FastQCFastQC Report
Mon 5 Dec 2016
JM13_3_GAGTGG_L007_R1_001.fastq

Summary

[OK]Basic Statistics

MeasureValue
FilenameJM13_3_GAGTGG_L007_R1_001.fastq
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences11003172
Sequences flagged as poor quality0
Sequence length50
%GC53

[OK]Per base sequence quality

Per base quality graph

[OK]Per tile sequence quality

Per base quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[FAIL]Per base sequence content

Per base sequence content

[FAIL]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[OK]Sequence Length Distribution

Sequence length distribution

[FAIL]Sequence Duplication Levels

Duplication level graph

[FAIL]Overrepresented sequences

SequenceCountPercentagePossible Source
TGGAATTCTCGGGTGCCAAGGAACTCCAGTCACGAGTGGATCTCGTATGC445306140.47070244834853RNA PCR Primer, Index 23 (100% over 50bp)
TTCAAGTAATCCAGGATAGGCTTGGAATTCTCGGGTGCCAAGGAACTCCA1349291.2262736599954995RNA PCR Primer, Index 1 (100% over 28bp)
GCATTGGTGGTTCAGTGGTAGAATTCTCGCCTTGGAATTCTCGGGTGCCA1123531.021096462002048No Hit
CATGGAATTCTCGGGTGCCAAGGAACTCCAGTCACGAGTGGATCTCGTAT983760.894069455607892RNA PCR Primer, Index 23 (100% over 48bp)
TCAGTAACTGGAATCTGTCCCTTGGAATTCTCGGGTGCCAAGGAACTCCA954360.867349887832345RNA PCR Primer, Index 1 (100% over 28bp)
ATGACCTATGAATTGACAGCCATGGAATTCTCGGGTGCCAAGGAACTCCA917920.8342321650520413RNA PCR Primer, Index 1 (100% over 28bp)
TGAGGTAGTAGGTTGTATAGTTTGGAATTCTCGGGTGCCAAGGAACTCCA895560.8139107522812513RNA PCR Primer, Index 1 (100% over 28bp)
ATGACCTATGAATTGACAGCCTGGAATTCTCGGGTGCCAAGGAACTCCAG887150.8062675017713075RNA PCR Primer, Index 1 (100% over 29bp)
TGGAGTGTGACAATGGTGTTTGTGGAATTCTCGGGTGCCAAGGAACTCCA800730.7277265137725739RNA PCR Primer, Index 1 (100% over 28bp)
TCCCTGGTGGTCTAGTGGTTAGGATTCGGCGCTCTGGAATTCTCGGGTGC631260.5737072909521No Hit
TTGCGGCCCCGGGTTCCTCCCGGGGCTACGCCTGTCTGAGGGTCGCTTGG544320.494693711958697No Hit
TAGCTTATCAGACTGGTGTTGGCTGGAATTCTCGGGTGCCAAGGAACTCC524540.4767170775845366RNA PCR Primer, Index 1 (100% over 27bp)
CCTGTCTGAGGGTCGCTTGGAATTCTCGGGTGCCAAGGAACTCCAGTCAC516570.46947371176238994RNA PCR Primer, Index 1 (100% over 33bp)
TATTGCACTTGTCCCGGCCTGTTGGAATTCTCGGGTGCCAAGGAACTCCA507190.46094889728162025RNA PCR Primer, Index 1 (100% over 28bp)
AAGCTGCCAGCTGAAGAACTGTTGGAATTCTCGGGTGCCAAGGAACTCCA501460.4557413080518963RNA PCR Primer, Index 1 (100% over 28bp)
GCATTGGTGGTTCAGTGGTAGAATTCTCGCCTGGAATTCTCGGGTGCCAA429360.39021474898329317No Hit
TGGAGTGTGACAATGGTGTTTTGGAATTCTCGGGTGCCAAGGAACTCCAG416520.37854538673029925RNA PCR Primer, Index 1 (100% over 29bp)
TGGAATTCTCGGGTGCCAAGGAACTCCAGTCACGAGCGGATCTCGTATGC413440.3757461939157181RNA PCR Primer, Index 23 (98% over 50bp)
GCATTGTGGTTCAGTGGTAGAATTCTCGCCTTGGAATTCTCGGGTGCCAA373330.3392930693076506No Hit
