FastQCFastQC Report
Mon 5 Dec 2016
JM13_1_GAGTGG_L002_R1_001.fastq

Summary

[OK]Basic Statistics

MeasureValue
FilenameJM13_1_GAGTGG_L002_R1_001.fastq
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences3720410
Sequences flagged as poor quality0
Sequence length50
%GC51

[OK]Per base sequence quality

Per base quality graph

[OK]Per tile sequence quality

Per base quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[FAIL]Per base sequence content

Per base sequence content

[FAIL]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[OK]Sequence Length Distribution

Sequence length distribution

[FAIL]Sequence Duplication Levels

Duplication level graph

[FAIL]Overrepresented sequences

SequenceCountPercentagePossible Source
AACATTCAACGCTGTCGGTGAGTGGAATTCTCGGGTGCCAAGGAACTCCA3165398.508175174241549RNA PCR Primer, Index 1 (100% over 28bp)
TTCAAGTAATCCAGGATAGGCTTGGAATTCTCGGGTGCCAAGGAACTCCA2296466.172599256533554RNA PCR Primer, Index 1 (100% over 28bp)
AACATTCAACGCTGTCGGTGAGTTGGAATTCTCGGGTGCCAAGGAACTCC1650314.435828309245486RNA PCR Primer, Index 1 (100% over 27bp)
TGAGGTAGTAGGTTGTATAGTTTGGAATTCTCGGGTGCCAAGGAACTCCA1367813.6765033961310714RNA PCR Primer, Index 1 (100% over 28bp)
TGGAATTCTCGGGTGCCAAGGAACTCCAGTCACGAGTGGATCTCGTATGC1022742.748998094296059RNA PCR Primer, Index 23 (100% over 50bp)
TCACAGTGAACCGGTCTCTTTTGGAATTCTCGGGTGCCAAGGAACTCCAG622281.672611351974648RNA PCR Primer, Index 1 (100% over 29bp)
AACATTCAACGCTGTCGGTGATGGAATTCTCGGGTGCCAAGGAACTCCAG554761.4911259780508062RNA PCR Primer, Index 1 (100% over 29bp)
TCCCTGAGACCCTTAACCTGTGTGGAATTCTCGGGTGCCAAGGAACTCCA458391.2320953873363418RNA PCR Primer, Index 1 (100% over 28bp)
TGGAATTCTCGGGTGCCAAGGAACTCCAGTCCCGAGTGGATCTCGTATGC447471.2027437836152466RNA PCR Primer, Index 23 (98% over 50bp)
TAAAGCTAGAGAACCGAAAGTATGGAATTCTCGGGTGCCAAGGAACTCCA427181.1482067836609406RNA PCR Primer, Index 1 (100% over 28bp)
AACCCGTAGATCCGAACTTGTGTGGAATTCTCGGGTGCCAAGGAACTCCA382871.0291070070234194RNA PCR Primer, Index 1 (100% over 28bp)
TATTGCACTCGTCCCGGCCTCCTGGAATTCTCGGGTGCCAAGGAACTCCA367820.9886544762539612RNA PCR Primer, Index 1 (100% over 28bp)
TCCCTGAGACCCTTAACCTGTTGGAATTCTCGGGTGCCAAGGAACTCCAG337130.9061635679938501RNA PCR Primer, Index 1 (100% over 29bp)
TGAGGTAGTAGGTTGTATAGTTGGAATTCTCGGGTGCCAAGGAACTCCAG331670.8914877661333025RNA PCR Primer, Index 1 (100% over 29bp)
AGCTACATCTGGCTACTGGGTCTCTGGAATTCTCGGGTGCCAAGGAACTC310300.8340478603164706RNA PCR Primer, Index 1 (100% over 26bp)
TGAGGTAGTAGTTTGTGCTGTTTGGAATTCTCGGGTGCCAAGGAACTCCA290790.7816074034850998RNA PCR Primer, Index 1 (100% over 28bp)
TGAGGTAGTAGTTTGTATAGTTTGGAATTCTCGGGTGCCAAGGAACTCCA279330.7508043468327416RNA PCR Primer, Index 1 (100% over 28bp)
