FastQCFastQC Report
Mon 5 Dec 2016
JM13_5_TCGAAG_L004_R1_001.fastq

Summary

[OK]Basic Statistics

MeasureValue
FilenameJM13_5_TCGAAG_L004_R1_001.fastq
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences11743610
Sequences flagged as poor quality0
Sequence length50
%GC51

[OK]Per base sequence quality

Per base quality graph

[FAIL]Per tile sequence quality

Per base quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[FAIL]Per base sequence content

Per base sequence content

[FAIL]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[OK]Sequence Length Distribution

Sequence length distribution

[FAIL]Sequence Duplication Levels

Duplication level graph

[FAIL]Overrepresented sequences

SequenceCountPercentagePossible Source
TTCCCTTTGTCATCCTATGCCTTGGAATTCTCGGGTGCCAAGGAACTCCA7724596.577696296113375RNA PCR Primer, Index 1 (100% over 28bp)
TTCAAGTAATCCAGGATAGGCTTGGAATTCTCGGGTGCCAAGGAACTCCA7505726.3913226001204055RNA PCR Primer, Index 1 (100% over 28bp)
AACATTCAACGCTGTCGGTGAGTGGAATTCTCGGGTGCCAAGGAACTCCA4972194.233953613922806RNA PCR Primer, Index 1 (100% over 28bp)
AACATTCAACGCTGTCGGTGAGTTGGAATTCTCGGGTGCCAAGGAACTCC3346522.8496518532206023RNA PCR Primer, Index 1 (100% over 27bp)
TACCCTGTAGAACCGAATTTGTTGGAATTCTCGGGTGCCAAGGAACTCCA3106282.645081027043643RNA PCR Primer, Index 1 (100% over 28bp)
TAGCTTATCAGACTGGTGTTGGCTGGAATTCTCGGGTGCCAAGGAACTCC2567982.1867040884361795RNA PCR Primer, Index 1 (100% over 27bp)
TCCTTCATTCCACCGGAGTCTGTGGAATTCTCGGGTGCCAAGGAACTCCA2501502.130094579094503RNA PCR Primer, Index 1 (100% over 28bp)
TACCCTGTAGAACCGAATTTGCTGGAATTCTCGGGTGCCAAGGAACTCCA2337281.9902568290329805RNA PCR Primer, Index 1 (100% over 28bp)
TACCCTGTAGAACCGAATTTGCGTGGAATTCTCGGGTGCCAAGGAACTCC1618441.3781452211032212RNA PCR Primer, Index 1 (100% over 27bp)
AAGCTGCCAGCTGAAGAACTGTTGGAATTCTCGGGTGCCAAGGAACTCCA1565711.3332442068495123RNA PCR Primer, Index 1 (100% over 28bp)
GCATTGGTGGTTCAGTGGTAGAATTCTCGCCTTGGAATTCTCGGGTGCCA1476691.2574412808327253No Hit
AACAGTAAGAGTTTATGTGCTGTGGAATTCTCGGGTGCCAAGGAACTCCA1445311.2307203662246957RNA PCR Primer, Index 1 (100% over 28bp)
TGAGGTAGTAGGTTGTATAGTTTGGAATTCTCGGGTGCCAAGGAACTCCA1034130.880589529114131RNA PCR Primer, Index 1 (100% over 28bp)
TAACGGAACCCATAATGCAGCTGTGGAATTCTCGGGTGCCAAGGAACTCC1032960.8795932426230094RNA PCR Primer, Index 1 (100% over 27bp)
TTCACAGTGGTTAAGTTCTGTGGAATTCTCGGGTGCCAAGGAACTCCAGT1004160.8550692674569405RNA PCR Primer, Index 1 (100% over 30bp)
