FastQCFastQC Report
Mon 5 Dec 2016
JM12_3_CGTACG_L005_R1_001.fastq

Summary

[OK]Basic Statistics

MeasureValue
FilenameJM12_3_CGTACG_L005_R1_001.fastq
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences10390732
Sequences flagged as poor quality0
Sequence length50
%GC52

[OK]Per base sequence quality

Per base quality graph

[OK]Per tile sequence quality

Per base quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[FAIL]Per base sequence content

Per base sequence content

[FAIL]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[OK]Sequence Length Distribution

Sequence length distribution

[FAIL]Sequence Duplication Levels

Duplication level graph

[FAIL]Overrepresented sequences

SequenceCountPercentagePossible Source
TGGAATTCTCGGGTGCCAAGGAACTCCAGTCACCGTACGATCTCGTATGC362229834.86085484641506RNA PCR Primer, Index 22 (100% over 50bp)
TTCAAGTAATCCAGGATAGGCTTGGAATTCTCGGGTGCCAAGGAACTCCA2662212.562100533436913RNA PCR Primer, Index 1 (100% over 28bp)
TGAGGTAGTAGGTTGTATAGTTTGGAATTCTCGGGTGCCAAGGAACTCCA1130151.0876519575329247RNA PCR Primer, Index 1 (100% over 28bp)
TAGCTTATCAGACTGGTGTTGGCTGGAATTCTCGGGTGCCAAGGAACTCC1066771.026655292427906RNA PCR Primer, Index 1 (100% over 27bp)
TGGAGTGTGACAATGGTGTTTGTGGAATTCTCGGGTGCCAAGGAACTCCA1010550.9725493834313117RNA PCR Primer, Index 1 (100% over 28bp)
AAGCTGCCAGCTGAAGAACTGTTGGAATTCTCGGGTGCCAAGGAACTCCA936040.9008412496828905RNA PCR Primer, Index 1 (100% over 28bp)
ATGACCTATGAATTGACAGCCATGGAATTCTCGGGTGCCAAGGAACTCCA902360.8684277488823694RNA PCR Primer, Index 1 (100% over 28bp)
ATGACCTATGAATTGACAGCCTGGAATTCTCGGGTGCCAAGGAACTCCAG881520.8483714140639947RNA PCR Primer, Index 1 (100% over 29bp)
TATTGCACTTGTCCCGGCCTGTTGGAATTCTCGGGTGCCAAGGAACTCCA860330.827978240609035RNA PCR Primer, Index 1 (100% over 28bp)
GCATTGGTGGTTCAGTGGTAGAATTCTCGCCTTGGAATTCTCGGGTGCCA857570.8253220273605363No Hit
CCGTCGAGCAGCATTCCGGGCTTCACATCGGAGGGCTCCAGCCGGCCCCG756920.7284568594397391No Hit
AACATTCAACGCTGTCGGTGAGTTGGAATTCTCGGGTGCCAAGGAACTCC753750.7254060637883838RNA PCR Primer, Index 1 (100% over 27bp)
AACATTCAACGCTGTCGGTGAGTGGAATTCTCGGGTGCCAAGGAACTCCA729840.7023951729291065RNA PCR Primer, Index 1 (100% over 28bp)
AGCCTGTGATGATACAAGTTATCCCTGTCTGAACTCTGGTGTGGAATTCT621550.5981772987697113No Hit
TCCCTGGTGGTCTAGTGGTTAGGATTCGGCGCTCTGGAATTCTCGGGTGC533360.5133035863113398No Hit
TAACGGAACCCATAATGCAGCTGTGGAATTCTCGGGTGCCAAGGAACTCC529020.5091267872176859RNA PCR Primer, Index 1 (100% over 27bp)
