FastQCFastQC Report
Mon 5 Dec 2016
JM15_1_GGTAGC_L003_R1_001.fastq

Summary

[OK]Basic Statistics

MeasureValue
FilenameJM15_1_GGTAGC_L003_R1_001.fastq
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences4346512
Sequences flagged as poor quality0
Sequence length50
%GC51

[OK]Per base sequence quality

Per base quality graph

[WARN]Per tile sequence quality

Per base quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[FAIL]Per base sequence content

Per base sequence content

[FAIL]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[OK]Sequence Length Distribution

Sequence length distribution

[FAIL]Sequence Duplication Levels

Duplication level graph

[FAIL]Overrepresented sequences

SequenceCountPercentagePossible Source
AACATTCAACGCTGTCGGTGAGTGGAATTCTCGGGTGCCAAGGAACTCCA4001889.207106755945917RNA PCR Primer, Index 1 (100% over 28bp)
TTCAAGTAATCCAGGATAGGCTTGGAATTCTCGGGTGCCAAGGAACTCCA2945706.7771583283331545RNA PCR Primer, Index 1 (100% over 28bp)
AACATTCAACGCTGTCGGTGAGTTGGAATTCTCGGGTGCCAAGGAACTCC2037184.686930577897864RNA PCR Primer, Index 1 (100% over 27bp)
TGAGGTAGTAGGTTGTATAGTTTGGAATTCTCGGGTGCCAAGGAACTCCA1646953.789130226719724RNA PCR Primer, Index 1 (100% over 28bp)
AACATTCAACGCTGTCGGTGATGGAATTCTCGGGTGCCAAGGAACTCCAG682561.570362626400203RNA PCR Primer, Index 1 (100% over 29bp)
TCACAGTGAACCGGTCTCTTTTGGAATTCTCGGGTGCCAAGGAACTCCAG675491.5540967101896876RNA PCR Primer, Index 1 (100% over 29bp)
TCCCTGAGACCCTTAACCTGTGTGGAATTCTCGGGTGCCAAGGAACTCCA531681.2232337101565576RNA PCR Primer, Index 1 (100% over 28bp)
TCCAGCATCAGTGATTTTGTTTGGAATTCTCGGGTGCCAAGGAACTCCAG446721.027766632186912RNA PCR Primer, Index 1 (100% over 29bp)
TGAGGTAGTAGGTTGTATAGTTGGAATTCTCGGGTGCCAAGGAACTCCAG420880.9683166640285359RNA PCR Primer, Index 1 (100% over 29bp)
TAAAGCTAGAGAACCGAAAGTATGGAATTCTCGGGTGCCAAGGAACTCCA359600.8273300522349875RNA PCR Primer, Index 1 (100% over 28bp)
AACCCGTAGATCCGAACTTGTGTGGAATTCTCGGGTGCCAAGGAACTCCA357920.8234648840265482RNA PCR Primer, Index 1 (100% over 28bp)
TATTGCACTCGTCCCGGCCTCCTGGAATTCTCGGGTGCCAAGGAACTCCA347620.7997677217962357RNA PCR Primer, Index 1 (100% over 28bp)
TCCCTGAGACCCTTAACCTGTTGGAATTCTCGGGTGCCAAGGAACTCCAG336200.773493780760297RNA PCR Primer, Index 1 (100% over 29bp)
TAAAGCTAGAGAACCGAAAGTTGGAATTCTCGGGTGCCAAGGAACTCCAG319620.7353482516555804RNA PCR Primer, Index 1 (100% over 29bp)
TGAGGTAGTAGTTTGTGCTGTTTGGAATTCTCGGGTGCCAAGGAACTCCA308850.7105697626050498RNA PCR Primer, Index 1 (100% over 28bp)
TCCCTGAGACCCTTAACCTGTGATGGAATTCTCGGGTGCCAAGGAACTCC303420.698076986788487RNA PCR Primer, Index 1 (100% over 27bp)
TCTTTGGTTATCTAGCTGTATGATGGAATTCTCGGGTGCCAAGGAACTCC301500.6936596516931277RNA PCR Primer, Index 1 (100% over 27bp)