TCTTTGGTTATCTAGCTGTATGATGGAATTCTCGGGTGCCAAGGAACTCC276250.7425256893729455RNA PCR Primer, Index 1 (100% over 27bp)
TCCAGCATCAGTGATTTTGTTTGGAATTCTCGGGTGCCAAGGAACTCCAG265970.7148943261629767RNA PCR Primer, Index 1 (100% over 29bp)
TAAAGCTAGAGAACCGAAAGTTGGAATTCTCGGGTGCCAAGGAACTCCAG261290.7023150674253644RNA PCR Primer, Index 1 (100% over 29bp)
TCTTTGGTTATCTAGCTGTATTGGAATTCTCGGGTGCCAAGGAACTCCAG253990.6826935740953283RNA PCR Primer, Index 1 (100% over 29bp)
AACATTCATTGCTGTCGGTGGGTGGAATTCTCGGGTGCCAAGGAACTCCA248590.6681790447826986RNA PCR Primer, Index 1 (100% over 28bp)
TCCCTGAGACCCTTAACCTGTGATGGAATTCTCGGGTGCCAAGGAACTCC243420.6542827269037552RNA PCR Primer, Index 1 (100% over 27bp)
TCCCTGAGACCCTAACTTGTGATGGAATTCTCGGGTGCCAAGGAACTCCA222300.597514790036582RNA PCR Primer, Index 1 (100% over 28bp)
TTAAAGGGAATTTGCGACTGTTTGGAATTCTCGGGTGCCAAGGAACTCCA193890.5211522385973588RNA PCR Primer, Index 1 (100% over 28bp)
AAGCTGCCAGCTGAAGAACTGTTGGAATTCTCGGGTGCCAAGGAACTCCA171370.46062127561209654RNA PCR Primer, Index 1 (100% over 28bp)
TGAGGTAGTTGGTTGTATAGTTTGGAATTCTCGGGTGCCAAGGAACTCCA150310.4040146112928414RNA PCR Primer, Index 1 (100% over 28bp)
ACCTTGGCTTTAGACTGCTTACTTGGAATTCTCGGGTGCCAAGGAACTCC148280.3985582234216121RNA PCR Primer, Index 1 (100% over 27bp)
TCTTTGGTTATCTAGCTGTATGTGGAATTCTCGGGTGCCAAGGAACTCCA144160.3874841751312355RNA PCR Primer, Index 1 (100% over 28bp)
AACATTCATTGCTGTCGGTGGGTTGGAATTCTCGGGTGCCAAGGAACTCC141220.3795818202832484RNA PCR Primer, Index 1 (100% over 27bp)
CCCTGAGACCCTTAACCTGTGATGGAATTCTCGGGTGCCAAGGAACTCCA138380.3719482530151247RNA PCR Primer, Index 1 (100% over 28bp)
TAGCTTATCAGACTGGTGTTGGCTGGAATTCTCGGGTGCCAAGGAACTCC137700.37012049747205283RNA PCR Primer, Index 1 (100% over 27bp)
TCACAGTGAACCGGTCTCTTTTTGGAATTCTCGGGTGCCAAGGAACTCCA137110.3685346507508581RNA PCR Primer, Index 1 (100% over 28bp)
TACCCTGTAGAACCGAATTTGTTGGAATTCTCGGGTGCCAAGGAACTCCA134390.36122362857857065RNA PCR Primer, Index 1 (100% over 28bp)
TTCACAGTGGCTAAGTTCTGCTGGAATTCTCGGGTGCCAAGGAACTCCAG131230.35272994105488376RNA PCR Primer, Index 1 (100% over 29bp)
TTCAAGTAATCCAGGATAGGCTGGAATTCTCGGGTGCCAAGGAACTCCAG126500.3400162885273397RNA PCR Primer, Index 1 (100% over 29bp)
TAACAGTCTACAGTCATGGCTTGGAATTCTCGGGTGCCAAGGAACTCCAG114020.3064715985603737RNA PCR Primer, Index 1 (100% over 29bp)
TATTGCACTTGTCCCGGCCTGTTGGAATTCTCGGGTGCCAAGGAACTCCA105720.28416222943170244RNA PCR Primer, Index 1 (100% over 28bp)
TTGCATAGTCACAAAAGTGATCTGGAATTCTCGGGTGCCAAGGAACTCCA104390.2805873546195178RNA PCR Primer, Index 1 (100% over 28bp)
TACCCTGTAGATCCGGATTTGTTGGAATTCTCGGGTGCCAAGGAACTCCA100740.27077660795449965RNA PCR Primer, Index 1 (100% over 28bp)
