FastQCFastQC Report
Mon 5 Dec 2016
JM107_3_GATCAG_L006_R1_001.fastq

Summary

[OK]Basic Statistics

MeasureValue
FilenameJM107_3_GATCAG_L006_R1_001.fastq
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences10110895
Sequences flagged as poor quality0
Sequence length50
%GC51

[OK]Per base sequence quality

Per base quality graph

[WARN]Per tile sequence quality

Per base quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[FAIL]Per base sequence content

Per base sequence content

[FAIL]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[OK]Sequence Length Distribution

Sequence length distribution

[FAIL]Sequence Duplication Levels

Duplication level graph

[FAIL]Overrepresented sequences

SequenceCountPercentagePossible Source
TGGAATTCTCGGGTGCCAAGGAACTCCAGTCACGATCAGATCTCGTATGC455892645.08924284150908RNA PCR Primer, Index 9 (100% over 50bp)
TGGAGTGTGACAATGGTGTTTGTGGAATTCTCGGGTGCCAAGGAACTCCA1743391.7242687220073RNA PCR Primer, Index 1 (100% over 28bp)
ATGACCTATGAATTGACAGCCATGGAATTCTCGGGTGCCAAGGAACTCCA1494991.4785931413589006RNA PCR Primer, Index 1 (100% over 28bp)
ATGACCTATGAATTGACAGCCTGGAATTCTCGGGTGCCAAGGAACTCCAG1420381.4048014542728413RNA PCR Primer, Index 1 (100% over 29bp)
AAGCTGCCAGCTGAAGAACTGTTGGAATTCTCGGGTGCCAAGGAACTCCA1219461.2060851190720505RNA PCR Primer, Index 1 (100% over 28bp)
TTCAAGTAATCCAGGATAGGCTTGGAATTCTCGGGTGCCAAGGAACTCCA1196831.183703322010564RNA PCR Primer, Index 1 (100% over 28bp)
TTGCGGCCCCGGGTTCCTCCCGGGGCTACGCCTGTCTGAGGGTCGCTTGG1066391.0546939712063077No Hit
TGAGGTAGTAGGTTGTATAGTTTGGAATTCTCGGGTGCCAAGGAACTCCA996130.9852045738779801RNA PCR Primer, Index 1 (100% over 28bp)
CATGGAATTCTCGGGTGCCAAGGAACTCCAGTCACGATCAGATCTCGTAT815340.8063974554181406RNA PCR Primer, Index 9 (100% over 48bp)
TGGAGTGTGACAATGGTGTTTTGGAATTCTCGGGTGCCAAGGAACTCCAG812720.8038061912422194RNA PCR Primer, Index 1 (100% over 29bp)
CCTGTCTGAGGGTCGCTTGGAATTCTCGGGTGCCAAGGAACTCCAGTCAC632150.6252166598505869RNA PCR Primer, Index 1 (100% over 33bp)
TGGAGTGTGACAATGGTGTTTGTTGGAATTCTCGGGTGCCAAGGAACTCC606910.6002534889344613RNA PCR Primer, Index 1 (100% over 27bp)
CCGTCGAGCAGCATTCCGGGCTTCACATCGGAGGGCTCCAGCCGGCCCCG558070.5519491597924813No Hit
TAGCTTATCAGACTGGTGTTGGCTGGAATTCTCGGGTGCCAAGGAACTCC498110.4926467933847597RNA PCR Primer, Index 1 (100% over 27bp)
TATTGCACTTGTCCCGGCCTGTTGGAATTCTCGGGTGCCAAGGAACTCCA458940.45390640492261075RNA PCR Primer, Index 1 (100% over 28bp)
AACATTCAACGCTGTCGGTGAGTTGGAATTCTCGGGTGCCAAGGAACTCC398240.39387215474001064RNA PCR Primer, Index 1 (100% over 27bp)
AACATTCAACGCTGTCGGTGAGTGGAATTCTCGGGTGCCAAGGAACTCCA380410.376237711893952RNA PCR Primer, Index 1 (100% over 28bp)
TTCAAGTAATCCAGGATAGGTTTGGAATTCTCGGGTGCCAAGGAACTCCA374700.3705903384418491RNA PCR Primer, Index 1 (100% over 28bp)
GATCCATGATGACATTAAAACATAACGTGACTGTTGGATGAAGCTTGCGG314860.3114066558895132No Hit
ATCCATGATGACATTAAAACATAACGTGACTGTTGGATGAAGCTTGCGGA314360.31091213982540616No Hit
