FastQCFastQC Report
Mon 5 Dec 2016
JM18_3_ACTGAT_L008_R1_001.fastq

Summary

[OK]Basic Statistics

MeasureValue
FilenameJM18_3_ACTGAT_L008_R1_001.fastq
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences11665645
Sequences flagged as poor quality0
Sequence length50
%GC51

[OK]Per base sequence quality

Per base quality graph

[OK]Per tile sequence quality

Per base quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[FAIL]Per base sequence content

Per base sequence content

[FAIL]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[OK]Sequence Length Distribution

Sequence length distribution

[FAIL]Sequence Duplication Levels

Duplication level graph

[FAIL]Overrepresented sequences

SequenceCountPercentagePossible Source
TTCAAGTAATCCAGGATAGGCTTGGAATTCTCGGGTGCCAAGGAACTCCA4857694.164098941807333RNA PCR Primer, Index 1 (100% over 28bp)
ATGACCTATGAATTGACAGCCTGGAATTCTCGGGTGCCAAGGAACTCCAG4150123.557557254656729RNA PCR Primer, Index 1 (100% over 29bp)
ATGACCTATGAATTGACAGCCATGGAATTCTCGGGTGCCAAGGAACTCCA3939943.3773871911926006RNA PCR Primer, Index 1 (100% over 28bp)
CCTGTCTGAGGGTCGCTTGGAATTCTCGGGTGCCAAGGAACTCCAGTCAC3908913.3507877189816764RNA PCR Primer, Index 1 (100% over 33bp)
TGAGGTAGTAGGTTGTATAGTTTGGAATTCTCGGGTGCCAAGGAACTCCA3445972.9539472528094244RNA PCR Primer, Index 1 (100% over 28bp)
TTGCGGCCCCGGGTTCCTCCCGGGGCTACGCCTGTCTGAGGGTCGCTTGG2002261.7163731623926495No Hit
TATTGCACTTGTCCCGGCCTGTTGGAATTCTCGGGTGCCAAGGAACTCCA1682481.4422520143549713RNA PCR Primer, Index 1 (100% over 28bp)
TCAGTAACTGGAATCTGTCCCTTGGAATTCTCGGGTGCCAAGGAACTCCA1592131.3648023748365392RNA PCR Primer, Index 1 (100% over 28bp)
TAGCTTATCAGACTGGTGTTGGCTGGAATTCTCGGGTGCCAAGGAACTCC1574331.349543895772587RNA PCR Primer, Index 1 (100% over 27bp)
CTACGCCTGTCTGAGGGTCGCTTGGAATTCTCGGGTGCCAAGGAACTCCA1358861.1648391494855193RNA PCR Primer, Index 1 (100% over 28bp)
AAGCTGCCAGCTGAAGAACTGTTGGAATTCTCGGGTGCCAAGGAACTCCA1266141.0853579034849765RNA PCR Primer, Index 1 (100% over 28bp)
AACATTCAACGCTGTCGGTGAGTGGAATTCTCGGGTGCCAAGGAACTCCA1175411.0075825211550669RNA PCR Primer, Index 1 (100% over 28bp)
AACATTCAACGCTGTCGGTGAGTTGGAATTCTCGGGTGCCAAGGAACTCC1137090.9747339302713223RNA PCR Primer, Index 1 (100% over 27bp)
TGAGGTAGTAGTTTGTATAGTTTGGAATTCTCGGGTGCCAAGGAACTCCA903010.7740763584011RNA PCR Primer, Index 1 (100% over 28bp)