TGAGATGAAGCACTGTAGCTCTTGGAATTCTCGGGTGCCAAGGAACTCCA98470.26467512989159797RNA PCR Primer, Index 1 (100% over 28bp)
TGAGGTAGTAGGTTGTATAGTTTTGGAATTCTCGGGTGCCAAGGAACTCC98410.2645138573436798RNA PCR Primer, Index 1 (100% over 27bp)
TCCAGCATCAGTGATTTTGTTGTGGAATTCTCGGGTGCCAAGGAACTCCA97770.2627936168325534RNA PCR Primer, Index 1 (100% over 28bp)
CCCTGCGACCCTTAACCTGTGATGGAATTCTCGGGTGCCAAGGAACTCCA95830.2575791377832013RNA PCR Primer, Index 1 (100% over 28bp)
AACCCGTAGATCCGAACTTGTTGGAATTCTCGGGTGCCAAGGAACTCCAG94620.2543268080668528RNA PCR Primer, Index 1 (100% over 29bp)
TTCACCGTGGCTAAGTTCTGCTGGAATTCTCGGGTGCCAAGGAACTCCAG91200.2451342728355208RNA PCR Primer, Index 1 (100% over 29bp)
AGCTACATCTGGCTACTGGGTCTTGGAATTCTCGGGTGCCAAGGAACTCC88160.23696313040767014RNA PCR Primer, Index 1 (100% over 27bp)
TAAAGCTAGAGAACCGAAAGTAATGGAATTCTCGGGTGCCAAGGAACTCC86680.23298507422569018RNA PCR Primer, Index 1 (100% over 27bp)
CCACGTTCCCGTGGTGGAATTCTCGGGTGCCAAGGAACTCCAGTCACGAG85710.23037783470101414RNA PCR Primer, Index 7 (97% over 36bp)
TCCCTGAGACCCTAACTTGTGTGGAATTCTCGGGTGCCAAGGAACTCCAG84610.22742117132251552RNA PCR Primer, Index 1 (100% over 29bp)
ACCGTGGCTTTAGATTGTTACTTGGAATTCTCGGGTGCCAAGGAACTCCA83950.2256471732954164RNA PCR Primer, Index 1 (100% over 28bp)
AGCTACATTGTCTGCTGGGTTTTGGAATTCTCGGGTGCCAAGGAACTCCA83500.22443762918603055RNA PCR Primer, Index 1 (100% over 28bp)
ATTGATCATCGACACTTCGAACGCACCTTGCGGCCCCGGGTTTGGAATTC83370.22408820533220802No Hit
TCTTTGGTTATCTAGCTGTATGTTGGAATTCTCGGGTGCCAAGGAACTCC83210.2236581452044264RNA PCR Primer, Index 1 (100% over 27bp)
TTCCCTTTGTCATCCTATGCCTTGGAATTCTCGGGTGCCAAGGAACTCCA82970.22301305501275398RNA PCR Primer, Index 1 (100% over 28bp)
TAAAGGGAATTTGCGACTGTTTGGAATTCTCGGGTGCCAAGGAACTCCAG82400.221480965807532RNA PCR Primer, Index 1 (100% over 29bp)
AAGCTGCCAGTTGAAGAGCTGTTGGAATTCTCGGGTGCCAAGGAACTCCA76630.20597192244940746RNA PCR Primer, Index 1 (100% over 28bp)
TCACAGTGAACCGGTCTCTTTGGAATTCTCGGGTGCCAAGGAACTCCAGT76280.20503116591988518RNA PCR Primer, Index 1 (100% over 30bp)
AAGCTGCCAGCTGAAGAACTTGGAATTCTCGGGTGCCAAGGAACTCCAGT74620.20056929209415092RNA PCR Primer, Index 1 (100% over 30bp)
TGGAATTCTCGGGTGCCAAGGAACTCCAGTCACGCGTGGATCTCGTATGC73850.1984996277292019RNA PCR Primer, Index 23 (98% over 50bp)
TGAGGTAGTAGGTTGTGTGGTTTGGAATTCTCGGGTGCCAAGGAACTCCA71000.19083918170309186RNA PCR Primer, Index 1 (100% over 28bp)
ACCATCGACCGTTGACTGTGCCTGGAATTCTCGGGTGCCAAGGAACTCCA70250.18882327485411554RNA PCR Primer, Index 1 (100% over 28bp)
AGAATAATGCCAGCAGTCGGTCTGGAATTCTCGGGTGCCAAGGAACTCCA69720.18739870068083894RNA PCR Primer, Index 1 (100% over 28bp)
CTTTGGTTATCTAGCTGTATGATGGAATTCTCGGGTGCCAAGGAACTCCA69610.18710303434298908RNA PCR Primer, Index 1 (100% over 28bp)