CCACGTTCCCGTGGTGGAATTCTCGGGTGCCAAGGAACTCCAGTCACTCG997520.8494151287380967RNA PCR Primer, Index 10 (97% over 36bp)
AACATTCAACGCTGTCGGTGATGGAATTCTCGGGTGCCAAGGAACTCCAG915340.7794366468232511RNA PCR Primer, Index 1 (100% over 29bp)
TTCACAGTGGCTAAGTTCTGTGGAATTCTCGGGTGCCAAGGAACTCCAGT883450.7522814534883225RNA PCR Primer, Index 1 (100% over 30bp)
TCCTTCATTCCACCGGAGTCTGTTGGAATTCTCGGGTGCCAAGGAACTCC810850.6904605994238568RNA PCR Primer, Index 1 (100% over 27bp)
TATTGCACTTGTCCCGGCCTGTTGGAATTCTCGGGTGCCAAGGAACTCCA729620.6212910680787254RNA PCR Primer, Index 1 (100% over 28bp)
TACCCTGTAGATCCGGATTTGTTGGAATTCTCGGGTGCCAAGGAACTCCA706990.6020210139812204RNA PCR Primer, Index 1 (100% over 28bp)
TCCCTGGTGGTCTAGTGGTTAGGATTCGGCGCTCTGGAATTCTCGGGTGC698670.5949363100443561No Hit
ACCCTGTAGAACCGAATTTGCGTGGAATTCTCGGGTGCCAAGGAACTCCA602920.5134026078863314RNA PCR Primer, Index 1 (100% over 28bp)
TTCAAGTAATCCAGGATAGGCTGGAATTCTCGGGTGCCAAGGAACTCCAG557050.47434306827287354RNA PCR Primer, Index 1 (100% over 29bp)
TCCCTGGTGGTCTAGTGGTTAGGATTCGGCGCTTGGAATTCTCGGGTGCC445130.3790401758913997No Hit
AAGCTGCCAGCTGAAGAACTTGGAATTCTCGGGTGCCAAGGAACTCCAGT444740.37870808039435916RNA PCR Primer, Index 1 (100% over 30bp)
TCATTGGTGGTTCAGTGGTAGAATTCTCGCCTTGGAATTCTCGGGTGCCA408330.34770398540142256No Hit
TTCAAGTAATCCAGGATAGGTTTGGAATTCTCGGGTGCCAAGGAACTCCA406800.3464011492207251RNA PCR Primer, Index 1 (100% over 28bp)
GCATTGGTGGTTCAGTGGTAGAATTCTCGCCTGGAATTCTCGGGTGCCAA390880.3328448407261481No Hit
TCCTTCATTCCACCGGAGTCTTGGAATTCTCGGGTGCCAAGGAACTCCAG384430.32735249212124723RNA PCR Primer, Index 1 (100% over 29bp)
GTTTCCGTAGTGTAGTGGTTATCACGTTCGCCTTGGAATTCTCGGGTGCC382740.32591341163407167No Hit
ACAGTAGTCTGCACATTGGTTTGGAATTCTCGGGTGCCAAGGAACTCCAG378340.3221666932059222RNA PCR Primer, Index 1 (100% over 29bp)
GCCCGGCTAGCTCAGTCGGTAGAGCATGAGACTCTGGAATTCTCGGGTGC377630.32156210909592536No Hit
GCATTGTGGTTCAGTGGTAGAATTCTCGCCTTGGAATTCTCGGGTGCCAA371840.3166317682552469No Hit
TTCACAGTGGCTAAGTTCTGCTGGAATTCTCGGGTGCCAAGGAACTCCAG363150.3092319993596518RNA PCR Primer, Index 1 (100% over 29bp)
TTGGTCCCCTTCAACCAGCTGTTGGAATTCTCGGGTGCCAAGGAACTCCA353950.3013979517371575RNA PCR Primer, Index 1 (100% over 28bp)
TCCCTGTGGTCTAGTGGTTAGGATTCGGCGCTCTGGAATTCTCGGGTGCC351460.29927764971759113No Hit
TTCCAGTGATGACAGCCTATAATCTGACTTGGAATTCTCGGGTGCCAAGG337800.28764579205201807Illumina Small RNA Adapter 2 (100% over 21bp)
TACCCTGTAGAACCGAATTTGTGGAATTCTCGGGTGCCAAGGAACTCCAG317700.270530101050699RNA PCR Primer, Index 1 (100% over 29bp)