TCTTTGGTTATCTAGCTGTATTGGAATTCTCGGGTGCCAAGGAACTCCAG282370.6496473494148871RNA PCR Primer, Index 1 (100% over 29bp)
TGAGGTAGTAGTTTGTATAGTTTGGAATTCTCGGGTGCCAAGGAACTCCA275140.633013321946425RNA PCR Primer, Index 1 (100% over 28bp)
AACATTCATTGCTGTCGGTGGGTGGAATTCTCGGGTGCCAAGGAACTCCA272260.6263873193033863RNA PCR Primer, Index 1 (100% over 28bp)
TTAAAGGGAATTTGCGACTGTTTGGAATTCTCGGGTGCCAAGGAACTCCA253570.5833873229844988RNA PCR Primer, Index 1 (100% over 28bp)
TAGCTTATCAGACTGGTGTTGGCTGGAATTCTCGGGTGCCAAGGAACTCC211050.48556175618518943RNA PCR Primer, Index 1 (100% over 27bp)
TGAGGTAGTTGGTTGTATAGTTTGGAATTCTCGGGTGCCAAGGAACTCCA193850.44598979595592975RNA PCR Primer, Index 1 (100% over 28bp)
TCCCTGAGACCCTAACTTGTGATGGAATTCTCGGGTGCCAAGGAACTCCA190370.4379833760955912RNA PCR Primer, Index 1 (100% over 28bp)
AGCTACATCTGGCTACTGGGTCTCTGGAATTCTCGGGTGCCAAGGAACTC184210.42381109266464695RNA PCR Primer, Index 1 (100% over 26bp)
AAGCTGCCAGCTGAAGAACTGTTGGAATTCTCGGGTGCCAAGGAACTCCA182620.4201529870388026RNA PCR Primer, Index 1 (100% over 28bp)
TTCAAGTAATCCAGGATAGGCTGGAATTCTCGGGTGCCAAGGAACTCCAG182190.41916368803307114RNA PCR Primer, Index 1 (100% over 29bp)
CCACGTTCCCGTGGTGGAATTCTCGGGTGCCAAGGAACTCCAGTCACGGT177590.40858048936710634RNA PCR Primer, Index 9 (97% over 36bp)
TGGAATTCTCGGGTGCCAAGGAACTCCAGTCACGGTAGCATCTCGTATGC173710.39965379136190127RNA PCR Primer, Index 24 (100% over 50bp)
TTCACAGTGGCTAAGTTCTGCTGGAATTCTCGGGTGCCAAGGAACTCCAG169490.38994485693355957RNA PCR Primer, Index 1 (100% over 29bp)
ACCTTGGCTTTAGACTGCTTACTTGGAATTCTCGGGTGCCAAGGAACTCC169030.38888653706696313RNA PCR Primer, Index 1 (100% over 27bp)
AACATTCATTGCTGTCGGTGGGTTGGAATTCTCGGGTGCCAAGGAACTCC160770.3698827933754698RNA PCR Primer, Index 1 (100% over 27bp)
TTGCGGCCCCGGGTTCCTCCCGGGGCTACGCCTGTCTGAGGGTCGCTTGG147170.33859333645000866No Hit
TCACAGTGAACCGGTCTCTTTTTGGAATTCTCGGGTGCCAAGGAACTCCA145460.33465914738070435RNA PCR Primer, Index 1 (100% over 28bp)
TTCACCGTGGCTAAGTTCTGCTGGAATTCTCGGGTGCCAAGGAACTCCAG144190.33173726427075323RNA PCR Primer, Index 1 (100% over 29bp)
TCCAGCATCAGTGATTTTGTTGTGGAATTCTCGGGTGCCAAGGAACTCCA142890.32874636029993703RNA PCR Primer, Index 1 (100% over 28bp)
TCTTTGGTTATCTAGCTGTATGTGGAATTCTCGGGTGCCAAGGAACTCCA138000.31749595997894403RNA PCR Primer, Index 1 (100% over 28bp)
TAACAGTCTACAGTCATGGCTTGGAATTCTCGGGTGCCAAGGAACTCCAG137920.3173119043499707RNA PCR Primer, Index 1 (100% over 29bp)
TTGCATAGTCACAAAAGTGATCTGGAATTCTCGGGTGCCAAGGAACTCCA134770.31006471395914703RNA PCR Primer, Index 1 (100% over 28bp)
TGAGATGAAGCACTGTAGCTCTTGGAATTCTCGGGTGCCAAGGAACTCCA132610.3050952119768679RNA PCR Primer, Index 1 (100% over 28bp)
TGAGGTAGTAGGTTGTATAGTTTTGGAATTCTCGGGTGCCAAGGAACTCC126590.291245025896627RNA PCR Primer, Index 1 (100% over 27bp)