TGGAATTCTCGGGTGCCAAGGAACTCCAGTCACGAGGGGATCTCGTATGC362910.32982307283754175RNA PCR Primer, Index 23 (98% over 50bp)
CCGTCGAGCAGCATTCCGGGCTTCACATCGGAGGGCTCCAGCCGGCCCCG354040.3217617610630825No Hit
TCAGTAACTGGAATCTGTCCCTGTGGAATTCTCGGGTGCCAAGGAACTCC335730.3051211050776994RNA PCR Primer, Index 1 (100% over 27bp)
TGGAGTGTGACAATGGTGTTTGTTGGAATTCTCGGGTGCCAAGGAACTCC335100.3045485429110806RNA PCR Primer, Index 1 (100% over 27bp)
TCCCTGTGGTCTAGTGGTTAGGATTCGGCGCTCTGGAATTCTCGGGTGCC332140.3018584095568078No Hit
ATCCATGATGACATTAAAACATAACGTGACTGTTGGATGAAGCTTGCGGA317440.28849862566903434No Hit
TTCAAGTAATCCAGGATAGGTTTGGAATTCTCGGGTGCCAAGGAACTCCA287900.261651821856461RNA PCR Primer, Index 1 (100% over 28bp)
AACATTCAACGCTGTCGGTGAGTGGAATTCTCGGGTGCCAAGGAACTCCA275060.24998245960346707RNA PCR Primer, Index 1 (100% over 28bp)
AACATTCAACGCTGTCGGTGAGTTGGAATTCTCGGGTGCCAAGGAACTCC269240.24469307577851188RNA PCR Primer, Index 1 (100% over 27bp)
GATCCATGATGACATTAAAACATAACGTGACTGTTGGATGAAGCTTGCGG268630.24413869018861106No Hit
GTTTCCGTAGTGTAGTGGTTATCACGTTCGCCTTGGAATTCTCGGGTGCC266180.24191205954064882No Hit
TGGACGTGATGAGCAGGTGTTACCGCCCCAGTCTGATGTTTGGTGACTGA251840.22887945403380042No Hit
ACCACGTTCCCGTGGTGGAATTCTCGGGTGCCAAGGAACTCCAGTCACGA241640.2196093999075903RNA PCR Primer, Index 7 (97% over 35bp)
AGAGATGATGACTTCTGTTACCGCCCCAGTCTGAGAAGTCATGACTGATC236750.21516522690002482No Hit
GTTCTACAGTCCGACTGGAATTCTCGGGTGCCAAGGAACTCCAGTCACGA211410.19213550419824393RNA PCR Primer, Index 7 (97% over 35bp)
TTCAGTGATGTTTGACAAATGTCTGACCTGAACTGCAATGTGGACAGATC210340.19116305734382777No Hit
TGAGGTAGTAGTTTGTATAGTTTGGAATTCTCGGGTGCCAAGGAACTCCA204500.18585549694215447RNA PCR Primer, Index 1 (100% over 28bp)
TAACGGAACCCATAATGCAGCTGTGGAATTCTCGGGTGCCAAGGAACTCC199010.18086602663304727RNA PCR Primer, Index 1 (100% over 27bp)
GGACAACTCTTAGCGGTGGAATTCTCGGGTGCCAAGGAACTCCAGTCACG196350.1784485419295454RNA PCR Primer, Index 6 (100% over 34bp)
CTACAGTCCGACGATCTGGAATTCTCGGGTGCCAAGGAACTCCAGTCACG194350.17663088425773948RNA PCR Primer, Index 6 (100% over 34bp)
CACCACGTTCCCGTGGTGGAATTCTCGGGTGCCAAGGAACTCCAGTCACG187000.16995099231385277RNA PCR Primer, Index 6 (100% over 34bp)
TGTAAACATCCTTGACTGGAAGCTTGGAATTCTCGGGTGCCAAGGAACTC182080.16547955444121024RNA PCR Primer, Index 1 (100% over 26bp)
TCCCATATGGTCTAGCGGTTAGGATTCCTTGGAATTCTCGGGTGCCAAGG177540.1613534715262108Illumina Small RNA Adapter 2 (100% over 21bp)
TGGACAACTCTTAGCGGTGGAATTCTCGGGTGCCAAGGAACTCCAGTCAC175580.15957216700784102RNA PCR Primer, Index 1 (100% over 33bp)
AGCCTGTGATGATACAAGTTATCCCTGTCTGAACTCTGGTGTGGAATTCT174460.1585542787116297No Hit
TGAGATGAAGCACTGTAGCTCTGGAATTCTCGGGTGCCAAGGAACTCCAG167580.15230153632061735RNA PCR Primer, Index 1 (100% over 29bp)
TGAGATGAAGCACTGTAGCTCTTGGAATTCTCGGGTGCCAAGGAACTCCA166210.15105644081543032RNA PCR Primer, Index 1 (100% over 28bp)
