PCR Primer, Index 5 (100% over 35bp)
TTCAGTGATGTTTGACAAATGTCTGACCTGAACTGCAATGTGGACAGATC669930.5428825162948627No Hit
GTTTCCGTAGTGTAGTGGTTATCACGTTCGCCTTGGAATTCTCGGGTGCC651600.5280286710816541No Hit
TTTGTTCGTTCGGCTCGCGTTATGGAATTCTCGGGTGCCAAGGAACTCCA601090.48709753514498383RNA PCR Primer, Index 1 (100% over 28bp)
CTTCGAACGCACCTTGCGGCCCCGGGTTCCTCCCGGGGCTACGCCTGTCT567030.4594967731176033No Hit
TTCAAGTAATCCAGGATAGGTTTGGAATTCTCGGGTGCCAAGGAACTCCA559970.4537756521571422RNA PCR Primer, Index 1 (100% over 28bp)
TGTAAACATCCTACACTCTCAGCTTGGAATTCTCGGGTGCCAAGGAACTC552490.447714181224529RNA PCR Primer, Index 1 (100% over 26bp)
TGAGATGAAGCACTGTAGCTCTGGAATTCTCGGGTGCCAAGGAACTCCAG496280.402164009951509RNA PCR Primer, Index 1 (100% over 29bp)
AGAGATGATGACTTCTGTTACCGCCCCAGTCTGAGAAGTCATGACTGATC495460.40149951714873594No Hit
TGAGGTAGTAGATTGAATAGTTTGGAATTCTCGGGTGCCAAGGAACTCCA494230.4005027779445763RNA PCR Primer, Index 1 (100% over 28bp)
TCAGTAACTGGAATCTGTCCCTGTGGAATTCTCGGGTGCCAAGGAACTCC479820.38882553247145374RNA PCR Primer, Index 1 (100% over 27bp)
GCATTGGTGGTTCAGTGGTAGAATTCTCGCCTTGGAATTCTCGGGTGCCA462890.37510618716541877No Hit
AACCCGTAGATCCGAACTTGTGTGGAATTCTCGGGTGCCAAGGAACTCCA460040.37279666949724394RNA PCR Primer, Index 1 (100% over 28bp)
CCTGTCTGAGGGTCGCTTTGGAATTCTCGGGTGCCAAGGAACTCCAGTCA452980.3670755485367828RNA PCR Primer, Index 1 (100% over 32bp)
TCAGTAACTGGAATCTGTCCCTGCTGGAATTCTCGGGTGCCAAGGAACTC449530.3642798166226764RNA PCR Primer, Index 1 (100% over 26bp)
TGGAGTGTGACAATGGTGTTTGTGGAATTCTCGGGTGCCAAGGAACTCCA432130.35017960349066174RNA PCR Primer, Index 1 (100% over 28bp)
CTGGACAACTCTTAGCGGTGGAATTCTCGGGTGCCAAGGAACTCCAGTCA426150.34533366817287736RNA PCR Primer, Index 1 (100% over 32bp)
TGTAAACATCCTTGACTGGAAGCTTGGAATTCTCGGGTGCCAAGGAACTC423130.3428863898016886RNA PCR Primer, Index 1 (100% over 26bp)
CTCCCGGGGCTACGCCTGTCTGAGGGTCGCTTGGAATTCTCGGGTGCCAA396200.3210634737301279No Hit
TGAGGTAGTAGGTTGTATAGTTGGAATTCTCGGGTGCCAAGGAACTCCAG393850.3191591346002294RNA PCR Primer, Index 1 (100% over 29bp)
TGAGGTAGTAGGTTGTATAGTTTTGGAATTCTCGGGTGCCAAGGAACTCC392910.31839739894826996RNA PCR Primer, Index 1 (100% over 27bp)
TTGCGGCCCCGGGTTCCTCCCGGGGCTACGCCTGTCTGAGGGTCGCTTTG377800.30615290352156066No Hit
TGAGATGAAGCACTGTAGCTCTTGGAATTCTCGGGTGCCAAGGAACTCCA374910.3038109715703237RNA PCR Primer, Index 1 (100% over 28bp)
TCGCTGCGATCCATTGAAAGTCAGCCCTCGATCCAAGTTTTTGTTGGAAT371410.3009747218023897No Hit
ACAGTAGTCTGCACATTGGTTTGGAATTCTCGGGTGCCAAGGAACTCCAG364360.2952617044126941RNA PCR Primer, Index 1 (100% over 29bp)
