FastQCFastQC Report
Mon 5 Dec 2016
JM15_3_GGTAGC_L006_R1_001.fastq

Summary

[OK]Basic Statistics

MeasureValue
FilenameJM15_3_GGTAGC_L006_R1_001.fastq
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences10595612
Sequences flagged as poor quality0
Sequence length50
%GC52

[OK]Per base sequence quality

Per base quality graph

[WARN]Per tile sequence quality

Per base quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[FAIL]Per base sequence content

Per base sequence content

[FAIL]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[OK]Sequence Length Distribution

Sequence length distribution

[FAIL]Sequence Duplication Levels

Duplication level graph

[FAIL]Overrepresented sequences

SequenceCountPercentagePossible Source
TGGAATTCTCGGGTGCCAAGGAACTCCAGTCACGGTAGCATCTCGTATGC441218541.64162485376022RNA PCR Primer, Index 24 (100% over 50bp)
ATGACCTATGAATTGACAGCCATGGAATTCTCGGGTGCCAAGGAACTCCA2631122.4832166372268065RNA PCR Primer, Index 1 (100% over 28bp)
ATGACCTATGAATTGACAGCCTGGAATTCTCGGGTGCCAAGGAACTCCAG2572282.427684214937278RNA PCR Primer, Index 1 (100% over 29bp)
TTCAAGTAATCCAGGATAGGCTTGGAATTCTCGGGTGCCAAGGAACTCCA1588441.4991488929568202RNA PCR Primer, Index 1 (100% over 28bp)
TAGCTTATCAGACTGGTGTTGGCTGGAATTCTCGGGTGCCAAGGAACTCC1163991.098558535363507RNA PCR Primer, Index 1 (100% over 27bp)
TGAGGTAGTAGGTTGTATAGTTTGGAATTCTCGGGTGCCAAGGAACTCCA940870.8879807980888693RNA PCR Primer, Index 1 (100% over 28bp)
TGGAGTGTGACAATGGTGTTTGTGGAATTCTCGGGTGCCAAGGAACTCCA726800.6859443324274237RNA PCR Primer, Index 1 (100% over 28bp)
TTGCGGCCCCGGGTTCCTCCCGGGGCTACGCCTGTCTGAGGGTCGCTTGG694690.6556393344716662No Hit
CATGGAATTCTCGGGTGCCAAGGAACTCCAGTCACGGTAGCATCTCGTAT686350.647768151570669RNA PCR Primer, Index 24 (100% over 48bp)
TGAGAACTGAATTCCATAGATGGTGGAATTCTCGGGTGCCAAGGAACTCC626080.590886113987564RNA PCR Primer, Index 1 (100% over 27bp)
TAACGGAACCCATAATGCAGCTGTGGAATTCTCGGGTGCCAAGGAACTCC615370.5807781560895209RNA PCR Primer, Index 1 (100% over 27bp)
AAGCTGCCAGCTGAAGAACTGTTGGAATTCTCGGGTGCCAAGGAACTCCA557960.5265953490935681RNA PCR Primer, Index 1 (100% over 28bp)
TATTGCACTTGTCCCGGCCTGTTGGAATTCTCGGGTGCCAAGGAACTCCA532960.5030006761289485RNA PCR Primer, Index 1 (100% over 28bp)
AACATTCAACGCTGTCGGTGAGTTGGAATTCTCGGGTGCCAAGGAACTCC516930.48787177182403435RNA PCR Primer, Index 1 (100% over 27bp)
AACATTCAACGCTGTCGGTGAGTGGAATTCTCGGGTGCCAAGGAACTCCA494650.4668441992779653RNA PCR Primer, Index 1 (100% over 28bp)
TGAGATGAAGCACTGTAGCTCTTGGAATTCTCGGGTGCCAAGGAACTCCA477990.4511207092143427RNA PCR Primer, Index 1 (100% over 28bp)
