FastQCFastQC Report
Mon 5 Dec 2016
JM115_3_TAGCTT_L008_R1_001.fastq

Summary

[OK]Basic Statistics

MeasureValue
FilenameJM115_3_TAGCTT_L008_R1_001.fastq
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences15583525
Sequences flagged as poor quality0
Sequence length50
%GC51

[OK]Per base sequence quality

Per base quality graph

[OK]Per tile sequence quality

Per base quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[FAIL]Per base sequence content

Per base sequence content

[FAIL]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[OK]Sequence Length Distribution

Sequence length distribution

[FAIL]Sequence Duplication Levels

Duplication level graph

[FAIL]Overrepresented sequences

SequenceCountPercentagePossible Source
TGGAATTCTCGGGTGCCAAGGAACTCCAGTCACTAGCTTATCTCGTATGC528477933.91260321397117RNA PCR Primer, Index 10 (100% over 50bp)
TTCAAGTAATCCAGGATAGGCTTGGAATTCTCGGGTGCCAAGGAACTCCA2429481.559005423997459RNA PCR Primer, Index 1 (100% over 28bp)
TGGAGTGTGACAATGGTGTTTGTGGAATTCTCGGGTGCCAAGGAACTCCA2070811.3288456879942119RNA PCR Primer, Index 1 (100% over 28bp)
ATGACCTATGAATTGACAGCCTGGAATTCTCGGGTGCCAAGGAACTCCAG2035641.3062769816200122RNA PCR Primer, Index 1 (100% over 29bp)
ATGACCTATGAATTGACAGCCATGGAATTCTCGGGTGCCAAGGAACTCCA1821991.1691770635976135RNA PCR Primer, Index 1 (100% over 28bp)
TAGCTTATCAGACTGGTGTTGGCTGGAATTCTCGGGTGCCAAGGAACTCC1323600.8493585373014128RNA PCR Primer, Index 1 (100% over 27bp)
AAGCTGCCAGCTGAAGAACTGTTGGAATTCTCGGGTGCCAAGGAACTCCA1256390.8062296559988835RNA PCR Primer, Index 1 (100% over 28bp)
TGAGGTAGTAGGTTGTATAGTTTGGAATTCTCGGGTGCCAAGGAACTCCA1220950.7834876897236023RNA PCR Primer, Index 1 (100% over 28bp)
TGGAGTGTGACAATGGTGTTTTGGAATTCTCGGGTGCCAAGGAACTCCAG982440.6304350267349653RNA PCR Primer, Index 1 (100% over 29bp)
TATTGCACTTGTCCCGGCCTGTTGGAATTCTCGGGTGCCAAGGAACTCCA978990.6282211502211471RNA PCR Primer, Index 1 (100% over 28bp)
CATGGAATTCTCGGGTGCCAAGGAACTCCAGTCACTAGCTTATCTCGTAT919990.5903606533181677RNA PCR Primer, Index 10 (100% over 48bp)
TGGAGTGTGACAATGGTGTTTGTTGGAATTCTCGGGTGCCAAGGAACTCC817590.5246502315746918RNA PCR Primer, Index 1 (100% over 27bp)
TCAGTAACTGGAATCTGTCCCTTGGAATTCTCGGGTGCCAAGGAACTCCA777260.4987703359798248RNA PCR Primer, Index 1 (100% over 28bp)
CCTGTCTGAGGGTCGCTTGGAATTCTCGGGTGCCAAGGAACTCCAGTCAC681320.4372053177955565RNA PCR Primer, Index 1 (100% over 33bp)