TTCAAGTAATCCAGGATAGGCTTTGGAATTCTCGGGTGCCAAGGAACTCC294160.2504851574600996RNA PCR Primer, Index 1 (100% over 27bp)
CCTGTCTGAGGGTCGCTTGGAATTCTCGGGTGCCAAGGAACTCCAGTCAC286490.24395394601830273RNA PCR Primer, Index 1 (100% over 33bp)
TGAGAACTGAATTCCATAGATGGTGGAATTCTCGGGTGCCAAGGAACTCC281360.2395856129418467RNA PCR Primer, Index 1 (100% over 27bp)
TGGAATTCTCGGGTGCCAAGGAACTCCAGTCACTCGAAGATCTCGTATGC275690.23475745533102682RNA PCR Primer, Index 47 (100% over 50bp)
TAGCTTATCAGACTGGTGTTGGTGGAATTCTCGGGTGCCAAGGAACTCCA271130.23087449259639922RNA PCR Primer, Index 1 (100% over 28bp)
TGAGGTAGTAGGTTGTATAGTTGGAATTCTCGGGTGCCAAGGAACTCCAG270210.23009108783414983RNA PCR Primer, Index 1 (100% over 29bp)
CATTGCACTTGTCTCGGTCTGATGGAATTCTCGGGTGCCAAGGAACTCCA260310.22166097137081356RNA PCR Primer, Index 1 (100% over 28bp)
AAGCTGCCAGCTGAAGAACTGCTGGAATTCTCGGGTGCCAAGGAACTCCA244860.20850488052651614RNA PCR Primer, Index 1 (100% over 28bp)
ACCCTGTAGAACCGAATTTGCTGGAATTCTCGGGTGCCAAGGAACTCCAG239850.20423873067991868RNA PCR Primer, Index 1 (100% over 29bp)
TCCCTGTGGTCTAGTGGTTAGGATTCGGCGCTTGGAATTCTCGGGTGCCA239480.20392366572118795No Hit
TTCACAGTGGCTAAGTTCAGTTGGAATTCTCGGGTGCCAAGGAACTCCAG232940.19835467969389312RNA PCR Primer, Index 1 (100% over 29bp)
TACCCTGTAGAACCGAATGTGTTGGAATTCTCGGGTGCCAAGGAACTCCA224850.19146582694759107RNA PCR Primer, Index 1 (100% over 28bp)
TTCACGTAATCCAGGATAGGCTTGGAATTCTCGGGTGCCAAGGAACTCCA212870.18126453450003877RNA PCR Primer, Index 1 (100% over 28bp)
AACATTCAACGCTGTCGGTGAGATGGAATTCTCGGGTGCCAAGGAACTCC209670.1785396483704755RNA PCR Primer, Index 1 (100% over 27bp)
TTTGGTCCCCTTCAACCAGCTGTTGGAATTCTCGGGTGCCAAGGAACTCC202440.1723831087714936RNA PCR Primer, Index 1 (100% over 27bp)
GTTTCCGTAGTGTAGTGGTTATCACGTTCGCCTCTGGAATTCTCGGGTGC196710.16750385954574445No Hit
TTCAGTCATTGTTTCTGGTTGTTGGAATTCTCGGGTGCCAAGGAACTCCA196350.1671973098561686RNA PCR Primer, Index 1 (100% over 28bp)
TTCACAGTGGTTAAGTTCTGCCTGGAATTCTCGGGTGCCAAGGAACTCCA195430.16641390509391918RNA PCR Primer, Index 1 (100% over 28bp)
TTAGGTAGTAGGTTGTATAGTTTGGAATTCTCGGGTGCCAAGGAACTCCA194090.16527285902716457RNA PCR Primer, Index 1 (100% over 28bp)
TGAGATGAAGCACTGTAGCTCTTGGAATTCTCGGGTGCCAAGGAACTCCA191110.1627353088190088RNA PCR Primer, Index 1 (100% over 28bp)
GCATTGGTGGTTCAGTGGTAGAATTCTCGCCTGCTGGAATTCTCGGGTGC189710.16154317113732491No Hit
TATTGCACTTGTCCCGGCCTGTTTGGAATTCTCGGGTGCCAAGGAACTCC184260.15690234944791254RNA PCR Primer, Index 1 (100% over 27bp)
