FastQCFastQC Report
Mon 5 Dec 2016
JM109_1_CAGATC_L008_R1_001.fastq

Summary

[OK]Basic Statistics

MeasureValue
FilenameJM109_1_CAGATC_L008_R1_001.fastq
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences6610788
Sequences flagged as poor quality0
Sequence length50
%GC51

[OK]Per base sequence quality

Per base quality graph

[FAIL]Per tile sequence quality

Per base quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[FAIL]Per base sequence content

Per base sequence content

[FAIL]Per sequence GC content

Per sequence GC content graph

[WARN]Per base N content

N content graph

[OK]Sequence Length Distribution

Sequence length distribution

[FAIL]Sequence Duplication Levels

Duplication level graph

[FAIL]Overrepresented sequences

SequenceCountPercentagePossible Source
AACATTCAACGCTGTCGGTGAGTGGAATTCTCGGGTGCCAAGGAACTCCA5725408.660692189796436RNA PCR Primer, Index 1 (100% over 28bp)
TTCAAGTAATCCAGGATAGGCTTGGAATTCTCGGGTGCCAAGGAACTCCA3059814.6285102471898965RNA PCR Primer, Index 1 (100% over 28bp)
AACATTCAACGCTGTCGGTGAGTTGGAATTCTCGGGTGCCAAGGAACTCC2634303.98485021755349RNA PCR Primer, Index 1 (100% over 27bp)
AACCCGTAGATCCGAACTTGTGTGGAATTCTCGGGTGCCAAGGAACTCCA1932272.922904198410235RNA PCR Primer, Index 1 (100% over 28bp)
TGAGGTAGTAGGTTGTATAGTTTGGAATTCTCGGGTGCCAAGGAACTCCA1689712.5559887868133115RNA PCR Primer, Index 1 (100% over 28bp)
TCACAGTGAACCGGTCTCTTTTGGAATTCTCGGGTGCCAAGGAACTCCAG1276621.9311162300167544RNA PCR Primer, Index 1 (100% over 29bp)
TAAAGCTAGAGAACCGAAAGTATGGAATTCTCGGGTGCCAAGGAACTCCA1125271.7021722675118307RNA PCR Primer, Index 1 (100% over 28bp)
TCCCTGAGACCCTTAACCTGTTGGAATTCTCGGGTGCCAAGGAACTCCAG1047911.5851514221905165RNA PCR Primer, Index 1 (100% over 29bp)
TAAAGCTAGAGAACCGAAAGTTGGAATTCTCGGGTGCCAAGGAACTCCAG928921.4051577512393378RNA PCR Primer, Index 1 (100% over 29bp)
TCCCTGAGACCCTTAACCTGTGTGGAATTCTCGGGTGCCAAGGAACTCCA788181.1922633126338342RNA PCR Primer, Index 1 (100% over 28bp)
AACATTCAACGCTGTCGGTGATGGAATTCTCGGGTGCCAAGGAACTCCAG728551.1020622654969423RNA PCR Primer, Index 1 (100% over 29bp)
AACCCGTAGATCCGAACTTGTTGGAATTCTCGGGTGCCAAGGAACTCCAG638940.9665111027611232RNA PCR Primer, Index 1 (100% over 29bp)
TAAAGCTAGAGAACCGAAAGTCTGGAATTCTCGGGTGCCAAGGAACTCCA590590.8933730744353018RNA PCR Primer, Index 1 (100% over 28bp)
TATTGCACTCGTCCCGGCCTCCTGGAATTCTCGGGTGCCAAGGAACTCCA498090.7534502694686321RNA PCR Primer, Index 1 (100% over 28bp)