GGACAACTCTTAGCGGTGGAATTCTCGGGTGCCAAGGAACTCCAGTCACA355060.2877253836007552RNA PCR Primer, Index 1 (100% over 34bp)
TGAGGTAGTAGTTTGTGCTGTTTGGAATTCTCGGGTGCCAAGGAACTCCA345440.2799297485243195RNA PCR Primer, Index 1 (100% over 28bp)
TTTGTTCGTTCGGCTCGCGTTTGGAATTCTCGGGTGCCAAGGAACTCCAG344850.2794516378491535RNA PCR Primer, Index 1 (100% over 29bp)
TTCACAGTGGCTAAGTTCTGCTGGAATTCTCGGGTGCCAAGGAACTCCAG335620.27197204203257325RNA PCR Primer, Index 1 (100% over 29bp)
TTCACAGTGGCTAAGTTCTGTGGAATTCTCGGGTGCCAAGGAACTCCAGT330200.26757990667765835RNA PCR Primer, Index 1 (100% over 30bp)
GTTTCCGTAGTGTAGTGGTTATCACGTTCGCCTCTGGAATTCTCGGGTGC329540.26704507100713365No Hit
TACGCCTGTCTGAGGGTCGCTTGGAATTCTCGGGTGCCAAGGAACTCCAG321590.26060273224854075RNA PCR Primer, Index 1 (100% over 29bp)
CCACGTTCCCGTGGTGGAATTCTCGGGTGCCAAGGAACTCCAGTCACACT316500.25647801472888815RNA PCR Primer, Index 8 (100% over 36bp)
AACATTCAACGCTGTCGGTGATGGAATTCTCGGGTGCCAAGGAACTCCAG312270.25305020429507075RNA PCR Primer, Index 1 (100% over 29bp)
TATTGCACTTGTCCCGGCCTGTTTGGAATTCTCGGGTGCCAAGGAACTCC301660.24445231571284803RNA PCR Primer, Index 1 (100% over 27bp)
CATTGCACTTGTCTCGGTCTGATGGAATTCTCGGGTGCCAAGGAACTCCA293500.23783980196817908RNA PCR Primer, Index 1 (100% over 28bp)
TAAGATGATGATTAACTCACCATCTTTCGGCTGAAGAATGATGTATACTC284000.23014140974092967No Hit
TCCCTGGTGGTCTAGTGGTTAGGATTCGGCGCTCTGGAATTCTCGGGTGC283810.22998744189638465No Hit
CTCGCTGCGATCCATTGAAAGTCAGCCCTCGATCCAAGTTTTTGTTGGAA283010.2293391562351426No Hit
TGCCTGTGATGAGACTCTCGACGGGCGGACTGAATGGGTTTTCACCCTCC257050.20830228652783792No Hit
ATGACCTATGAATTGACAGCCATTGGAATTCTCGGGTGCCAAGGAACTCC238110.19295412349793226RNA PCR Primer, Index 1 (100% over 27bp)
TTACATGATGAAACATGTGTTGGTAGGGACATCTGAATGAATGTGATGAA236380.1915522057554963No Hit
ACTGGACAACTCTTAGCGGTGGAATTCTCGGGTGCCAAGGAACTCCAGTC235940.19119564864181318RNA PCR Primer, Index 1 (100% over 31bp)
GTTACATGATGAAACATGTGTTGGTAGGGACATCTGAATGAATGTGATGA235280.19066081297128848No Hit
AACTCTTAGCGGTGGATCACTCGGCTCGTGCGTCGATGAAGAACGCAGCT227510.18436433848647502No Hit
CTTGCGGCCCCGGGTTCCTCCCGGGGCTACGCCTGTCTGAGGGTCGCTTG225870.18303535288092881No Hit
AGCCTGTGATGATACAAGTTATCCCTGTCTGAACTCTGGTGTGGAATTCT222730.18049083166055374No Hit
TTCACAGTGGTTAAGTTCTGTGGAATTCTCGGGTGCCAAGGAACTCCAGT222540.18033686381600875RNA PCR Primer, Index 1 (100% over 30bp)
TATTGCACTTGTCCCGGCCTGTATGGAATTCTCGGGTGCCAAGGAACTCC218920.17740337119888844RNA PCR Primer, Index 1 (100% over 27bp)
TTCAAGTAATCCAGGATAGGCTGGAATTCTCGGGTGCCAAGGAACTCCAG218220.17683612124530165RNA PCR Primer, Index 1 (100% over 29bp)
TCACAGTGAACCGGTCTCTTTTGGAATTCTCGGGTGCCAAGGAACTCCAG215990.17502902496458944RNA PCR Primer, Index 1 (100% over 29bp)