GCATTGGTGGTTCAGTGGTAGAATTCTCGCCTTGGAATTCTCGGGTGCCA451900.42649730850846557No Hit
CCTGTCTGAGGGTCGCTTGGAATTCTCGGGTGCCAAGGAACTCCAGTCAC428910.4047996472502013RNA PCR Primer, Index 1 (100% over 33bp)
TGGACGTGATGAGCAGGTGTTACCGCCCCAGTCTGATGTTTGGTGACTGA422150.39841964768056815No Hit
AGAGATGATGACTTCTGTTACCGCCCCAGTCTGAGAAGTCATGACTGATC412430.389246038831924No Hit
ACTGTATAAGGTACATATGGTTGAGTGTCGTATGGAATTCTCGGGTGCCA403920.3812144121547675No Hit
GATCCATGATGACATTAAAACATAACGTGACTGTTGGATGAAGCTTGCGG401740.37915695667225263No Hit
TGAGATGAAGCACTGTAGCTCTGGAATTCTCGGGTGCCAAGGAACTCCAG365040.3445199767601909RNA PCR Primer, Index 1 (100% over 29bp)
TAGCTTATCAGACTGGTGTTGGTGGAATTCTCGGGTGCCAAGGAACTCCA335470.3166121975776387RNA PCR Primer, Index 1 (100% over 28bp)
ATCCATGATGACATTAAAACATAACGTGACTGTTGGATGAAGCTTGCGGA321540.30346524580175266No Hit
TGGAGTGTGACAATGGTGTTTGTTGGAATTCTCGGGTGCCAAGGAACTCC313130.29552799781645456RNA PCR Primer, Index 1 (100% over 27bp)
TTCAAGTAATCCAGGATAGGTTTGGAATTCTCGGGTGCCAAGGAACTCCA308880.2915169034124692RNA PCR Primer, Index 1 (100% over 28bp)
TGTAACAGCAACTCCATGTGGATGGAATTCTCGGGTGCCAAGGAACTCCA303610.28654314635152744RNA PCR Primer, Index 1 (100% over 28bp)
TCCCTGGTGGTCTAGTGGTTAGGATTCGGCGCTCTGGAATTCTCGGGTGC290300.27398134246516387No Hit
TGAGAACTGAATTCCATAGATGTGGAATTCTCGGGTGCCAAGGAACTCCA278640.26297678699446525RNA PCR Primer, Index 1 (100% over 28bp)
ACCACGTTCCCGTGGTGGAATTCTCGGGTGCCAAGGAACTCCAGTCACGG278060.2624293905816861RNA PCR Primer, Index 2 (97% over 35bp)
TGGAGTGTGACAATGGTGTTTTGGAATTCTCGGGTGCCAAGGAACTCCAG262910.24813101876512655RNA PCR Primer, Index 1 (100% over 29bp)
TTCAGTGATGTTTGACAAATGTCTGACCTGAACTGCAATGTGGACAGATC255020.24068453997749256No Hit
TGTAAACATCCTTGACTGGAAGCTTGGAATTCTCGGGTGCCAAGGAACTC253350.239108415823456RNA PCR Primer, Index 1 (100% over 26bp)
GTTCTACAGTCCGACTGGAATTCTCGGGTGCCAAGGAACTCCAGTCACGG247130.23323806118985857RNA PCR Primer, Index 2 (97% over 35bp)
TTACATGATGAAACATGTGTTGGTAGGGACATCTGAATGAATGTGATGAA240290.22678255866673863No Hit
AGCCTGTGATGATACAAGTTATCCCTGTCTGAACTCTGGTGTGGAATTCT232650.2195720266087509No Hit
TCAGTAACTGGAATCTGTCCCTTGGAATTCTCGGGTGCCAAGGAACTCCA221200.20876566639095503RNA PCR Primer, Index 1 (100% over 28bp)
TGCCTGTGATGAGACTCTCGACGGGCGGACTGAATGGGTTTTCACCCTCC204910.19339137748720886No Hit
TTCCAGTGATGACAGCCTATAATCTGACTTGGAATTCTCGGGTGCCAAGG194540.18360430714148462Illumina Small RNA Adapter 2 (100% over 21bp)
GTGGGATGATGATTCTTAGACTAGAGTCTCTGAGAACACATGAAGTTGTT183950.1736096036736717No Hit