AACANTCAACGCTGTCGGTGAGTGGAATTCTCGGGTGCCAAGGAACTCCA451540.6830350632935136RNA PCR Primer, Index 1 (100% over 28bp)
AGCTACATCTGGCTACTGGGTCTCTGGAATTCTCGGGTGCCAAGGAACTC437850.6623264881584464RNA PCR Primer, Index 1 (100% over 26bp)
AACAGTCAACGCTGTCGGTGAGTGGAATTCTCGGGTGCCAAGGAACTCCA412750.6243582459458691RNA PCR Primer, Index 1 (100% over 28bp)
TCCAGCATCAGTGATTTTGTTTGGAATTCTCGGGTGCCAAGGAACTCCAG411940.6231329759780528RNA PCR Primer, Index 1 (100% over 29bp)
TCTTTGGTTATCTAGCTGTATGATGGAATTCTCGGGTGCCAAGGAACTCC405530.6134367037636058RNA PCR Primer, Index 1 (100% over 27bp)
TGAGGTAGTAGTTTGTATAGTTTGGAATTCTCGGGTGCCAAGGAACTCCA392370.5935298484840235RNA PCR Primer, Index 1 (100% over 28bp)
TTAAAGGGAATTTGCGACTGTTTGGAATTCTCGGGTGCCAAGGAACTCCA368710.5577398639920083RNA PCR Primer, Index 1 (100% over 28bp)
TCTTTGGTTATCTAGCTGTATTGGAATTCTCGGGTGCCAAGGAACTCCAG365140.5523396000597811RNA PCR Primer, Index 1 (100% over 29bp)
ACCTTGGCTTTAGACTGCTTACTTGGAATTCTCGGGTGCCAAGGAACTCC351580.5318276731911536RNA PCR Primer, Index 1 (100% over 27bp)
TGAGGTAGTAGTTTGTGCTGTTTGGAATTCTCGGGTGCCAAGGAACTCCA345510.5226457118273948RNA PCR Primer, Index 1 (100% over 28bp)
TCCCTGAGACCCTTAACCTGTGATGGAATTCTCGGGTGCCAAGGAACTCC343860.520149791522584RNA PCR Primer, Index 1 (100% over 27bp)
TAGCTTATCAGACTGGTGTTGGCTGGAATTCTCGGGTGCCAAGGAACTCC336310.5087290652793586RNA PCR Primer, Index 1 (100% over 27bp)
AACATTCATTGCTGTCGGTGGGTGGAATTCTCGGGTGCCAAGGAACTCCA324790.49130300351486084RNA PCR Primer, Index 1 (100% over 28bp)
TTGCATAGTCACAAAAGTGATCTGGAATTCTCGGGTGCCAAGGAACTCCA314350.4755106350407849RNA PCR Primer, Index 1 (100% over 28bp)
CCACGTTCCCGTGGTGGAATTCTCGGGTGCCAAGGAACTCCAGTCACCAG308680.4669337452660712RNA PCR Primer, Index 7 (100% over 36bp)
TGAGGTAGTAGGTTGTATAGTTGGAATTCTCGGGTGCCAAGGAACTCCAG291230.4405374971939805RNA PCR Primer, Index 1 (100% over 29bp)
TACCCTGTAGAACCGAATTTGTTGGAATTCTCGGGTGCCAAGGAACTCCA289900.43852563416040574RNA PCR Primer, Index 1 (100% over 28bp)
AACCCGTAGATCCGAACTTGTGATGGAATTCTCGGGTGCCAAGGAACTCC278200.4208272901808378RNA PCR Primer, Index 1 (100% over 27bp)
TCACAGTGAACCGGTCTCTTTTTGGAATTCTCGGGTGCCAAGGAACTCCA248030.37518976557711425RNA PCR Primer, Index 1 (100% over 28bp)
TTCACAGTGGCTAAGTTCTGCTGGAATTCTCGGGTGCCAAGGAACTCCAG241480.3652817183065014RNA PCR Primer, Index 1 (100% over 29bp)
TGAGGTAGTTGGTTGTATAGTTTGGAATTCTCGGGTGCCAAGGAACTCCA240510.36381441970306716RNA PCR Primer, Index 1 (100% over 28bp)