CTGTCTGAGGGTCGCTTGGAATTCTCGGGTGCCAAGGAACTCCAGTCACA900000.7714961324470271RNA PCR Primer, Index 1 (100% over 34bp)
CTGGACAACTCTTAGCGGTGGAATTCTCGGGTGCCAAGGAACTCCAGTCA858310.735758717156231RNA PCR Primer, Index 1 (100% over 32bp)
GGACAACTCTTAGCGGTGGAATTCTCGGGTGCCAAGGAACTCCAGTCACA833280.7143025524949542RNA PCR Primer, Index 1 (100% over 34bp)
TAACGGAACCCATAATGCAGCTGTGGAATTCTCGGGTGCCAAGGAACTCC762930.6539972714753449RNA PCR Primer, Index 1 (100% over 27bp)
TTCCAGTGATGACAGCCTATAATCTGACTTGGAATTCTCGGGTGCCAAGG631690.5414959910060696Illumina Small RNA Adapter 2 (100% over 21bp)
GCATTGGTGGTTCAGTGGTAGAATTCTCGCCTTGGAATTCTCGGGTGCCA591760.5072672792631697No Hit
GTTTCCGTAGTGTAGTGGTTATCACGTTCGCCTTGGAATTCTCGGGTGCC591200.5067872372252027No Hit
TGTCTGAGGGTCGCTTGGAATTCTCGGGTGCCAAGGAACTCCAGTCACAC571340.4897628892358717RNA PCR Primer, Index 5 (100% over 35bp)
TGTAAACATCCTTGACTGGAAGCTTGGAATTCTCGGGTGCCAAGGAACTC549400.470955527962663RNA PCR Primer, Index 1 (100% over 26bp)
TCCAGTGATGACAGCCTATAATCTGACTTGGAATTCTCGGGTGCCAAGGA532940.45684572091813186RNA PCR Primer, Index 1 (100% over 22bp)
TTCAAGTAATCCAGGATAGGTTTGGAATTCTCGGGTGCCAAGGAACTCCA518920.4448275256104571RNA PCR Primer, Index 1 (100% over 28bp)
ACTGGACAACTCTTAGCGGTGGAATTCTCGGGTGCCAAGGAACTCCAGTC512630.4394356248625772RNA PCR Primer, Index 1 (100% over 31bp)
TGAGATGAAGCACTGTAGCTCTGGAATTCTCGGGTGCCAAGGAACTCCAG498610.4274174295549025RNA PCR Primer, Index 1 (100% over 29bp)
AGCCTGTGATGATACAAGTTATCCCTGTCTGAACTCTGGTGTGGAATTCT495500.42475148180833555No Hit
TGAGGTAGTAGGTTGTATAGTTGGAATTCTCGGGTGCCAAGGAACTCCAG472340.4048983146666987RNA PCR Primer, Index 1 (100% over 29bp)
TGTAAACATCCTACACTCTCAGCTTGGAATTCTCGGGTGCCAAGGAACTC457900.3925200878305486RNA PCR Primer, Index 1 (100% over 26bp)
TGAGGTAGTAGGTTGTATAGTTTTGGAATTCTCGGGTGCCAAGGAACTCC441330.37831598681427386RNA PCR Primer, Index 1 (100% over 27bp)
CCACGTTCCCGTGGTGGAATTCTCGGGTGCCAAGGAACTCCAGTCACACT438170.37560717817145983RNA PCR Primer, Index 8 (100% over 36bp)
TGGAGTGTGACAATGGTGTTTGTGGAATTCTCGGGTGCCAAGGAACTCCA424150.3635889828637851RNA PCR Primer, Index 1 (100% over 28bp)
TGAGGTAGTAGATTGAATAGTTTGGAATTCTCGGGTGCCAAGGAACTCCA411930.35311377982100434RNA PCR Primer, Index 1 (100% over 28bp)
CCTGTCTGAGGGTCGCTTTGGAATTCTCGGGTGCCAAGGAACTCCAGTCA411480.35272803175478085RNA PCR Primer, Index 1 (100% over 32bp)
TGAGATGAAGCACTGTAGCTCTTGGAATTCTCGGGTGCCAAGGAACTCCA403590.34596458232699523RNA PCR Primer, Index 1 (100% over 28bp)