CCGTCGAGCAGCATTCCGGGCTTCACATCGGAGGGCTCCAGCCGGCCCCG183620.17329815399053872No Hit
TGTAAACATCCTACACTCTCAGCTTGGAATTCTCGGGTGCCAAGGAACTC183490.1731754616911227RNA PCR Primer, Index 1 (100% over 26bp)
TGGAATTCTCGGGTGCCAAGGAACTCCAGTCACGGTAGAATCTCGTATGC176590.16666333195288768RNA PCR Primer, Index 24 (98% over 50bp)
TAACACTGTCTGGTAACGATGTTGGAATTCTCGGGTGCCAAGGAACTCCA171130.16151025537741473RNA PCR Primer, Index 1 (100% over 28bp)
TGAGGTAGTAGTTTGTATAGTTTGGAATTCTCGGGTGCCAAGGAACTCCA170580.16099117257219311RNA PCR Primer, Index 1 (100% over 28bp)
TCCCTGTGGTCTAGTGGTTAGGATTCGGCGCTCTGGAATTCTCGGGTGCC167210.15781061065656238No Hit
CTACAGTCCGACGATCTGGAATTCTCGGGTGCCAAGGAACTCCAGTCACG167200.15780117278737651RNA PCR Primer, Index 6 (100% over 34bp)
CACCACGTTCCCGTGGTGGAATTCTCGGGTGCCAAGGAACTCCAGTCACG164150.1549226226856929RNA PCR Primer, Index 6 (100% over 34bp)
TTCACAGTGGTTAAGTTCTGTGGAATTCTCGGGTGCCAAGGAACTCCAGT162820.15366738608397515RNA PCR Primer, Index 1 (100% over 30bp)
TCCAGTGATGACAGCCTATAATCTGACTTGGAATTCTCGGGTGCCAAGGA162280.15315774114793937RNA PCR Primer, Index 1 (100% over 22bp)
GCATTGTGGTTCAGTGGTAGAATTCTCGCCTTGGAATTCTCGGGTGCCAA157710.14884463493000688No Hit
GTTACATGATGAAACATGTGTTGGTAGGGACATCTGAATGAATGTGATGA151230.14272889569757746No Hit
TGAGGTAGTAGGTTGTATAGTTGGAATTCTCGGGTGCCAAGGAACTCCAG151090.14259676552897557RNA PCR Primer, Index 1 (100% over 29bp)
GCATTGGTGGTTCAGTGGTAGAATTCTCGCCTGGAATTCTCGGGTGCCAA150180.1417379194330634No Hit
TGAATGTGATGAAAATCCAACACCCCTGACTTGGAATTCTCGGGTGCCAA149510.1411055821976116No Hit
GGACAACTCTTAGCGGTGGAATTCTCGGGTGCCAAGGAACTCCAGTCACG148510.14016179527902684RNA PCR Primer, Index 6 (100% over 34bp)
CATTATTACTTTTGGTACGCGTGGAATTCTCGGGTGCCAAGGAACTCCAG148340.1400013515028674RNA PCR Primer, Index 1 (100% over 29bp)
TGGAATTCTCGGGTGCCAAGGAACTCCAGTGACGGTAGCATCTCGTATGC145610.13742481321513095RNA PCR Primer, Index 24 (98% over 50bp)
TAAGATGATGATTAACTCACCATCTTTCGGCTGAAGAATGATGTATACTC145490.13731155878490076No Hit
ATGACCTATGAATTGACAGCCATTGGAATTCTCGGGTGCCAAGGAACTCC141550.1335930383256767RNA PCR Primer, Index 1 (100% over 27bp)
TGGCTGTGATGAGAAACTTGCCCTCACTGAAACGTGATTGAGACATCTTT134870.12728854170953033No Hit
TGAGATGAAGCACTGTAGCTTGGAATTCTCGGGTGCCAAGGAACTCCAGT133710.12619374888397197RNA PCR Primer, Index 1 (100% over 30bp)
TGAGGTAGTAGGTTGTATAGTTTTGGAATTCTCGGGTGCCAAGGAACTCC132030.12460818686074952RNA PCR Primer, Index 1 (100% over 27bp)
TTCACAGTGGCTAAGTTCTGTGGAATTCTCGGGTGCCAAGGAACTCCAGT131660.12425898570087314RNA PCR Primer, Index 1 (100% over 30bp)