TGTAAACATCCTTGACTGGAAGCTTGGAATTCTCGGGTGCCAAGGAACTC298570.29529532252090446RNA PCR Primer, Index 1 (100% over 26bp)
TTCAGTGATGTTTGACAAATGTCTGACCTGAACTGCAATGTGGACAGATC293210.2899941103136765No Hit
TGAGGTAGTAGTTTGTATAGTTTGGAATTCTCGGGTGCCAAGGAACTCCA291300.2881050589487874RNA PCR Primer, Index 1 (100% over 28bp)
GTTCTACAGTCCGACTGGAATTCTCGGGTGCCAAGGAACTCCAGTCACGA286510.28336759505464154RNA PCR Primer, Index 7 (97% over 35bp)
ACCACGTTCCCGTGGTGGAATTCTCGGGTGCCAAGGAACTCCAGTCACGA279860.2767905314020173RNA PCR Primer, Index 7 (97% over 35bp)
TGGACGTGATGAGCAGGTGTTACCGCCCCAGTCTGATGTTTGGTGACTGA240260.23762485912473624No Hit
TGTAAACATCCTACACTCTCAGCTTGGAATTCTCGGGTGCCAAGGAACTC239050.23642813024959708RNA PCR Primer, Index 1 (100% over 26bp)
GGACAACTCTTAGCGGTGGAATTCTCGGGTGCCAAGGAACTCCAGTCACG234560.23198737599391547RNA PCR Primer, Index 6 (100% over 34bp)
TGGAATTCTCGGGTGCCAAGGAACTCCAGTCACGGTCAGATCTCGTATGC230640.22811037005131593RNA PCR Primer, Index 9 (98% over 50bp)
GCATTGGTGGTTCAGTGGTAGAATTCTCGCCTTGGAATTCTCGGGTGCCA210300.20799345656343973No Hit
CTACAGTCCGACGATCTGGAATTCTCGGGTGCCAAGGAACTCCAGTCACG202550.20032845756977996RNA PCR Primer, Index 6 (100% over 34bp)
TCAGTAACTGGAATCTGTCCCTTGGAATTCTCGGGTGCCAAGGAACTCCA197030.1948690002220377RNA PCR Primer, Index 1 (100% over 28bp)
GCATTGGTGGTTCAGTGGTAGAATTCTCGCCTGCCACGCGGGAGGCCCGG194000.19187223287354876No Hit
TCCCTGGTGGTCTAGTGGTTAGGATTCGGCGCTCTGGAATTCTCGGGTGC189020.1869468528750422No Hit
TGGACAACTCTTAGCGGTGGAATTCTCGGGTGCCAAGGAACTCCAGTCAC178410.17645322199468988RNA PCR Primer, Index 1 (100% over 33bp)
CTCCCGGGGCTACGCCTGTCTGAGGGTCGCTTGGAATTCTCGGGTGCCAA177610.17566199629211857No Hit
AGCCTGTGATGATACAAGTTATCCCTGTCTGAACTCTGGTGTGGAATTCT167510.16567277179715545No Hit
CTACGCCTGTCTGAGGGTCGCTTGGAATTCTCGGGTGCCAAGGAACTCCA162080.1603023273409525RNA PCR Primer, Index 1 (100% over 28bp)
TGAGGTAGTAGATTGAATAGTTTGGAATTCTCGGGTGCCAAGGAACTCCA157870.15613850208117086RNA PCR Primer, Index 1 (100% over 28bp)
TCTACAGTCCGACGATCTGGAATTCTCGGGTGCCAAGGAACTCCAGTCAC153830.1521428122831856RNA PCR Primer, Index 1 (100% over 33bp)
AGTTCTACAGTCCGACGATCTGGAATTCTCGGGTGCCAAGGAACTCCAGT149570.14792953541699325RNA PCR Primer, Index 1 (100% over 30bp)
TGGAATTCTCGGGTGCCAAGGAACTCCAGTGACGATCAGATCTCGTATGC148440.14681192911211124RNA PCR Primer, Index 9 (98% over 50bp)
TGTCTGAGGGTCGCTTGGAATTCTCGGGTGCCAAGGAACTCCAGTCACGA145890.14428989718516513RNA PCR Primer, Index 7 (97% over 35bp)
TGTAACAGCAACTCCATGTGGATGGAATTCTCGGGTGCCAAGGAACTCCA143500.14192611039873324RNA PCR Primer, Index 1 (100% over 28bp)
TAGCTTATCAGACTGGTGTTGGTGGAATTCTCGGGTGCCAAGGAACTCCA142890.14132280080052262RNA PCR Primer, Index 1 (100% over 28bp)
TAGCAGCACGTAAATATTGGAGTGGAATTCTCGGGTGCCAAGGAACTCCA138780.13725787875356238RNA PCR Primer, Index 1 (100% over 28bp)
CTGTCTGAGGGTCGCTTGGAATTCTCGGGTGCCAAGGAACTCCAGTCACG137100.13559630477816256RNA PCR Primer, Index 6 (100% over 34bp)
ACAGTCCGACGATCTGGAATTCTCGGGTGCCAAGGAACTCCAGTCACGAT136970.13546773060149472RNA PCR Primer, Index 9 (100% over 36bp)