TTCANGTAATCCAGGATAGGCTTGGAATTCTCGGGTGCCAAGGAACTCCA230060.348006924439265RNA PCR Primer, Index 1 (100% over 28bp)
TTCAGGTAATCCAGGATAGGCTTGGAATTCTCGGGTGCCAAGGAACTCCA227730.34448238243307755RNA PCR Primer, Index 1 (100% over 28bp)
TCTTTGGTTATCTAGCTGTATGTGGAATTCTCGGGTGCCAAGGAACTCCA219200.3315792307966917RNA PCR Primer, Index 1 (100% over 28bp)
TCCCTGAGACCCTAACTTGTGATGGAATTCTCGGGTGCCAAGGAACTCCA206630.31256485611095075RNA PCR Primer, Index 1 (100% over 28bp)
TACCCTGTAGATCCGGATTTGTTGGAATTCTCGGGTGCCAAGGAACTCCA204150.30881341225887143RNA PCR Primer, Index 1 (100% over 28bp)
AACANTCAACGCTGTCGGTGAGTTGGAATTCTCGGGTGCCAAGGAACTCC201510.30481993977117405RNA PCR Primer, Index 1 (100% over 27bp)
AAGCTGCCAGCTGAAGAACTGTTGGAATTCTCGGGTGCCAAGGAACTCCA192580.2913117165457431RNA PCR Primer, Index 1 (100% over 28bp)
AACATTCATTGCTGTCGGTGGGTTGGAATTCTCGGGTGCCAAGGAACTCC191470.28963264288614304RNA PCR Primer, Index 1 (100% over 27bp)
AACAGTCAACGCTGTCGGTGAGTTGGAATTCTCGGGTGCCAAGGAACTCC189720.286985454684071RNA PCR Primer, Index 1 (100% over 27bp)
TAACAGTCTACAGTCATGGCTTGGAATTCTCGGGTGCCAAGGAACTCCAG188510.28515511312720965RNA PCR Primer, Index 1 (100% over 29bp)
TCCCTGAGACCCTAACTTGTTGGAATTCTCGGGTGCCAAGGAACTCCAGT175660.26571718832913716RNA PCR Primer, Index 1 (100% over 30bp)
TCCCTGAGACCCTAACTTGTGTGGAATTCTCGGGTGCCAAGGAACTCCAG174940.26462805946885604RNA PCR Primer, Index 1 (100% over 29bp)
TGGAATTCTCGGGTGCCAAGGAACTCCAGTCACCAGATCATCTCGTATGC173850.26297923938870826RNA PCR Primer, Index 7 (100% over 50bp)
TTCAAGTAATCCAGGATAGGCTGGAATTCTCGGGTGCCAAGGAACTCCAG172660.2611791514112992RNA PCR Primer, Index 1 (100% over 29bp)
CCCTGAGACCCTTAACCTGTGATGGAATTCTCGGGTGCCAAGGAACTCCA166820.25234510621124134RNA PCR Primer, Index 1 (100% over 28bp)
TAAAGCTAGAGAACCGAAAGTAATGGAATTCTCGGGTGCCAAGGAACTCC166470.25181566857082693RNA PCR Primer, Index 1 (100% over 27bp)
TCCAGCATCAGTGATTTTGTTGTGGAATTCTCGGGTGCCAAGGAACTCCA165610.2505147646543801RNA PCR Primer, Index 1 (100% over 28bp)
TAAAGGGAATTTGCGACTGTTTGGAATTCTCGGGTGCCAAGGAACTCCAG164430.24872980346669718RNA PCR Primer, Index 1 (100% over 29bp)
TGAGATGAAGCACTGTAGCTCTTGGAATTCTCGGGTGCCAAGGAACTCCA158640.23997139221526997RNA PCR Primer, Index 1 (100% over 28bp)
TCACAGTGAACCGGTCTCTTTGGAATTCTCGGGTGCCAAGGAACTCCAGT154470.23366352089947523RNA PCR Primer, Index 1 (100% over 30bp)
AGCTACATCTGGCTACTGGGTCTTGGAATTCTCGGGTGCCAAGGAACTCC151910.22979106272958688RNA PCR Primer, Index 1 (100% over 27bp)