TGGAATTCTCGGGTGCCAAGGAACTCCAGTCACGGTAGGATCTCGTATGC131660.12425898570087314RNA PCR Primer, Index 24 (98% over 50bp)
TATTGCACTTGTCCCGGCCTGTTTGGAATTCTCGGGTGCCAAGGAACTCC128580.12135212199163202RNA PCR Primer, Index 1 (100% over 27bp)
ATGACCTATGAATTGACAGCCTTGGAATTCTCGGGTGCCAAGGAACTCCA123940.1169729506893986RNA PCR Primer, Index 1 (100% over 28bp)
AGTTCTACAGTCCGACGATCTGGAATTCTCGGGTGCCAAGGAACTCCAGT123020.11610466672430059RNA PCR Primer, Index 1 (100% over 30bp)
TCTACAGTCCGACGATCTGGAATTCTCGGGTGCCAAGGAACTCCAGTCAC122630.11573658982605252RNA PCR Primer, Index 1 (100% over 33bp)
TGGAATTCTCGGGTGCCAAGGAAATCCAGTCACGGTAGCATCTCGTATGC120260.11349981482900656RNA PCR Primer, Index 24 (98% over 50bp)
TGGACAACTCTTAGCGGTGGAATTCTCGGGTGCCAAGGAACTCCAGTCAC115780.10927164943374673RNA PCR Primer, Index 1 (100% over 33bp)
TGAGGTAGTAGATTGAATAGTTTGGAATTCTCGGGTGCCAAGGAACTCCA115700.10919614648025994RNA PCR Primer, Index 1 (100% over 28bp)
ACAGTCCGACGATCTGGAATTCTCGGGTGCCAAGGAACTCCAGTCACGGT115140.10866762580585246RNA PCR Primer, Index 9 (97% over 36bp)
CATTGCACTTGTCTCGGTCTGATGGAATTCTCGGGTGCCAAGGAACTCCA112410.106091087518116RNA PCR Primer, Index 1 (100% over 28bp)
CTCCCGGGGCTACGCCTGTCTGAGGGTCGCTTGGAATTCTCGGGTGCCAA111790.10550593962859343No Hit
TAACACTGTCTGGTAACGATGTGGAATTCTCGGGTGCCAAGGAACTCCAG108960.10283502264899846RNA PCR Primer, Index 1 (100% over 29bp)
TAGCAGCACGTAAATATTGGAGTGGAATTCTCGGGTGCCAAGGAACTCCA108700.10258963805016644RNA PCR Primer, Index 1 (100% over 28bp)
TGTAAACATCCTACACTCAGCTTGGAATTCTCGGGTGCCAAGGAACTCCA108190.10210830672168819RNA PCR Primer, Index 1 (100% over 28bp)
TGTTGCTGGAGAAAAAGTTACACCTCTGACCTGGAATTCTCGGGTGCCAA108040.10196673868390048No Hit
TCGTACCGTGAGTAATAATGCTGGAATTCTCGGGTGCCAAGGAACTCCAG107760.10170247834669674RNA PCR Primer, Index 1 (100% over 29bp)
TCCGAATGATGAAATGTTGTTGATCTCTGTAGTAACCACGGTTACAGTGA106130.10016410566940352No Hit

[WARN]Adapter Content

Adapter graph

[FAIL]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
ACCATCG2100.044.0400921
TATTGAA1550.044.0400921
GCTTACG3450.044.0400921
TTCGCAG302.5138906E-644.0400921
TCGTAAG700.044.0371843
TATGCCC254.4232176E-544.03717844
CGTTTGC254.4232176E-544.03717844
CGCGTAT207.828249E-444.03551542
ATCACGC950.043.9972821
TAGGCAA454.802132E-1043.99603317
GCTACGG302.5312656E-643.99603325
CTAGGCA454.802132E-1043.99603317
ACGCGAG750.043.9960324
AGGCAGA207.862908E-443.9960318
GGCTAAT207.862908E-443.9960317
CCAGACG351.4486795E-743.99582726
CTACGGC302.5313475E-643.99582726
TGCGAAA351.4486795E-743.99582727
TTGCGAA351.4486795E-743.99582726
ATGCTCC207.863091E-443.99582327