GTGGGATGATGATTCTTAGACTAGAGTCTCTGAGAACACATGAAGTTGTT134620.13314350510019143No Hit
TGGAATTCTCGGGTGCCAAGGAACTCCAGTCACGATCCGATCTCGTATGC127360.12596313184935656RNA PCR Primer, Index 9 (98% over 50bp)
ACAGTAGTCTGCACATTGGTTTGGAATTCTCGGGTGCCAAGGAACTCCAG125810.1244301320506246RNA PCR Primer, Index 1 (100% over 29bp)
CATTATTACTTTTGGTACGCGTGGAATTCTCGGGTGCCAAGGAACTCCAG125610.12423232562498177RNA PCR Primer, Index 1 (100% over 29bp)
TGCCTGTGATGAGACTCTCGACGGGCGGACTGAATGGGTTTTCACCCTCC125240.12386638373754252No Hit
AGAGATGATGACTTCTGTTACCGCCCCAGTCTGAGAAGTCATGACTGATC123820.1224619581154784No Hit
TTACATGATGAAACATGTGTTGGTAGGGACATCTGAATGAATGTGATGAA122950.12160150016393208No Hit
TCGCTGCGATCCATTGAAAGTCAGCCCTCGATCCAAGTTTTTGTTGGAAT121900.12056301642930721No Hit
TAGTTCTACAGTCCGACGATCTGGAATTCTCGGGTGCCAAGGAACTCCAG121250.119920145545968RNA PCR Primer, Index 1 (100% over 29bp)
TGTAAACATCCTACACTCAGCTTGGAATTCTCGGGTGCCAAGGAACTCCA120760.11943551980314304RNA PCR Primer, Index 1 (100% over 28bp)
TTGCGGCCCCGGGTTCCTCCCGGGGCTACGCCTGTCTGAGGGTCGCTTTG118490.11719041687209687No Hit
CAGAGTTCTACAGTCCGACGATCTGGAATTCTCGGGTGCCAAGGAACTCC115950.11467827526643289RNA PCR Primer, Index 1 (100% over 27bp)
CACCACGTTCCCGTGGTGGAATTCTCGGGTGCCAAGGAACTCCAGTCACG115790.11452003012591863RNA PCR Primer, Index 6 (100% over 34bp)
TAAGATGATGATTAACTCACCATCTTTCGGCTGAAGAATGATGTATACTC115170.11390683020642584No Hit
TGAGGTAGTAGTTTGTGCTGTTTGGAATTCTCGGGTGCCAAGGAACTCCA113210.11196832723512606RNA PCR Primer, Index 1 (100% over 28bp)
ATGGAATTCTCGGGTGCCAAGGAACTCCAGTCACGATCAGATCTCGTATG112810.11157271438384041RNA PCR Primer, Index 9 (100% over 49bp)
TGGAATTCTCGGGTGCCAAGGAACTCCAGTCACGATAAGATCTCGTATGC112130.11090017253665477RNA PCR Primer, Index 9 (98% over 50bp)
TGAGGTAGTAGGTTGTATAGTTTTGGAATTCTCGGGTGCCAAGGAACTCC111710.11048477904280482RNA PCR Primer, Index 1 (100% over 27bp)
TTCTACAGTCCGACGATCTGGAATTCTCGGGTGCCAAGGAACTCCAGTCA111370.11014850811921201RNA PCR Primer, Index 1 (100% over 32bp)
TACAGTCCGACGATCTGGAATTCTCGGGTGCCAAGGAACTCCAGTCACGA109920.10871441153330146RNA PCR Primer, Index 7 (97% over 35bp)
TCCCTGTGGTCTAGTGGTTAGGATTCGGCGCTCTGGAATTCTCGGGTGCC106080.10491652816095903No Hit
ATGACCTATGAATTGACAGCCATTGGAATTCTCGGGTGCCAAGGAACTCC106050.10488685719711262RNA PCR Primer, Index 1 (100% over 27bp)

[WARN]Adapter Content

Adapter graph

[FAIL]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
CGCTAAA351.4350553E-744.0487171
GCTTACG7200.044.0487171
GCCACAT408.241841E-944.0487171
GGTTAAC207.8166847E-444.0487171
TACTTAA4650.044.0487141
CGATTGC254.4252836E-544.03367243
TATGCCC302.5164027E-644.03367244
TATTCCG254.4252836E-544.03367244
TCGTAAG551.8189894E-1244.03367243
GATTGCC207.829845E-444.03367244
ATACACA254.4252836E-544.03367244
CTCGTAA551.8189894E-1244.03236442
TACACTA900.044.02081740
AGCATGC800.043.99643323
TTGCGAA302.5310947E-643.99643326
ACCGTGC254.4474396E-543.99643323
GTCTTGC207.8625354E-443.99643323
TTCGCCA454.802132E-1043.99643327
CCCGCTT1900.043.99643326
GCATACC454.802132E-1043.99643328