TGTAAACATCCTACACTCTCAGCTTGGAATTCTCGGGTGCCAAGGAACTC163960.14901157593464867RNA PCR Primer, Index 1 (100% over 26bp)
GCATTGTGGTTCAGTGGTAGAATTCTCGCCTGGAATTCTCGGGTGCCAAG153860.1398324046920288No Hit
TGGCTGTGATGAGAAACTTGCCCTCACTGAAACGTGATTGAGACATCTTT141050.12819030730411193No Hit
CATTATTACTTTTGGTACGCGTGGAATTCTCGGGTGCCAAGGAACTCCAG139820.1270724478359513RNA PCR Primer, Index 1 (100% over 29bp)
TGAGAACTGAATTCCATAGATGGTGGAATTCTCGGGTGCCAAGGAACTCC138050.12546382079640309RNA PCR Primer, Index 1 (100% over 27bp)
TAGCTTATCAGACTGGTGTTGGTGGAATTCTCGGGTGCCAAGGAACTCCA133780.12158312166709745RNA PCR Primer, Index 1 (100% over 28bp)
TCTACAGTCCGACGATCTGGAATTCTCGGGTGCCAAGGAACTCCAGTCAC131740.11972911084185542RNA PCR Primer, Index 1 (100% over 33bp)
TTCCAGTGATGACAGCCTATAATCTGACTTGGAATTCTCGGGTGCCAAGG131070.11912019552180043Illumina Small RNA Adapter 2 (100% over 21bp)
AGTTCTACAGTCCGACGATCTGGAATTCTCGGGTGCCAAGGAACTCCAGT130540.11863851623877188RNA PCR Primer, Index 1 (100% over 30bp)
GTTTCCGTAGTGTAGTGGTTATCACGTTCGCCTCTGGAATTCTCGGGTGC127760.11611197207496166No Hit
TGGAATTCTCGGGTGCCAAGGAAATCCAGTCACGAGTGGATCTCGTATGC125270.1138489882735633RNA PCR Primer, Index 23 (98% over 50bp)
TCAGTAACTGGAATCTGTCCCTGCTGGAATTCTCGGGTGCCAAGGAACTC122850.11164962249067814RNA PCR Primer, Index 1 (100% over 26bp)
TGAGGTAGTAGGTTGTATAGTTGGAATTCTCGGGTGCCAAGGAACTCCAG122680.11149512158857465RNA PCR Primer, Index 1 (100% over 29bp)
TGAGGTAGTAGGTTGTATAGTTTTGGAATTCTCGGGTGCCAAGGAACTCC117350.1066510638932119RNA PCR Primer, Index 1 (100% over 27bp)
CTGTCTGAGGGTCGCTTGGAATTCTCGGGTGCCAAGGAACTCCAGTCACG116580.1059512656895666RNA PCR Primer, Index 6 (100% over 34bp)
AACTCTTAGCGGTGGATCACTCGGCTCGTGCGTCGATGAAGAACGCAGCT116080.10549685127161514No Hit
TGCCTGTGATGAGACTCTCGACGGGCGGACTGAATGGGTTTTCACCCTCC115170.10466981703094345No Hit
TCCAGTGATGACAGCCTATAATCTGACTTGGAATTCTCGGGTGCCAAGGA114890.10441534495689062RNA PCR Primer, Index 1 (100% over 22bp)
TGTAAACATCCTACACTCAGCTTGGAATTCTCGGGTGCCAAGGAACTCCA114340.10391548909714399RNA PCR Primer, Index 1 (100% over 28bp)
TATTGCACTTGTCCCGGCCTGTTTGGAATTCTCGGGTGCCAAGGAACTCC114030.10363375215801407RNA PCR Primer, Index 1 (100% over 27bp)

[WARN]Adapter Content

Adapter graph

[FAIL]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
AACCAAT351.4335819E-744.054511
TCCTTCA502.7284841E-1144.054511
CGTAAGC408.305506E-944.01085744
TCGTACG351.44546E-744.0082543
ATAGATA1800.044.00205616
TCAGGCT207.8576204E-444.00205616
TAGGCAA408.3200575E-944.00205617
AGGTATT700.044.00205218
GCGTTTT351.4470606E-744.00205217
ACGGCAA1650.044.00205216
AATTGCC351.4470606E-744.00205217
GTACTGC2300.044.00205216
GCAGGTA3250.044.00205216
TATAGTA302.5288919E-644.00205216
TAGATAT1750.044.00205217
TAGGCTA1200.044.00205217
TAGGCGT600.044.00205217
TATAAGC1500.044.00205216
GGCTTCG1550.044.00185422
GCATCAC351.4472789E-744.00125521