TAAAGCTAGAGAACCGAAAGTATTGGAATTCTCGGGTGCCAAGGAACTCC69050.1855978238957534RNA PCR Primer, Index 1 (100% over 27bp)
GGAATTCTCGGGTGCCAAGGAACTCCAGTCACGAGTGGATCTCGTATGCC66970.18000704223459243RNA PCR Primer, Index 23 (100% over 50bp)
AGCTACATTGTCTGCTGGGTTTCTGGAATTCTCGGGTGCCAAGGAACTCC66700.17928131576896095RNA PCR Primer, Index 1 (100% over 27bp)
TACCCTGTAGAACCGAATTTGCGTGGAATTCTCGGGTGCCAAGGAACTCC66370.17839431675541137RNA PCR Primer, Index 1 (100% over 27bp)
TCCTCCCGGGGCTACGCCTGTCTGAGGGTCGCTTGGAATTCTCGGGTGCC64910.17447001808940413No Hit
TTCAAGTAATCCAGGATAGGCTTTGGAATTCTCGGGTGCCAAGGAACTCC64490.1733411102539774RNA PCR Primer, Index 1 (100% over 27bp)
TTGCGGCCCCGGGTTCCTCCCGGGGCTACGCCTGTCTGAGGGTCGCTTGG64240.1726691413043186No Hit
AACCCGTAGATCCGAACTTGTGATGGAATTCTCGGGTGCCAAGGAACTCC63570.1708682645192331RNA PCR Primer, Index 1 (100% over 27bp)
CCTGTCTGAGGGTCGCTTGGAATTCTCGGGTGCCAAGGAACTCCAGTCAC61980.1665945419994033RNA PCR Primer, Index 1 (100% over 33bp)
TGAGGTAGTTGGTTGTATTGTTTGGAATTCTCGGGTGCCAAGGAACTCCA61790.16608384559766262RNA PCR Primer, Index 1 (100% over 28bp)
TGGAATTCTCGGGTGCCAAGGAACTCCAGTCCCGCGTGGATCTCGTATGC59820.16078873027435148RNA PCR Primer, Index 6 (97% over 35bp)
TACCCTGTAGAACCGAATGTGTTGGAATTCTCGGGTGCCAAGGAACTCCA59770.16065433648441974RNA PCR Primer, Index 1 (100% over 28bp)
AGCTGGTGTTGTGAATCAGGCCGTGGAATTCTCGGGTGCCAAGGAACTCC59030.15866530839342977RNA PCR Primer, Index 1 (100% over 27bp)
TACGACCTCAGATCAGACGAGATGGAATTCTCGGGTGCCAAGGAACTCCA58490.15721385546216682RNA PCR Primer, Index 1 (100% over 28bp)
CCTTGGCTTTAGACTGCTTACTTGGAATTCTCGGGTGCCAAGGAACTCCA58000.1558967963208356RNA PCR Primer, Index 1 (100% over 28bp)
TGAGATGAAGCACTGTAGCTCTGGAATTCTCGGGTGCCAAGGAACTCCAG57750.15522482737117682RNA PCR Primer, Index 1 (100% over 29bp)
AACATTCAACGCTGTCGGTGAGATGGAATTCTCGGGTGCCAAGGAACTCC57730.15517106985520412RNA PCR Primer, Index 1 (100% over 27bp)
TGTTGCTGGAGAAAAAGTTACACCTCTGACCTGGAATTCTCGGGTGCCAA57450.15441846463158632No Hit
ATTGATCATCGACACTTCGAACGCACCTTGCGGCCCCGGGTTGGAATTCT56230.1511392561572515No Hit
TTCACAGTGGCTAAGTTCTGTGGAATTCTCGGGTGCCAAGGAACTCCAGT54950.14769877513499857RNA PCR Primer, Index 1 (100% over 30bp)
TTCCCTTTGTCATCCTATGCCTGTGGAATTCTCGGGTGCCAAGGAACTCC54720.1470805637013125RNA PCR Primer, Index 1 (100% over 27bp)
CATTGCACTTGTCTCGGTCTGATGGAATTCTCGGGTGCCAAGGAACTCCA54380.14616668592977658RNA PCR Primer, Index 1 (100% over 28bp)
TACCCTGTAGAACCGAATTTGCTGGAATTCTCGGGTGCCAAGGAACTCCA53240.14310250751933257RNA PCR Primer, Index 1 (100% over 28bp)
TGAGGTAGTAGATTGAATAGTTTGGAATTCTCGGGTGCCAAGGAACTCCA49650.13345303340223255RNA PCR Primer, Index 1 (100% over 28bp)
ACCATCGACCGTTGACTGTGCCTTGGAATTCTCGGGTGCCAAGGAACTCC49640.1334261546442462RNA PCR Primer, Index 1 (100% over 27bp)