AAGCTGCCAGCTGAAGAACTTGGAATTCTCGGGTGCCAAGGAACTCCAGT120870.278085048425036RNA PCR Primer, Index 1 (100% over 30bp)
TATTGCACTTGTCCCGGCCTGTTGGAATTCTCGGGTGCCAAGGAACTCCA117340.2699635937965891RNA PCR Primer, Index 1 (100% over 28bp)
TCACAGTGAACCGGTCTCTTTGGAATTCTCGGGTGCCAAGGAACTCCAGT117330.26994058684296746RNA PCR Primer, Index 1 (100% over 30bp)
TAAAGGGAATTTGCGACTGTTTGGAATTCTCGGGTGCCAAGGAACTCCAG113300.2606687845334374RNA PCR Primer, Index 1 (100% over 29bp)
TTCCCTTTGTCATCCTATGCCTTGGAATTCTCGGGTGCCAAGGAACTCCA113220.2604847289044641RNA PCR Primer, Index 1 (100% over 28bp)
CCCTGAGACCCTTAACCTGTGATGGAATTCTCGGGTGCCAAGGAACTCCA108680.25003957196022925RNA PCR Primer, Index 1 (100% over 28bp)
TGAGATGAAGCACTGTAGCTTGGAATTCTCGGGTGCCAAGGAACTCCAGT108660.24999355805298595RNA PCR Primer, Index 1 (100% over 30bp)
TTCACAGTGGCTAAGTTCTGTGGAATTCTCGGGTGCCAAGGAACTCCAGT107820.24806097394876628RNA PCR Primer, Index 1 (100% over 30bp)
TAAAGCTAGAGAACCGAAAGTCTGGAATTCTCGGGTGCCAAGGAACTCCA106370.2447249656736252RNA PCR Primer, Index 1 (100% over 28bp)
AGCTACATTGTCTGCTGGGTTTTGGAATTCTCGGGTGCCAAGGAACTCCA104990.24155000607383575RNA PCR Primer, Index 1 (100% over 28bp)
TCCCTGAGACCCTAACTTGTGTGGAATTCTCGGGTGCCAAGGAACTCCAG103560.238260011705938RNA PCR Primer, Index 1 (100% over 29bp)
AGCTACATCTGGCTACTGGGTCTTGGAATTCTCGGGTGCCAAGGAACTCC102720.23632742760171832RNA PCR Primer, Index 1 (100% over 27bp)
TACCCTGTAGAACCGAATTTGTTGGAATTCTCGGGTGCCAAGGAACTCCA100820.23195610641360245RNA PCR Primer, Index 1 (100% over 28bp)
TTCAAGTAATCCAGGATAGGCTTTGGAATTCTCGGGTGCCAAGGAACTCC94320.21700158655952173RNA PCR Primer, Index 1 (100% over 27bp)
TCTTTGGTTATCTAGCTGTATGTTGGAATTCTCGGGTGCCAAGGAACTCC91120.20963936140058972RNA PCR Primer, Index 1 (100% over 27bp)
CCCTGCGACCCTTAACCTGTGATGGAATTCTCGGGTGCCAAGGAACTCCA90350.2078678259717217RNA PCR Primer, Index 1 (100% over 28bp)
AACCCGTAGATCCGAACTTGTTGGAATTCTCGGGTGCCAAGGAACTCCAG88930.20460083855744557RNA PCR Primer, Index 1 (100% over 29bp)
AGCTACATTGTCTGCTGGGTTTCTGGAATTCTCGGGTGCCAAGGAACTCC84670.19479987631461732RNA PCR Primer, Index 1 (100% over 27bp)
GTTTCCGTAGTGTAGTGGTTATCACGTTCGCCTTGGAATTCTCGGGTGCC84110.19351148691180423No Hit
TAAAGCTAGAGAACCGAAAGTAATGGAATTCTCGGGTGCCAAGGAACTCC83640.1924301600915861RNA PCR Primer, Index 1 (100% over 27bp)
TTCACCGTGGCTAAGTTCTGTGGAATTCTCGGGTGCCAAGGAACTCCAGT81130.18665541473254876RNA PCR Primer, Index 1 (100% over 30bp)
ACCGTGGCTTTAGATTGTTACTTGGAATTCTCGGGTGCCAAGGAACTCCA81090.18656338691806212RNA PCR Primer, Index 1 (100% over 28bp)
TGAGGTAGTAGGTTGTGTGGTTTGGAATTCTCGGGTGCCAAGGAACTCCA80150.18440073327762582RNA PCR Primer, Index 1 (100% over 28bp)
TGAGGTAGTTGGTTGTATTGTTTGGAATTCTCGGGTGCCAAGGAACTCCA79720.18341143427189435RNA PCR Primer, Index 1 (100% over 28bp)