GTTCTACAGTCCGACTGGAATTCTCGGGTGCCAAGGAACTCCAGTCACCG506760.48770384993088073RNA PCR Primer, Index 2 (100% over 35bp)
TGGAGTGTGACAATGGTGTTTGTTGGAATTCTCGGGTGCCAAGGAACTCC480910.46282591062881806RNA PCR Primer, Index 1 (100% over 27bp)
TTGCGGCCCCGGGTTCCTCCCGGGGCTACGCCTGTCTGAGGGTCGCTTGG472220.4544626884804651No Hit
ACCACGTTCCCGTGGTGGAATTCTCGGGTGCCAAGGAACTCCAGTCACCG455380.4382559380802046RNA PCR Primer, Index 2 (100% over 35bp)
TGGAGTGTGACAATGGTGTTTTGGAATTCTCGGGTGCCAAGGAACTCCAG454380.43729354197567605RNA PCR Primer, Index 1 (100% over 29bp)
TCAGTAACTGGAATCTGTCCCTTGGAATTCTCGGGTGCCAAGGAACTCCA447030.43021993060739133RNA PCR Primer, Index 1 (100% over 28bp)
CATGGAATTCTCGGGTGCCAAGGAACTCCAGTCACCGTACGATCTCGTAT442120.42549456573415617RNA PCR Primer, Index 22 (100% over 48bp)
TTCAAGTAATCCAGGATAGGTTTGGAATTCTCGGGTGCCAAGGAACTCCA431800.4155626379354217RNA PCR Primer, Index 1 (100% over 28bp)
CTACAGTCCGACGATCTGGAATTCTCGGGTGCCAAGGAACTCCAGTCACC384130.3696852156325464RNA PCR Primer, Index 2 (100% over 34bp)
TGAGAACTGAATTCCATAGATGGTGGAATTCTCGGGTGCCAAGGAACTCC383700.3692713853075991RNA PCR Primer, Index 1 (100% over 27bp)
CCTGTCTGAGGGTCGCTTGGAATTCTCGGGTGCCAAGGAACTCCAGTCAC383520.369098154008784RNA PCR Primer, Index 1 (100% over 33bp)
TGAGATGAAGCACTGTAGCTCTTGGAATTCTCGGGTGCCAAGGAACTCCA354120.340803708535645RNA PCR Primer, Index 1 (100% over 28bp)
AGTTCTACAGTCCGACGATCTGGAATTCTCGGGTGCCAAGGAACTCCAGT331710.31923641183316054RNA PCR Primer, Index 1 (100% over 30bp)
TGGACGTGATGAGCAGGTGTTACCGCCCCAGTCTGATGTTTGGTGACTGA330510.3180815365077263No Hit
ATCCATGATGACATTAAAACATAACGTGACTGTTGGATGAAGCTTGCGGA313540.3017496746138771No Hit
GCATTGTGGTTCAGTGGTAGAATTCTCGCCTTGGAATTCTCGGGTGCCAA303060.291663763438418No Hit
GATCCATGATGACATTAAAACATAACGTGACTGTTGGATGAAGCTTGCGG288970.27810360232561093No Hit
TCCCTGTGGTCTAGTGGTTAGGATTCGGCGCTCTGGAATTCTCGGGTGCC286140.27538002134979517No Hit
TAGCTTATCAGACTGGTGTTGGTGGAATTCTCGGGTGCCAAGGAACTCCA286120.2753607734277046RNA PCR Primer, Index 1 (100% over 28bp)
CACCACGTTCCCGTGGTGGAATTCTCGGGTGCCAAGGAACTCCAGTCACC282690.2720597547891717RNA PCR Primer, Index 2 (100% over 34bp)
TGAGATGAAGCACTGTAGCTCTGGAATTCTCGGGTGCCAAGGAACTCCAG280650.2700964667359335RNA PCR Primer, Index 1 (100% over 29bp)
TAGTTCTACAGTCCGACGATCTGGAATTCTCGGGTGCCAAGGAACTCCAG269330.2592021428326705RNA PCR Primer, Index 1 (100% over 29bp)