AGCTGGTGTTGTGAATCAGGCCGTGGAATTCTCGGGTGCCAAGGAACTCC149530.22619088677476876RNA PCR Primer, Index 1 (100% over 27bp)
AACCNGTAGATCCGAACTTGTGTGGAATTCTCGGGTGCCAAGGAACTCCA147800.22357395215214887RNA PCR Primer, Index 1 (100% over 28bp)
TGAGATGAAGCACTGTAGCTCTGGAATTCTCGGGTGCCAAGGAACTCCAG147540.22318065561926959RNA PCR Primer, Index 1 (100% over 29bp)
TATTGCACTTGTCCCGGCCTGTTGGAATTCTCGGGTGCCAAGGAACTCCA142140.2150121891671613RNA PCR Primer, Index 1 (100% over 28bp)
TAAAGCTAGAGAACCGAAAGTATTGGAATTCTCGGGTGCCAAGGAACTCC142110.2149668087979829RNA PCR Primer, Index 1 (100% over 27bp)
AACCGGTAGATCCGAACTTGTGTGGAATTCTCGGGTGCCAAGGAACTCCA141290.21372641204044054RNA PCR Primer, Index 1 (100% over 28bp)
CCTTGGCTTTAGACTGCTTACTTGGAATTCTCGGGTGCCAAGGAACTCCA133020.20121655693693402RNA PCR Primer, Index 1 (100% over 28bp)
TTCACCGTGGCTAAGTTCTGCTGGAATTCTCGGGTGCCAAGGAACTCCAG131680.19918956711363306RNA PCR Primer, Index 1 (100% over 29bp)
TACCCTGTAGAACCGAATTTGCGTGGAATTCTCGGGTGCCAAGGAACTCC130570.19751049345403301RNA PCR Primer, Index 1 (100% over 27bp)
TCCCTGAGACCCTTAACCTGTGTTGGAATTCTCGGGTGCCAAGGAACTCC127150.19233713136769778RNA PCR Primer, Index 1 (100% over 27bp)
TGAGATGAAGCACTGTAGCTTGGAATTCTCGGGTGCCAAGGAACTCCAGT125830.1903403951238491RNA PCR Primer, Index 1 (100% over 30bp)
AGAATAATGCCAGCAGTCGGTCTGGAATTCTCGGGTGCCAAGGAACTCCA124670.1885856875156184RNA PCR Primer, Index 1 (100% over 28bp)
CCTGTCTGAGGGTCGCTTGGAATTCTCGGGTGCCAAGGAACTCCAGTCAC124260.1879654891368472RNA PCR Primer, Index 1 (100% over 33bp)
TGAGNTAGTAGGTTGTATAGTTTGGAATTCTCGGGTGCCAAGGAACTCCA120780.18270136631215522RNA PCR Primer, Index 1 (100% over 28bp)
AGCTACATTGTCTGCTGGGTTTTGGAATTCTCGGGTGCCAAGGAACTCCA120420.1821568018820147RNA PCR Primer, Index 1 (100% over 28bp)
AGCTACATTGTCTGCTGGGTTTCTGGAATTCTCGGGTGCCAAGGAACTCC114770.17361016568675322RNA PCR Primer, Index 1 (100% over 27bp)
TTCCCTTTGTCATCCTATGCCTTGGAATTCTCGGGTGCCAAGGAACTCCA114630.17339839063058746RNA PCR Primer, Index 1 (100% over 28bp)
TTCACAGTGGCTAAGTTCTGTGGAATTCTCGGGTGCCAAGGAACTCCAGT113930.1723395153497586RNA PCR Primer, Index 1 (100% over 30bp)
TGAGGTAGTAGGTTGTATAGTTTTGGAATTCTCGGGTGCCAAGGAACTCC112630.17037303268536216RNA PCR Primer, Index 1 (100% over 27bp)
TTGCGGCCCCGGGTTCCTCCCGGGGCTACGCCTGTCTGAGGGTCGCTTGG111180.16817964817507383No Hit
TGAGGTAGTTGGTTGTATTGTTTGGAATTCTCGGGTGCCAAGGAACTCCA110080.1665157013051999RNA PCR Primer, Index 1 (100% over 28bp)