AACATTCAACGCTGTCGGTGAGTGGAATTCTCGGGTGCCAAGGAACTCCA653680.4194686375515167RNA PCR Primer, Index 1 (100% over 28bp)
TAACGGAACCCATAATGCAGCTGTGGAATTCTCGGGTGCCAAGGAACTCC652920.4189809430151394RNA PCR Primer, Index 1 (100% over 27bp)
TTCAAGTAATCCAGGATAGGTTTGGAATTCTCGGGTGCCAAGGAACTCCA635140.4075714576772585RNA PCR Primer, Index 1 (100% over 28bp)
AACATTCAACGCTGTCGGTGAGTTGGAATTCTCGGGTGCCAAGGAACTCC587220.3768210337519913RNA PCR Primer, Index 1 (100% over 27bp)
ACCACGTTCCCGTGGTGGAATTCTCGGGTGCCAAGGAACTCCAGTCACTA584150.3748510045063617RNA PCR Primer, Index 7 (97% over 35bp)
GTTCTACAGTCCGACTGGAATTCTCGGGTGCCAAGGAACTCCAGTCACTA569060.36516770114592173RNA PCR Primer, Index 7 (97% over 35bp)
TGAGATGAAGCACTGTAGCTCTGGAATTCTCGGGTGCCAAGGAACTCCAG516680.3315552803361242RNA PCR Primer, Index 1 (100% over 29bp)
TTGCGGCCCCGGGTTCCTCCCGGGGCTACGCCTGTCTGAGGGTCGCTTGG514850.3303809632287945No Hit
TGAGATGAAGCACTGTAGCTCTTGGAATTCTCGGGTGCCAAGGAACTCCA462110.2965375292175551RNA PCR Primer, Index 1 (100% over 28bp)
CTACAGTCCGACGATCTGGAATTCTCGGGTGCCAAGGAACTCCAGTCACT435580.2795131396779612RNA PCR Primer, Index 3 (100% over 34bp)
CACCACGTTCCCGTGGTGGAATTCTCGGGTGCCAAGGAACTCCAGTCACT431670.27700407962896717RNA PCR Primer, Index 3 (100% over 34bp)
TGAGGTAGTAGTTTGTATAGTTTGGAATTCTCGGGTGCCAAGGAACTCCA430400.27618911639054705RNA PCR Primer, Index 1 (100% over 28bp)
TGTAAACATCCTTGACTGGAAGCTTGGAATTCTCGGGTGCCAAGGAACTC390470.2505659021306155RNA PCR Primer, Index 1 (100% over 26bp)
TGTAAACATCCTACACTCTCAGCTTGGAATTCTCGGGTGCCAAGGAACTC390040.2502899696955599RNA PCR Primer, Index 1 (100% over 26bp)
TAGCTTATCAGACTGGTGTTGGTGGAATTCTCGGGTGCCAAGGAACTCCA383690.24621515350345957RNA PCR Primer, Index 1 (100% over 28bp)
GGACAACTCTTAGCGGTGGAATTCTCGGGTGCCAAGGAACTCCAGTCACT377560.2422815120455738RNA PCR Primer, Index 3 (100% over 34bp)
TGGAATTCTCGGGTGCCAAGGAACTCCATCACTAGCTTATCTCGTATGCC333020.21370004540051113RNA PCR Primer, Index 1 (96% over 28bp)
TGAGAACTGAATTCCATAGATGGTGGAATTCTCGGGTGCCAAGGAACTCC327840.210376022113097RNA PCR Primer, Index 1 (100% over 27bp)
TGGACAACTCTTAGCGGTGGAATTCTCGGGTGCCAAGGAACTCCAGTCAC327760.21032468584610992RNA PCR Primer, Index 1 (100% over 33bp)
TCTACAGTCCGACGATCTGGAATTCTCGGGTGCCAAGGAACTCCAGTCAC321800.20650013395557168RNA PCR Primer, Index 1 (100% over 33bp)
TCAGTAACTGGAATCTGTCCCTGTGGAATTCTCGGGTGCCAAGGAACTCC298980.1918564637975041RNA PCR Primer, Index 1 (100% over 27bp)