TCTACAGTCCGACGATCTGGAATTCTCGGGTGCCAAGGAACTCCAGTCAC261010.2511950072429931RNA PCR Primer, Index 1 (100% over 33bp)
TTCCAGTGATGACAGCCTATAATCTGACTTGGAATTCTCGGGTGCCAAGG252280.24279328925045895Illumina Small RNA Adapter 2 (100% over 21bp)
ACAGTCCGACGATCTGGAATTCTCGGGTGCCAAGGAACTCCAGTCACCGT242250.23314045632203775RNA PCR Primer, Index 12 (97% over 36bp)
AGAGATGATGACTTCTGTTACCGCCCCAGTCTGAGAAGTCATGACTGATC235110.22626894813570403No Hit
GGACAACTCTTAGCGGTGGAATTCTCGGGTGCCAAGGAACTCCAGTCACC229710.22107200917124994RNA PCR Primer, Index 2 (100% over 34bp)
TGAGGTAGTAGTTTGTATAGTTTGGAATTCTCGGGTGCCAAGGAACTCCA229460.2208314101451178RNA PCR Primer, Index 1 (100% over 28bp)
TCCAGTGATGACAGCCTATAATCTGACTTGGAATTCTCGGGTGCCAAGGA222520.21415238117968974RNA PCR Primer, Index 1 (100% over 22bp)
TAACACTGTCTGGTAACGATGTTGGAATTCTCGGGTGCCAAGGAACTCCA216190.2080604138380241RNA PCR Primer, Index 1 (100% over 28bp)
TGGCTGTGATGAGAAACTTGCCCTCACTGAAACGTGATTGAGACATCTTT215830.20771395124039382No Hit
AACATTCAACGCTGTCGGTGATGGAATTCTCGGGTGCCAAGGAACTCCAG212400.20441293260186097RNA PCR Primer, Index 1 (100% over 29bp)
TGGACAACTCTTAGCGGTGGAATTCTCGGGTGCCAAGGAACTCCAGTCAC206350.1985904361694633RNA PCR Primer, Index 1 (100% over 33bp)
TGAGGTAGTAGGTTGTATAGTTGGAATTCTCGGGTGCCAAGGAACTCCAG206180.19842682883169346RNA PCR Primer, Index 1 (100% over 29bp)
CATTGCACTTGTCTCGGTCTGATGGAATTCTCGGGTGCCAAGGAACTCCA204580.19688699506444785RNA PCR Primer, Index 1 (100% over 28bp)
TTCAGTGATGTTTGACAAATGTCTGACCTGAACTGCAATGTGGACAGATC199830.19231561356793728No Hit
TTCTACAGTCCGACGATCTGGAATTCTCGGGTGCCAAGGAACTCCAGTCA198660.1911896101256389RNA PCR Primer, Index 1 (100% over 32bp)
TGTAAACATCCTACACTCTCAGCTTGGAATTCTCGGGTGCCAAGGAACTC197040.18963052843630265RNA PCR Primer, Index 1 (100% over 26bp)
TGTAAACATCCTTGACTGGAAGCTTGGAATTCTCGGGTGCCAAGGAACTC196460.1890723386956761RNA PCR Primer, Index 1 (100% over 26bp)
TACAGTCCGACGATCTGGAATTCTCGGGTGCCAAGGAACTCCAGTCACCG194620.1873015298633436RNA PCR Primer, Index 2 (100% over 35bp)
TTCACAGTGGCTAAGTTCTGTGGAATTCTCGGGTGCCAAGGAACTCCAGT191870.18465494057589013RNA PCR Primer, Index 1 (100% over 30bp)
ACTGTATAAGGTACATATGGTTGAGTGTCGTATGGAATTCTCGGGTGCCA190680.18350968921150118No Hit
GTTTCCGTAGTGTAGTGGTTATCACGTTCGCCTTGGAATTCTCGGGTGCC186400.17939063388411905No Hit
TATTGCACTTGTCCCGGCCTGTTTGGAATTCTCGGGTGCCAAGGAACTCC184720.1777738084285111RNA PCR Primer, Index 1 (100% over 27bp)
GCCTGTGATGATACAAGTTATCCCTGTCTGAACTCTGGTGTGGAATTCTC183180.17629171842753716No Hit