TGAGATGAAGCACTGTAGCTCTGGAATTCTCGGGTGCCAAGGAACTCCAG79300.1824451422197845RNA PCR Primer, Index 1 (100% over 29bp)
AAGCTGCCAGTTGAAGAGCTGTTGGAATTCTCGGGTGCCAAGGAACTCCA72350.166455309452729RNA PCR Primer, Index 1 (100% over 28bp)
ACCATCGACCGTTGACTGTGCCTGGAATTCTCGGGTGCCAAGGAACTCCA72210.16613321210202572RNA PCR Primer, Index 1 (100% over 28bp)
AGAATAATGCCAGCAGTCGGTCTGGAATTCTCGGGTGCCAAGGAACTCCA72140.16597216342667406RNA PCR Primer, Index 1 (100% over 28bp)
TAAAGCTAGAGAACCGAAAGTATTGGAATTCTCGGGTGCCAAGGAACTCC71470.16443069753402267RNA PCR Primer, Index 1 (100% over 27bp)
AACATTCAACGCTGTCGGTGTTGGAATTCTCGGGTGCCAAGGAACTCCAG71300.16403957932245442RNA PCR Primer, Index 1 (100% over 29bp)
AACATTCAACGCTGTCGGTGAGATGGAATTCTCGGGTGCCAAGGAACTCC70070.1612097240269899RNA PCR Primer, Index 1 (100% over 27bp)
TCTTTGGTTATCTAGCTGTCTGATGGAATTCTCGGGTGCCAAGGAACTCC69670.1602894458821234RNA PCR Primer, Index 1 (100% over 27bp)
TTCCCTTTGTCATCCTATGCCTGTGGAATTCTCGGGTGCCAAGGAACTCC69520.1599443415777985RNA PCR Primer, Index 1 (100% over 27bp)
TGAGGTAGTAGATTGAATAGTTTGGAATTCTCGGGTGCCAAGGAACTCCA68660.1579657435663355RNA PCR Primer, Index 1 (100% over 28bp)
CCTGTCTGAGGGTCGCTTGGAATTCTCGGGTGCCAAGGAACTCCAGTCAC68270.15706847237509067RNA PCR Primer, Index 1 (100% over 33bp)
ACCATCGACCGTTGACTGTGCCTTGGAATTCTCGGGTGCCAAGGAACTCC67510.1553199438998443RNA PCR Primer, Index 1 (100% over 27bp)
TGGAATTCTCGGGTGCCAAGGAACTCCAGTCACGGTAGCATCTCGTCTGC66980.15410057535789617RNA PCR Primer, Index 24 (98% over 50bp)
TCCTCCCGGGGCTACGCCTGTCTGAGGGTCGCTTGGAATTCTCGGGTGCC66210.15232903992902813No Hit
CTTTGGTTATCTAGCTGTATGATGGAATTCTCGGGTGCCAAGGAACTCCA65800.15138575483053998RNA PCR Primer, Index 1 (100% over 28bp)
ATTGATCATCGACACTTCGAACGCACCTTGCGGCCCCGGGTTTGGAATTC64900.14931512900459035No Hit
AACCCGTAGATCCGAACTTGTGATGGAATTCTCGGGTGCCAAGGAACTCC64190.1476816352974523RNA PCR Primer, Index 1 (100% over 27bp)
CCTTGGCTTTAGACTGCTTACTTGGAATTCTCGGGTGCCAAGGAACTCCA63250.14551898165701602RNA PCR Primer, Index 1 (100% over 28bp)
TCTTTGGTTATCTAGCTGTCTTGGAATTCTCGGGTGCCAAGGAACTCCAG63020.14498982172371777RNA PCR Primer, Index 1 (100% over 29bp)
TCCCTGAGACCCTAACTTGTGCTGGAATTCTCGGGTGCCAAGGAACTCCA62140.14296520980501146RNA PCR Primer, Index 1 (100% over 28bp)
ATTGATCATCGACACTTCGAACGCACCTTGCGGCCCCGGGTTGGAATTCT61330.1411016465616568No Hit
AGAATCATGCCAGCAGTCGGTCTGGAATTCTCGGGTGCCAAGGAACTCCA60760.139790250205222RNA PCR Primer, Index 1 (100% over 28bp)
AGCTGGTGTTGTGAATCAGGCCGTGGAATTCTCGGGTGCCAAGGAACTCC60010.13806472868359732RNA PCR Primer, Index 1 (100% over 27bp)
AGCTACATCTGGCTACTGGGTCTCTGGAATTCTCGGGTGCCAAGGACCTC59490.1368683670952709RNA PCR Primer, Index 1 (96% over 26bp)