AGTTCTACAGTCCGACGATCTGGAATTCTCGGGTGCCAAGGAACTCCAGT292660.18780089870552394RNA PCR Primer, Index 1 (100% over 30bp)
TCCCATATGGTCTAGCGGTTAGGATTCCTTGGAATTCTCGGGTGCCAAGG283190.18172396810092709Illumina Small RNA Adapter 2 (100% over 21bp)
TGGAATTCTCGGGTGCCAAGGAACTCCAGTCACTAGCTTACTCGTATGCC279720.17949725752036205RNA PCR Primer, Index 10 (97% over 40bp)
TCCCTGGTGGTCTAGTGGTTAGGATTCGGCGCTCTGGAATTCTCGGGTGC269500.17293904941276123No Hit
ACAGTCCGACGATCTGGAATTCTCGGGTGCCAAGGAACTCCAGTCACTAG255800.16414771369122197RNA PCR Primer, Index 7 (97% over 36bp)
TAGCAGCACGTAAATATTGGAGTGGAATTCTCGGGTGCCAAGGAACTCCA236760.15192968214829441RNA PCR Primer, Index 1 (100% over 28bp)
TGGAATTCTCGGGTGCCAAGGACTCCAGTCACTAGCTTATCTCGTATGCC235610.15119172331035502Illumina PCR Primer Index 10 (96% over 31bp)
TTCTACAGTCCGACGATCTGGAATTCTCGGGTGCCAAGGAACTCCAGTCA235580.15117247221023486RNA PCR Primer, Index 1 (100% over 32bp)
TGTAAACATCCTACACTCAGCTTGGAATTCTCGGGTGCCAAGGAACTCCA234710.15061419030675025RNA PCR Primer, Index 1 (100% over 28bp)
GCATTGGTGGTTCAGTGGTAGAATTCTCGCCTTGGAATTCTCGGGTGCCA231170.14834256049257147No Hit
TGGAATTCTCGGGTGCCAAGGAACTCCAGTCACTTGCTTATCTCGTATGC222160.1425608134231504RNA PCR Primer, Index 10 (98% over 50bp)
TAACACTGTCTGGTAACGATGTTGGAATTCTCGGGTGCCAAGGAACTCCA219060.14057153307740067RNA PCR Primer, Index 1 (100% over 28bp)
TAGTTCTACAGTCCGACGATCTGGAATTCTCGGGTGCCAAGGAACTCCAG216780.13910844946826859RNA PCR Primer, Index 1 (100% over 29bp)
TGAGAACTGAATTCCATAGATGTGGAATTCTCGGGTGCCAAGGAACTCCA216140.13869775933237186RNA PCR Primer, Index 1 (100% over 28bp)
GTTCTACAGTCCGACGTGGAATTCTCGGGTGCCAAGGAACTCCAGTCACT209840.13465502830713846RNA PCR Primer, Index 3 (100% over 34bp)
CATTATTACTTTTGGTACGCGTGGAATTCTCGGGTGCCAAGGAACTCCAG206970.1328133397289766RNA PCR Primer, Index 1 (100% over 29bp)
CAGAGTTCTACAGTCCGACGATCTGGAATTCTCGGGTGCCAAGGAACTCC202110.12969466150951084RNA PCR Primer, Index 1 (100% over 27bp)
TGTAACAGCAACTCCATGTGGATGGAATTCTCGGGTGCCAAGGAACTCCA201150.12907862630566574RNA PCR Primer, Index 1 (100% over 28bp)
TACAGTCCGACGATCTGGAATTCTCGGGTGCCAAGGAACTCCAGTCACTA200460.1286358510029021RNA PCR Primer, Index 7 (97% over 35bp)
ACAGTAGTCTGCACATTGGTTTGGAATTCTCGGGTGCCAAGGAACTCCAG198570.1274230316953321RNA PCR Primer, Index 1 (100% over 29bp)
TGGAATTCTCGGGTGCCAAGGAATCCAGTCACTAGCTTATCTCGTATGCC198010.12706367782642244TruSeq Adapter, Index 10 (96% over 29bp)