TGGCTGTGATGAGAAACTTGCCCTCACTGAAACGTGATTGAGACATCTTT209760.1699805003776669No Hit
TACACTGATGACTTCTTAGGACACCTTTGGATTCTTGATGAAAACAAATT208060.16860289334752754No Hit
TCGTACCGTGAGTAATAATGCATGGAATTCTCGGGTGCCAAGGAACTCCA206180.1670794220436087RNA PCR Primer, Index 1 (100% over 28bp)
AAGCTGCCAGCTGAAGAACTTGGAATTCTCGGGTGCCAAGGAACTCCAGT201850.16357057590213608RNA PCR Primer, Index 1 (100% over 30bp)
TTCCAGTGATGACAGCCTATAATCTGACTTGGAATTCTCGGGTGCCAAGG199940.1620227938859207Illumina Small RNA Adapter 2 (100% over 21bp)
TAACGGAACCCATAATGCAGCTGTGGAATTCTCGGGTGCCAAGGAACTCC196570.15929189053793852RNA PCR Primer, Index 1 (100% over 27bp)
TTCAAGTAATCCAGGATAGGCTTTGGAATTCTCGGGTGCCAAGGAACTCC195690.15857877631057227RNA PCR Primer, Index 1 (100% over 27bp)
AACTGGACAACTCTTAGCGGTGGAATTCTCGGGTGCCAAGGAACTCCAGT194680.15776031566325416RNA PCR Primer, Index 1 (100% over 30bp)
CGCTGCGATCCATTGAAAGTCAGCCCTCGATCCAAGTTTTTGTTGGAATT190830.15464044091852677No Hit
TGTAAACATCCCCGACTGGAAGCTTGGAATTCTCGGGTGCCAAGGAACTC190730.15455940521087153RNA PCR Primer, Index 1 (100% over 26bp)
CATTATTACTTTTGGTACGCGTGGAATTCTCGGGTGCCAAGGAACTCCAG180690.14642342016228374RNA PCR Primer, Index 1 (100% over 29bp)
CCTTGCGGCCCCGGGTTCCTCCCGGGGCTACGCCTGTCTGAGGGTCGCTT174620.14150455270760962No Hit
TGTAAACATCCTACACTCAGCTTGGAATTCTCGGGTGCCAAGGAACTCCA172880.14009453139440817RNA PCR Primer, Index 1 (100% over 28bp)
AGTACTTGGATGGGAGACCGCCTGGGAATACCAGGTGCTGTAAGCTTTGG172330.13964883500230424No Hit
GCATTGTGGTTCAGTGGTAGAATTCTCGCCTTGGAATTCTCGGGTGCCAA170700.13832795296752357No Hit
GAAGGATCATTATGGAATTCTCGGGTGCCAAGGAACTCCAGTCACACTTG168530.1365694781114045RNA PCR Primer, Index 8 (100% over 38bp)
TCCCTGTGGTCTAGTGGTTAGGATTCGGCGCTCTGGAATTCTCGGGTGCC166400.13484341753834753No Hit
TAGCTTATCAGACTGGTGTTGGTGGAATTCTCGGGTGCCAAGGAACTCCA165970.13449496399542993RNA PCR Primer, Index 1 (100% over 28bp)
TCCAGTGATGACAGCCTATAATCTGACTTGGAATTCTCGGGTGCCAAGGA163970.13287424984232477RNA PCR Primer, Index 1 (100% over 22bp)
GCCCGGCTAGCTCAGTCGGTAGAGCATGAGACTCTGGAATTCTCGGGTGC160670.13020007148970128No Hit
ATCCATGATGACATTAAAACATAACGTGCCTGTTGGATGAAGCTTGCGGA160170.129794892951425No Hit
TCCTCCCGGGGCTACGCCTGTCTGAGGGTCGCTTGGAATTCTCGGGTGCC158810.1286928073273135No Hit
ATGACCTATGAATTGACAGCTGGAATTCTCGGGTGCCAAGGAACTCCAGT158760.1286522894734859RNA PCR Primer, Index 1 (100% over 30bp)
TCCGAATGATGAAATGTTGTTGATCTCTGTAGTAACCACGGTTACAGTGA153280.1242115326939778No Hit
CAACTCTTAGCGGTGGATCACTCGGCTCGTGCGTCGATGAAGAACGCAGC150550.12199925787498929No Hit