AGAGTTCTACAGTCCGACGATCTGGAATTCTCGGGTGCCAAGGAACTCCA179010.17227852667165316RNA PCR Primer, Index 1 (100% over 28bp)
GTTTCCGTAGTGTAGTGGTTATCACGTTCGCCTCTGGAATTCTCGGGTGC178830.17210529537283803No Hit
CAGAGTTCTACAGTCCGACGATCTGGAATTCTCGGGTGCCAAGGAACTCC176510.16987253641033181RNA PCR Primer, Index 1 (100% over 27bp)
GCATTGGTGGTTCAGTGGTAGAATTCTCGCCTGGAATTCTCGGGTGCCAA176270.16964156134524497No Hit
TCAGTAACTGGAATCTGTCCCTGTGGAATTCTCGGGTGCCAAGGAACTCC169900.1635110981593982RNA PCR Primer, Index 1 (100% over 27bp)
TGAGAACTGAATTCCATAGATGTGGAATTCTCGGGTGCCAAGGAACTCCA169840.1634533543931265RNA PCR Primer, Index 1 (100% over 28bp)
CATTATTACTTTTGGTACGCGTGGAATTCTCGGGTGCCAAGGAACTCCAG166190.15994060861159734RNA PCR Primer, Index 1 (100% over 29bp)
GTTCTACAGTCCGACGTGGAATTCTCGGGTGCCAAGGAACTCCAGTCACC163380.15723627555787215RNA PCR Primer, Index 2 (100% over 34bp)
TGAGGTAGTAGGTTGTATAGTTTTGGAATTCTCGGGTGCCAAGGAACTCC161290.15522486769940752RNA PCR Primer, Index 1 (100% over 27bp)
TATTGCACTTGTCCCGGCCTGTATGGAATTCTCGGGTGCCAAGGAACTCC160310.15428171951696953RNA PCR Primer, Index 1 (100% over 27bp)
AACTCTTAGCGGTGGATCACTCGGCTCGTGCGTCGATGAAGAACGCAGCT157780.15184685737251236No Hit
TAACACTGTCTGGTAACGATGTGGAATTCTCGGGTGCCAAGGAACTCCAG149660.14403220100374065RNA PCR Primer, Index 1 (100% over 29bp)
TCCCTGGTGGTCTAGTGGTTAGGATTCGGCGCTTGGAATTCTCGGGTGCC147460.14191492957377785No Hit
TCGTACCGTGAGTAATAATGCTGGAATTCTCGGGTGCCAAGGAACTCCAG146690.1411738845732909RNA PCR Primer, Index 1 (100% over 29bp)
TGTAACAGCAACTCCATGTGGATGGAATTCTCGGGTGCCAAGGAACTCCA144970.1395185632735018RNA PCR Primer, Index 1 (100% over 28bp)
TTCACAGTGGCTAAGTTCTGCTGGAATTCTCGGGTGCCAAGGAACTCCAG143690.13828669625970527RNA PCR Primer, Index 1 (100% over 29bp)
TTCAAGTAATCCAGGATAGGTGGAATTCTCGGGTGCCAAGGAACTCCAGT142680.13731467619413149RNA PCR Primer, Index 1 (100% over 30bp)
ATCTATTGATGAAACAAACACTTCGGATCTGACTTCTGAGTTGGAATTCT137200.13204074554131506No Hit
TAGCAGCACGTAAATATTGGAGTGGAATTCTCGGGTGCCAAGGAACTCCA136780.1316365391774131RNA PCR Primer, Index 1 (100% over 28bp)
TACCCTGTAGATCCGGATTTGTTGGAATTCTCGGGTGCCAAGGAACTCCA134710.12964437924103903RNA PCR Primer, Index 1 (100% over 28bp)
TTCAAGTAATCCAGGATAGGCTTTGGAATTCTCGGGTGCCAAGGAACTCC134350.12929791664340876RNA PCR Primer, Index 1 (100% over 27bp)
ACAGTAGTCTGCACATTGGTTTGGAATTCTCGGGTGCCAAGGAACTCCAG134250.1292016770329559RNA PCR Primer, Index 1 (100% over 29bp)