TCCCTGAGACCCTAACTTGTGCTGGAATTCTCGGGTGCCAAGGAACTCCA109790.16607702440314226RNA PCR Primer, Index 1 (100% over 28bp)
TCTTTGGTTATCTAGCTGTATGTTGGAATTCTCGGGTGCCAAGGAACTCC108520.1641559221079242RNA PCR Primer, Index 1 (100% over 27bp)
TACCCTGTAGAACCGAATTTGCTGGAATTCTCGGGTGCCAAGGAACTCCA107100.16200791796681424RNA PCR Primer, Index 1 (100% over 28bp)
ACCGTGGCTTTAGATTGTTACTTGGAATTCTCGGGTGCCAAGGAACTCCA105510.15960275840036015RNA PCR Primer, Index 1 (100% over 28bp)
AACAATCAACGCTGTCGGTGAGTGGAATTCTCGGGTGCCAAGGAACTCCA103790.15700095056746638RNA PCR Primer, Index 1 (100% over 28bp)
TACCCTGTAGAACCGAATGTGTTGGAATTCTCGGGTGCCAAGGAACTCCA103430.15645638613732585RNA PCR Primer, Index 1 (100% over 28bp)
AAGCTGCCAGCTGAAGAACTTGGAATTCTCGGGTGCCAAGGAACTCCAGT101150.15300747807976903RNA PCR Primer, Index 1 (100% over 30bp)
TCCCTGAGACCCTTAACCTGTGGAATTCTCGGGTGCCAAGGAACTCCAGT100800.1524780404393546RNA PCR Primer, Index 1 (100% over 30bp)
ACCATCGACCGTTGACTGTGCCTGGAATTCTCGGGTGCCAAGGAACTCCA98900.14960395039139057RNA PCR Primer, Index 1 (100% over 28bp)
AAGGTCCAACCTCACATGTCCTTGGAATTCTCGGGTGCCAAGGAACTCCA92200.13946900127488585RNA PCR Primer, Index 1 (100% over 28bp)
TCACGGTGAACCGGTCTCTTTTGGAATTCTCGGGTGCCAAGGAACTCCAG91350.13818322414816508RNA PCR Primer, Index 1 (100% over 29bp)
TGGAATTCTCGGGTGCCAAGGCACTCCAGTCACCAGATCATCTCGTATGC90680.13716972923651463RNA PCR Primer, Index 7 (98% over 50bp)
TAAAGCTAGAGAACCGAAAGTCATGGAATTCTCGGGTGCCAAGGAACTCC87880.13293422811319922RNA PCR Primer, Index 1 (100% over 27bp)
CCCTGCGACCCTTAACCTGTGATGGAATTCTCGGGTGCCAAGGAACTCCA87870.13291910132347307RNA PCR Primer, Index 1 (100% over 28bp)
AAGCTGCCAGTTGAAGAGCTGTTGGAATTCTCGGGTGCCAAGGAACTCCA87300.13205687430908386RNA PCR Primer, Index 1 (100% over 28bp)
TAGCTTATCAGACTGGTGTTGGTGGAATTCTCGGGTGCCAAGGAACTCCA87100.13175433851456136RNA PCR Primer, Index 1 (100% over 28bp)
AGCCTGTGATGATACAAGTTATCCCTGTCTGAACTCTGGTGTGGAATTCT85870.1298937433782478No Hit
CCCTGAGACCCTTAACCTGTGCTGGAATTCTCGGGTGCCAAGGAACTCCA85340.12909202352276308RNA PCR Primer, Index 1 (100% over 28bp)
TGAGGTAGTAGGTTGTGTGGTTTGGAATTCTCGGGTGCCAAGGAACTCCA81850.12381277390834497RNA PCR Primer, Index 1 (100% over 28bp)
TGAGGTAGTAGATTGAATAGTTTGGAATTCTCGGGTGCCAAGGAACTCCA78740.11910834230351965RNA PCR Primer, Index 1 (100% over 28bp)
TCCCGGAGACCCTTAACCTGTTGGAATTCTCGGGTGCCAAGGAACTCCAG77240.11683932384460066RNA PCR Primer, Index 1 (100% over 29bp)
TTCAAGTAATCCAGGATAGGTTTGGAATTCTCGGGTGCCAAGGAACTCCA76930.11637039336309075RNA PCR Primer, Index 1 (100% over 28bp)