TACCCTGTAGATCCGGATTTGTTGGAATTCTCGGGTGCCAAGGAACTCCA148460.12030561158499443RNA PCR Primer, Index 1 (100% over 28bp)
TGAGATGAAGCACTGTAGCTTGGAATTCTCGGGTGCCAAGGAACTCCAGT148410.1202650937311668RNA PCR Primer, Index 1 (100% over 30bp)
TACCGTGAAGAATATCACGTCTTTCGCTCCTATCTGATCTGGAATTCTCG144740.11729108326021886No Hit
AAGGTCCAACCTCACATGTCCTTGGAATTCTCGGGTGCCAAGGAACTCCA143970.11666710831127339RNA PCR Primer, Index 1 (100% over 28bp)
AGGGTCGCTTGGAATTCTCGGGTGCCAAGGAACTCCAGTCACACTTGAAT141530.11468983704448511RNA PCR Primer, Index 8 (100% over 41bp)
TGGAGTGTGACAATGGTGTTTGTTGGAATTCTCGGGTGCCAAGGAACTCC141010.11426845136467778RNA PCR Primer, Index 1 (100% over 27bp)
GTTTCCGTAGTGTAGTGGTTATCACGTTCGCCTGGAATTCTCGGGTGCCA139970.11342568000506312No Hit
TGTAACAGCAACTCCATGTGGATGGAATTCTCGGGTGCCAAGGAACTCCA139560.11309343360367656RNA PCR Primer, Index 1 (100% over 28bp)
TCGTACCGTGAGTAATAATGCTGGAATTCTCGGGTGCCAAGGAACTCCAG138520.1122506622440619RNA PCR Primer, Index 1 (100% over 29bp)
GTAGTTCAGCCTGAGCAATACAGCGAGACACAGTCTTTTGGAATTCTCGG138280.11205617654568927No Hit
TGTCTGAGGGTCGCTTGGAATTCTCGGGTGCCCAGGAACTCCAGTCACAC136290.11044356596334967RNA PCR Primer, Index 5 (97% over 35bp)
CGCCTGTCTGAGGGTCGCTTGGAATTCTCGGGTGCCAAGGAACTCCAGTC134010.10859595182880981RNA PCR Primer, Index 1 (100% over 31bp)
AGCTACATCTGGCTACTGGGTCTCTGGAATTCTCGGGTGCCAAGGAACTC131640.10667540555738021RNA PCR Primer, Index 1 (100% over 26bp)
GTCGCTTGGAATTCTCGGGTGCCAAGGAACTCCAGTCACACTTGAATCTC131300.10639988415135233RNA PCR Primer, Index 8 (100% over 44bp)
ATGGCTGATGACCTTTGATGCGTTAGACTTCTGATTTAAAAATGAAGTCA129760.10515193425346138No Hit
TGAGGTAGTAGGTTGTGTGGTTTGGAATTCTCGGGTGCCAAGGAACTCCA129140.10464951286599877RNA PCR Primer, Index 1 (100% over 28bp)
GGAATACCAGGTGCTGTAAGCTTTGGAATTCTCGGGTGCCAAGGAACTCC129040.10456847715834353RNA PCR Primer, Index 1 (100% over 27bp)
TATTGCACTTGTCCCGGCCTGTATTGGAATTCTCGGGTGCCAAGGAACTC126890.1028262094437555RNA PCR Primer, Index 1 (100% over 26bp)

[FAIL]Adapter Content

Adapter graph

[FAIL]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
TGGGGTA302.5095578E-644.051221
ATAGGCG2050.044.00034716
TATAGTA850.044.00034716
CTAGGCA254.4451615E-544.00034717
TCAGTAA422750.043.9991231
AGGCTTC900.043.999121
ATATGTC700.043.9980313
TAACATC351.4481338E-743.9980323
ATGCGAC5450.043.9980326
GCATGCG5450.043.9980324
TATGTCC700.043.9980314
ATAATCA207.861355E-443.99785215
TCGCGTA207.861355E-443.99785215
TTTACGG207.861669E-443.9974982
CAATCCG207.861669E-443.99749829
CAACCAA502.7284841E-1143.99749429
GTTTATA351.4484976E-743.9966058
ATAGCTA254.447395E-543.99660511
CCTTGTA302.5310728E-643.99660510
TCCCTAG1100.043.996254