GCCCGGCTAGCTCAGTCGGTAGAGCATGAGACTCTTAATCTTGGAATTCT196780.12627438272149594No Hit
CCGTCGAGCAGCATTCCGGGCTTCACATCGGAGGGCTCCAGCCGGCCCCG195650.12554925795030328No Hit
TATTGCACTTGTCCCGGCCTGTTTGGAATTCTCGGGTGCCAAGGAACTCC190320.12212897916228838RNA PCR Primer, Index 1 (100% over 27bp)
TGGAATTCTCGGGTGCCAGGAACTCCAGTCACTAGCTTATCTCGTATGCC184940.11867661520740655RNA PCR Primer, Index 10 (97% over 35bp)
GCATTGGTGGTTCAGTGGTAGAATTCTCTGGAATTCTCGGGTGCCAAGGA184180.1181889206710292RNA PCR Primer, Index 1 (100% over 22bp)
TTCACAGTGGCTAAGTTCTGTGGAATTCTCGGGTGCCAAGGAACTCCAGT181520.11648198979370841RNA PCR Primer, Index 1 (100% over 30bp)
GTTGGGCGCCATGGAATTCTCGGGTGCCAAGGAACTCCAGTCACTAGCTT178620.11462105011542639RNA PCR Primer, Index 10 (100% over 39bp)
TTCACAGTGGTTAAGTTCTGTGGAATTCTCGGGTGCCAAGGAACTCCAGT171760.11021896522128338RNA PCR Primer, Index 1 (100% over 30bp)
CATTGCACTTGTCTCGGTCTGATGGAATTCTCGGGTGCCAAGGAACTCCA166420.10679226939989507RNA PCR Primer, Index 1 (100% over 28bp)
AACATTCAACGCTGTCGGTGATGGAATTCTCGGGTGCCAAGGAACTCCAG164340.10545752645823073RNA PCR Primer, Index 1 (100% over 29bp)
TTCACAGTGGTTAAGTTCTGCCTGGAATTCTCGGGTGCCAAGGAACTCCA163860.1051495088563082RNA PCR Primer, Index 1 (100% over 28bp)
AGAGTTCTACAGTCCGACGATCTGGAATTCTCGGGTGCCAAGGAACTCCA162490.10427037528415427RNA PCR Primer, Index 1 (100% over 28bp)
TGAGGTAGTAGATTGAATAGTTTGGAATTCTCGGGTGCCAAGGAACTCCA161890.10388535328175108RNA PCR Primer, Index 1 (100% over 28bp)
TTCACAGTGGCTAAGTTCTGCTGGAATTCTCGGGTGCCAAGGAACTCCAG160380.10291638124236974RNA PCR Primer, Index 1 (100% over 29bp)
AGCCTGTGATGATACAAGTTATCCCTGTCTGAACTCTGGTGTGGAATTCT159300.10222334163804403No Hit

[WARN]Adapter Content

Adapter graph

[FAIL]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
TAGACGG1400.044.04631
TGCATAT1400.044.04631
TCCTTCA351.4357283E-744.04631
TTGGCAC302.5115332E-644.046291
TTAATGC502.7284841E-1144.046291
TCGCATA207.858843E-444.00078241
TCGCGTA551.8189894E-1244.00078241
ATAATCG4550.044.00050416
GGTATGT2700.044.00050417
ATAGGCG600.044.000516
TAGAAAT207.859091E-444.000517
ATAGAAA207.859091E-444.000516
GTATCAT551.8189894E-1244.000518
TATAAGC1850.044.000516
ATATTAG700.044.00036214
TAATATA1850.044.0003613
CAACATA254.4452092E-544.0003613
ATTCCTA551.8189894E-1244.0003612
TCAATAC254.4452092E-544.0003612
TTAAGTA551.8189894E-1244.0003612