TTCAAGTAATCCAGGATAGGTTTGGAATTCTCGGGTGCCAAGGAACTCCA59300.1364312349764593RNA PCR Primer, Index 1 (100% over 28bp)
TGAGGTAGTTGGTTGTATAGTTGGAATTCTCGGGTGCCAAGGAACTCCAG57700.13275012239699327RNA PCR Primer, Index 1 (100% over 29bp)
AACATTCAACGCTGTCGGTGGTGGAATTCTCGGGTGCCAAGGAACTCCAG56400.12975921842617713RNA PCR Primer, Index 1 (100% over 29bp)
TGAGGTAGTAGTTTGTGCTGTTTTGGAATTCTCGGGTGCCAAGGAACTCC55910.12863187769871565RNA PCR Primer, Index 1 (100% over 27bp)
TAAGGCACGCGGTGAATGCCTGGAATTCTCGGGTGCCAAGGAACTCCAGT55080.12672230054811764RNA PCR Primer, Index 1 (100% over 30bp)
TGTTGCTGGAGAAAAAGTTACACCTCTGACCTGGAATTCTCGGGTGCCAA53180.12235097936000178No Hit
TAGCTTATCAGACTGGTGTTGGTGGAATTCTCGGGTGCCAAGGAACTCCA51330.11809469293999418RNA PCR Primer, Index 1 (100% over 28bp)
CATTGCACTTGTCTCGGTCTGATGGAATTCTCGGGTGCCAAGGAACTCCA51210.11781860949653424RNA PCR Primer, Index 1 (100% over 28bp)
TACCCTGTAGATCCGGATTTGTTGGAATTCTCGGGTGCCAAGGAACTCCA50580.1163691714183695RNA PCR Primer, Index 1 (100% over 28bp)
TCCCTGAGACCCTTAACCTGTGTTGGAATTCTCGGGTGCCAAGGAACTCC49460.11379239261274327RNA PCR Primer, Index 1 (100% over 27bp)
GTACAGTACTGTGATAACTGATGGAATTCTCGGGTGCCAAGGAACTCCAG49370.11358533003014831RNA PCR Primer, Index 1 (100% over 29bp)
AGCCTGTGATGATACAAGTTATCCCTGTCTGAACTCTGGTGTGGAATTCT47300.10882289063046414No Hit
TGAGGTAGTAGTTTGTATAGTTGGAATTCTCGGGTGCCAAGGAACTCCAG47070.10829373069716593RNA PCR Primer, Index 1 (100% over 29bp)
TCGCTGCGATCCATTGAAAGTCAGCCCTCGATCCAAGTTTTTGTTGGAAT47020.1081786959290576No Hit
TAACGGAACCCATAATGCAGCTGTGGAATTCTCGGGTGCCAAGGAACTCC45560.10481968070029486RNA PCR Primer, Index 1 (100% over 27bp)
AACATTCAACGCTGTCGGTGATTGGAATTCTCGGGTGCCAAGGAACTCCA45430.10452059030321324RNA PCR Primer, Index 1 (100% over 28bp)
TGAGGTAGTTGTTTGTACAGTTTGGAATTCTCGGGTGCCAAGGAACTCCA45180.10394541646267168RNA PCR Primer, Index 1 (100% over 28bp)
CATTATTACTTTTGGTACGCGTGGAATTCTCGGGTGCCAAGGAACTCCAG44780.10302513831780519RNA PCR Primer, Index 1 (100% over 29bp)
TGAGGTAGTAGGTTGTGTGGTTTTGGAATTCTCGGGTGCCAAGGAACTCC44460.10228891580191196RNA PCR Primer, Index 1 (100% over 27bp)

[FAIL]Adapter Content

Adapter graph

[FAIL]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
TACTTCA700.044.069851
GCCGGAC207.7977503E-444.069851
TATTGCG302.5018908E-644.069851
CGAGGTA302.5018908E-644.069851
CGCTAGA207.7977503E-444.069851
ATTGCCC2700.044.069851
AGCTACG502.7284841E-1144.069851
CCACGTC351.4293983E-744.069851
AGGGCGA302.5018908E-644.069851
CTGTGCG408.205461E-944.069851
ATGGCCA454.7293724E-1044.0698471
TCCCATA4250.044.0698471
ACTGGCC2050.044.0698471
TCCAGCA68600.044.0377271
AACATTC838700.044.025191
TTGTTCC1950.044.00140815
TATTTAT207.8576675E-444.00140415
GGTACGA351.4469697E-744.00140414
AAATCCT551.8189894E-1244.00140413
ACCATGT1050.044.00140415