AACATTAAGAGTTTATGTGCTGTGGAATTCTCGGGTGCCAAGGAACTCCA182720.15559099799806023RNA PCR Primer, Index 1 (100% over 28bp)
TCCAGTGATGACAGCCTATAATCTGACTTGGAATTCTCGGGTGCCAAGGA178240.15177615741667172RNA PCR Primer, Index 1 (100% over 22bp)
TGAGATGAAGCACTGTAGCTCTGGAATTCTCGGGTGCCAAGGAACTCCAG173710.14791874048950876RNA PCR Primer, Index 1 (100% over 29bp)
TTTCCTTTGTCATCCTATGCCTTGGAATTCTCGGGTGCCAAGGAACTCCA172970.14728861057204726RNA PCR Primer, Index 1 (100% over 28bp)
GCCCGGCTAGCTCAGTCGGTAGAGCATGAGACTTGGAATTCTCGGGTGCC171340.145900621699801No Hit
TTCACAGTGGTTAAGTTCTGCCTTGGAATTCTCGGGTGCCAAGGAACTCC171050.14565367889430933RNA PCR Primer, Index 1 (100% over 27bp)
TGAGATGAAGCACTGTAGCTTGGAATTCTCGGGTGCCAAGGAACTCCAGT170190.14492136574698922RNA PCR Primer, Index 1 (100% over 30bp)
TTCACAGTGGCTAAGTTCTGCTTGGAATTCTCGGGTGCCAAGGAACTCCA166400.14169407873728776RNA PCR Primer, Index 1 (100% over 28bp)
CACCACGTTCCCGTGGTGGAATTCTCGGGTGCCAAGGAACTCCAGTCACT160640.13678928370407395RNA PCR Primer, Index 3 (100% over 34bp)
TCCAGCATCAGTGATTTTGTTTGGAATTCTCGGGTGCCAAGGAACTCCAG154700.13173121382607222RNA PCR Primer, Index 1 (100% over 29bp)
CATTATTACTTTTGGTACGCGTGGAATTCTCGGGTGCCAAGGAACTCCAG154380.13145872521311588RNA PCR Primer, Index 1 (100% over 29bp)
TCCCATATGGTCTAGCGGTTAGGATTCCTTGGAATTCTCGGGTGCCAAGG152550.12990043095777193Illumina Small RNA Adapter 2 (100% over 21bp)
AGCCTGTGATGATACAAGTTATCCCTGTCTGAACTCTGGTGTGGAATTCT152480.12984082407368772No Hit
TGGACGGAGAACTGATAAGGGCTGGAATTCTCGGGTGCCAAGGAACTCCA151920.12936396900101418RNA PCR Primer, Index 1 (100% over 28bp)
AACATTCATTGCTGTCGGTGGGTGGAATTCTCGGGTGCCAAGGAACTCCA151800.12926178577115555RNA PCR Primer, Index 1 (100% over 28bp)
TTCCCTTTGTCATCCTATGCCTGTGGAATTCTCGGGTGCCAAGGAACTCC151160.1287168085452429RNA PCR Primer, Index 1 (100% over 27bp)
TGAGGTAGTAGTTTGTATAGTTTGGAATTCTCGGGTGCCAAGGAACTCCA151140.12869977800693314RNA PCR Primer, Index 1 (100% over 28bp)
TGAGGTAGTAGGTTGTATAGTTTTGGAATTCTCGGGTGCCAAGGAACTCC146110.12441659762202593RNA PCR Primer, Index 1 (100% over 27bp)
TTCCATTTGTCATCCTATGCCTTGGAATTCTCGGGTGCCAAGGAACTCCA144920.12340328059259462RNA PCR Primer, Index 1 (100% over 28bp)
AACATTCAACGCTGTCGGTGGTGGAATTCTCGGGTGCCAAGGAACTCCAG144530.12307118509555408RNA PCR Primer, Index 1 (100% over 29bp)
TTCACAGTGGTTAAGTTCTGCTGGAATTCTCGGGTGCCAAGGAACTCCAG142890.12167468095415294RNA PCR Primer, Index 1 (100% over 29bp)
TCAGTAACTGGAATCTGTCCCTTGGAATTCTCGGGTGCCAAGGAACTCCA142730.12153843664767477RNA PCR Primer, Index 1 (100% over 28bp)