CATTATTACTTTTGGTACGCGTGGAATTCTCGGGTGCCAAGGAACTCCAG76010.11497872870828711RNA PCR Primer, Index 1 (100% over 29bp)
AGCAGCATTGTACAGGGCTATGATGGAATTCTCGGGTGCCAAGGAACTCC74510.11270971024936816RNA PCR Primer, Index 1 (100% over 27bp)
TGTAAACATCCTTGACTGGAAGCTTGGAATTCTCGGGTGCCAAGGAACTC73680.11145418670209965RNA PCR Primer, Index 1 (100% over 26bp)
TACCCTGTAGATCCGGATTTGTGTGGAATTCTCGGGTGCCAAGGAACTCC73340.11093987585141137RNA PCR Primer, Index 1 (100% over 27bp)
TAAAGCTAGAGAACCGAAAGTCTTGGAATTCTCGGGTGCCAAGGAACTCC72690.10995663451921313RNA PCR Primer, Index 1 (100% over 27bp)
TTCCCTTTGTCATCCTATGCCTGTGGAATTCTCGGGTGCCAAGGAACTCC71510.10817167333153023RNA PCR Primer, Index 1 (100% over 27bp)
CTTTGGTTATCTAGCTGTATGATGGAATTCTCGGGTGCCAAGGAACTCCA70500.10664386756919146RNA PCR Primer, Index 1 (100% over 28bp)
AACCCGTAGATCCGAACTTGTGGAATTCTCGGGTGCCAAGGAACTCCAGT69980.10585727450343288RNA PCR Primer, Index 1 (100% over 30bp)
TAAGGCACGCGGTGAATGCCTGGAATTCTCGGGTGCCAAGGAACTCCAGT69210.10469251169452114RNA PCR Primer, Index 1 (100% over 30bp)
TAAANCTAGAGAACCGAAAGTTGGAATTCTCGGGTGCCAAGGAACTCCAG68920.10425383479246346RNA PCR Primer, Index 1 (100% over 29bp)
TTCAAGTAATCCAGGATAGGCTTTGGAATTCTCGGGTGCCAAGGAACTCC68640.10383028468013192RNA PCR Primer, Index 1 (100% over 27bp)
AGAATCATGCCAGCAGTCGGTCTGGAATTCTCGGGTGCCAAGGAACTCCA68270.10327059346026525RNA PCR Primer, Index 1 (100% over 28bp)
ACCTTGGCTCTAGACTGCTTACTTGGAATTCTCGGGTGCCAAGGAACTCC67540.10216633781025802RNA PCR Primer, Index 1 (100% over 27bp)
CCTGTCTGAGGGTCGCTTGGACTTCTCGGGTGCCAAGGAACTCCAGTCAC66740.1009561946321679RNA PCR Primer, Index 1 (96% over 33bp)
AACATTCAACGCTGTCGGTGAGATGGAATTCTCGGGTGCCAAGGAACTCC66210.1001544747766832RNA PCR Primer, Index 1 (100% over 27bp)

[FAIL]Adapter Content

Adapter graph

[FAIL]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
GTTTGCG1300.046.660961
AGCCCGT750.046.660961
ATTGCCC1800.046.660961
GATCGAT253.142564E-546.6609571
AGGCGGT253.142564E-546.6609571
TAGCCGC301.6884242E-646.6609571
AAACGCG253.142564E-546.6609571
GTTCGCA501.4551915E-1146.6609571
TACTACA205.88496E-446.6609571
CTTTCCG1000.046.6609571
CACCGCG404.953108E-946.6609571
TCCTTCA800.046.6609571
TCCCAGA6700.046.6609571
AACATTC1081250.046.6178051
TACAATT5300.046.604492
ATTTCAC1050.046.6044852
GAGCTTA3050.046.604482
GCAACCG205.9201923E-446.604482
GAATCGA205.9201923E-446.604482
ATTTTTA205.9201923E-446.604482