TTCAAGTAATCCAGGATAGGTTTGGAATTCTCGGGTGCCAAGGAACTCCA49140.13208221674492865RNA PCR Primer, Index 1 (100% over 28bp)
AGAATCATGCCAGCAGTCGGTCTGGAATTCTCGGGTGCCAAGGAACTCCA48470.13028133995984312RNA PCR Primer, Index 1 (100% over 28bp)
TGAGATGAAGCACTGTAGCTTGGAATTCTCGGGTGCCAAGGAACTCCAGT48430.13017382492789772RNA PCR Primer, Index 1 (100% over 30bp)
TGAGGTAGTAGTTTGTGCTGTTTTGGAATTCTCGGGTGCCAAGGAACTCC47700.1282116755948941RNA PCR Primer, Index 1 (100% over 27bp)
AACATTCAACGCTGTCGGTGAGTTGGAATTCTCGGGTGCCAAGGAAATCC46660.1254162847643136RNA PCR Primer, Index 1 (96% over 27bp)
GCATTGGTGGTTCAGTGGTAGAATTCTCGCCTTGGAATTCTCGGGTGCCA45560.12245962138581501No Hit
AGCAGCATTGTACAGGGCTATGATGGAATTCTCGGGTGCCAAGGAACTCC44340.11918041291148018RNA PCR Primer, Index 1 (100% over 27bp)
TGAGGTAGTAGTTTGTATAGTTGGAATTCTCGGGTGCCAAGGAACTCCAG44080.11848156520383507RNA PCR Primer, Index 1 (100% over 29bp)
AACATTCAACGCTGTCGGTGTTGGAATTCTCGGGTGCCAAGGAACTCCAG43750.1175945661902855RNA PCR Primer, Index 1 (100% over 29bp)
TCGTGTCTTGTGTTGCAGCCAGTTGGAATTCTCGGGTGCCAAGGAACTCC43240.11622374953298158RNA PCR Primer, Index 1 (100% over 27bp)
TCACAGTGAACCGGTCTCTTTGGAATTCTCGGGTGCCAAGGAACTCCCGT42300.1136971462822646RNA PCR Primer, Index 1 (96% over 30bp)
TCCCTGAGACCCTTAACCTGTGTTGGAATTCTCGGGTGCCAAGGAACTCC42290.11367026752427824RNA PCR Primer, Index 1 (100% over 27bp)
ACCATCGACCGTTGACTGTACCTGGAATTCTCGGGTGCCAAGGAACTCCA42160.11332084367045568RNA PCR Primer, Index 1 (100% over 28bp)
AAGCTGCCAGCTGAAGAACTTGGAATTCTCGGGTGCCAAGGAACTCCCGT41700.11208442080308353RNA PCR Primer, Index 1 (96% over 30bp)
AACATTCAACGCTGTCGGTGGTGGAATTCTCGGGTGCCAAGGAACTCCAG41110.11049857408188882RNA PCR Primer, Index 1 (100% over 29bp)
TGAGGTAGTTGGTTGTATAGTTGGAATTCTCGGGTGCCAAGGAACTCCAG40840.10977284761625734RNA PCR Primer, Index 1 (100% over 29bp)
TGCTCAGTAGTCAGTGTAGATCCTGGAATTCTCGGGTGCCAAGGAACTCC38370.10313379439362866RNA PCR Primer, Index 1 (100% over 27bp)
TTCAAGTAATCAAGGATAGGCTTGGAATTCTCGGGTGCCAAGGAACTCCA37860.10176297773632477RNA PCR Primer, Index 1 (100% over 28bp)

[FAIL]Adapter Content

Adapter graph

[WARN]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
CAACACG207.7775895E-444.0928571
ATCCCCC207.7775895E-444.0928571
ATTGCCC2150.044.0928571
TCCTTCA502.7284841E-1144.0928571
TTCGAGT207.7775895E-444.0928571
AACGTTC454.7111826E-1044.0928541
CTTCACG950.044.0928541
GAGAGCG14600.044.0928541
TAACACT1100.044.0928541
AGTAGAG4200.044.0928541
TTACAAT1050.044.0928541
AACATTC676650.044.0537571
TAATACC302.529092E-644.00040431
ACAAACC207.8584E-444.00040431
CCCGCGT6050.044.00040431
CCCGAGG207.8584E-444.00040431
TACGCAA351.4472971E-743.99981711
CGCAAAA351.4472971E-743.99981713
TGATAAG302.5293248E-643.99981313
AGCCGAC207.85892E-443.99981332