ACCCTGTAGAACCGAATTTGTTGGAATTCTCGGGTGCCAAGGAACTCCAG141810.12075503188542534RNA PCR Primer, Index 1 (100% over 29bp)
AACATTCAACGCTGTCGGTGTTGGAATTCTCGGGTGCCAAGGAACTCCAG139850.11908603913106787RNA PCR Primer, Index 1 (100% over 29bp)
TTTAAGTAATCCAGGATAGGCTTGGAATTCTCGGGTGCCAAGGAACTCCA139330.11864324513501386RNA PCR Primer, Index 1 (100% over 28bp)
CTGGACAACTCTTAGCGGTGGAATTCTCGGGTGCCAAGGAACTCCAGTCA133650.11380657225503912RNA PCR Primer, Index 1 (100% over 32bp)
TTCCCTTTGTCATCCTATGCCTGGAATTCTCGGGTGCCAAGGAACTCCAG132850.1131253507226483RNA PCR Primer, Index 1 (100% over 29bp)
TATGTGCCCTTGGACTACATCGTGGAATTCTCGGGTGCCAAGGAACTCCA132150.11252928188180636RNA PCR Primer, Index 1 (100% over 28bp)
TGAAATGTTTAGGACCACTTGTTGGAATTCTCGGGTGCCAAGGAACTCCA128840.1097107277915394RNA PCR Primer, Index 1 (100% over 28bp)
CCACTTTCCCGTGGTGGAATTCTCGGGTGCCAAGGAACTCCAGTCACTCG126480.1077011242709865RNA PCR Primer, Index 10 (97% over 36bp)
AACATTCATTGCTGTCGGTGGGTTGGAATTCTCGGGTGCCAAGGAACTCC124090.10566597494296899RNA PCR Primer, Index 1 (100% over 27bp)
TTCAAGTAATCCAGGATGGGCTTGGAATTCTCGGGTGCCAAGGAACTCCA122470.1042865013398776RNA PCR Primer, Index 1 (100% over 28bp)
TATTGCACTTGTCCCGGCCTGTATGGAATTCTCGGGTGCCAAGGAACTCC122240.10409065014931525RNA PCR Primer, Index 1 (100% over 27bp)
TAACTGAACCCATAATGCAGCTGTGGAATTCTCGGGTGCCAAGGAACTCC121150.10316248581143277RNA PCR Primer, Index 1 (100% over 27bp)
ACCCTGTAGAACCGAATTTGTGTGGAATTCTCGGGTGCCAAGGAACTCCA119510.1017659816700316RNA PCR Primer, Index 1 (100% over 28bp)
TTCAAGTAATCCAGGATAGGCATGGAATTCTCGGGTGCCAAGGAACTCCA118990.10132318767397759RNA PCR Primer, Index 1 (100% over 28bp)
ACAGTAGTCTGCACATTGGTTATGGAATTCTCGGGTGCCAAGGAACTCCA117790.1003013553753914RNA PCR Primer, Index 1 (100% over 28bp)

[WARN]Adapter Content

Adapter graph

[FAIL]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
GCATGCG302.0902953E-645.23684324
GTTCGCC111200.044.72833326
ACGTTCG111050.044.68691624
TTCGCCT113950.044.3634727
CGTTCGC113350.043.95975525
TTCACGT35300.043.8460961
TTAGCTA750.043.8460921
TCTTACG600.043.8460921
CGCTCAC207.996239E-443.8460921
ACAATCG408.58563E-943.8460921
TCCTTAA850.043.8460921
AACATTC1198150.043.8296241
AAGGTAT208.052488E-443.78372217
CTACTAT351.504759E-743.7837217
GCTTTAT254.57655E-543.7837217
TCCCATA34700.043.7829131
ACCTATC1150.043.77551716
GCCTAAA208.0599217E-443.77551715
CTAGGCC408.709321E-943.77551715
CCTAGGC408.71114E-943.77458614