TGGAATTCTCGGGTGCCAGGAACTCCAGTCACCGTACGATCTCGTATGCC133990.12895145404577849RNA PCR Primer, Index 22 (97% over 35bp)
TCGTACCGTGAGTAATAATGCATGGAATTCTCGGGTGCCAAGGAACTCCA131630.12668019923909116RNA PCR Primer, Index 1 (100% over 28bp)
GCCCGGCTAGCTCAGTCGGTAGAGCATGAGACTCTTAATCTTGGAATTCT131530.12658395962863828No Hit
TGTAAACATCCTACACTCAGCTTGGAATTCTCGGGTGCCAAGGAACTCCA128180.12335993267846769RNA PCR Primer, Index 1 (100% over 28bp)
TTCAAGTAATCCAGGATAGGCTGGAATTCTCGGGTGCCAAGGAACTCCAG127900.1230904617691997RNA PCR Primer, Index 1 (100% over 29bp)
TGAGATGAAGCACTGTAGCTTGGAATTCTCGGGTGCCAAGGAACTCCAGT127650.12284986274306757RNA PCR Primer, Index 1 (100% over 30bp)
TGTTGCTGGAGAAAAAGTTACACCTCTGACCTGGAATTCTCGGGTGCCAA122180.11758555605129647No Hit
TACCCTGTAGAACCGAATTTGCGTGGAATTCTCGGGTGCCAAGGAACTCC121330.11676751936244723RNA PCR Primer, Index 1 (100% over 27bp)
TGGAATTCTCGGGTGCCAAGGAACTCCAGTCAACGTACGATCTCGTATGC120980.11643068072586223RNA PCR Primer, Index 22 (98% over 50bp)
TCGCTGCGATCCATTGAAAGTCAGCCCTCGATCCAAGTTTTTGTTGGAAT120180.11566076384223942No Hit
TATTGCACTTGTCCCGGCCTGTATTGGAATTCTCGGGTGCCAAGGAACTC115200.11086803124168731RNA PCR Primer, Index 1 (100% over 26bp)
TTCACAGTGGTTAAGTTCTGTGGAATTCTCGGGTGCCAAGGAACTCCAGT112470.10824068987632442RNA PCR Primer, Index 1 (100% over 30bp)
TCCTCCCGGGGCTACGCCTGTCTGAGGGTCGCTTGGAATTCTCGGGTGCC108420.10434298565298383No Hit
TGAGGTAGTAGATTGAATAGTTTGGAATTCTCGGGTGCCAAGGAACTCCA107990.10392915532803657RNA PCR Primer, Index 1 (100% over 28bp)
TGAGGTAGTAGGTTGTGTGGTTTGGAATTCTCGGGTGCCAAGGAACTCCA107540.10349607708099871RNA PCR Primer, Index 1 (100% over 28bp)
CTCCCGGGGCTACGCCTGTCTGAGGGTCGCTTGGAATTCTCGGGTGCCAA106440.10243744136601733No Hit
TGAATGTGATGAAAATCCAACACCCCTGACTTGGAATTCTCGGGTGCCAA104030.10011806675410356No Hit

[WARN]Adapter Content

Adapter graph

[FAIL]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
TACTTAA1600.044.038271
GTTAACG650.044.038271
ATCAAAT1350.044.0382651
ATACTTA600.044.0172844
CGTAGGC254.4350287E-544.0172844
TCGTAAG254.4350287E-544.0172843
GAGGGAT351.446897E-744.00266340
CTCAATA650.043.999912
CGCGCTA207.859674E-443.999718
CTTTATT207.859674E-443.999718
ACATAGT207.859674E-443.999717
CTTTTCG600.043.99969518
TAGGAAA302.5298104E-643.99969517
CATGCGC351.4478246E-743.9990625
TATTCGA207.860233E-443.9990624
CGTTAGG254.4460052E-543.9988516
TATAGAG254.4460052E-543.9988516
GCATACC207.860419E-443.9988528
CGCCGTA1200.043.9963131
GTAATTA800.043.99567414