AACTGGACAACTCTTAGCGGTGGAATTCTCGGGTGCCAAGGAACTCCAGT400100.3429728917689506RNA PCR Primer, Index 1 (100% over 30bp)
TTCACAGTGGCTAAGTTCTGTGGAATTCTCGGGTGCCAAGGAACTCCAGT385420.33038893263081465RNA PCR Primer, Index 1 (100% over 30bp)
TATTGCACTTGTCCCGGCCTGTTTGGAATTCTCGGGTGCCAAGGAACTCC376680.3228968479668291RNA PCR Primer, Index 1 (100% over 27bp)
TCTGACACCATGGAATTCTCGGGTGCCAAGGAACTCCAGTCACACTGATA374380.3209252467394645RNA PCR Primer, Index 25 (100% over 40bp)
TACCCTGTAGATCCGGATTTGTTGGAATTCTCGGGTGCCAAGGAACTCCA374380.3209252467394645RNA PCR Primer, Index 1 (100% over 28bp)
GCCCGGCTAGCTCAGTCGGTAGAGCATGAGACTCTTAATCTTGGAATTCT354780.30412377541061814No Hit
TCGTACCGTGAGTAATAATGCATGGAATTCTCGGGTGCCAAGGAACTCCA348340.29860329197399715RNA PCR Primer, Index 1 (100% over 28bp)
TACGCCTGTCTGAGGGTCGCTTGGAATTCTCGGGTGCCAAGGAACTCCAG347670.2980289559642866RNA PCR Primer, Index 1 (100% over 29bp)
TTCACAGTGGCTAAGTTCTGCTGGAATTCTCGGGTGCCAAGGAACTCCAG340490.2918741312632092RNA PCR Primer, Index 1 (100% over 29bp)
CATTGCACTTGTCTCGGTCTGATGGAATTCTCGGGTGCCAAGGAACTCCA339050.29063973745129396RNA PCR Primer, Index 1 (100% over 28bp)
TATTGCACTTGTCCCGGCCTGTATGGAATTCTCGGGTGCCAAGGAACTCC325100.27868154739836504RNA PCR Primer, Index 1 (100% over 27bp)
ACAGTAGTCTGCACATTGGTTTGGAATTCTCGGGTGCCAAGGAACTCCAG322760.27667565745400274RNA PCR Primer, Index 1 (100% over 29bp)
TGTTGCTGGAGAAAAAGTTACACCTCTGACCTGGAATTCTCGGGTGCCAA314660.26973219226197953No Hit
TTCACAGTGGTTAAGTTCTGTGGAATTCTCGGGTGCCAAGGAACTCCAGT314140.2692864389410101RNA PCR Primer, Index 1 (100% over 30bp)
GTTTCCGTAGTGTAGTGGTTATCACGTTCGCCTCTGGAATTCTCGGGTGC311830.26730626553439607No Hit
AACCCGTAGATCCGAACTTGTGTGGAATTCTCGGGTGCCAAGGAACTCCA296760.2543879914055331RNA PCR Primer, Index 1 (100% over 28bp)
TTCAAGTAATCCAGGATAGGCTGGAATTCTCGGGTGCCAAGGAACTCCAG288950.24769311941174277RNA PCR Primer, Index 1 (100% over 29bp)
TCGTACCGTGAGTAATAATGCTGGAATTCTCGGGTGCCAAGGAACTCCAG279340.2394552551530584RNA PCR Primer, Index 1 (100% over 29bp)
CTCCCGGGGCTACGCCTGTCTGAGGGTCGCTTGGAATTCTCGGGTGCCAA272790.23384047774469394No Hit
CATTATTACTTTTGGTACGCGTGGAATTCTCGGGTGCCAAGGAACTCCAG271140.23242606816854103RNA PCR Primer, Index 1 (100% over 29bp)
TCCCTGGTGGTCTAGTGGTTAGGATTCGGCGCTCTGGAATTCTCGGGTGC270950.23226319676280224No Hit
ATCCATGATGACATTAAAACATAACGTGACTGTTGGATGAAGCTTGCGGA236130.2024148686163517No Hit
TAGCTTATCAGACTGGTGTTGGTGGAATTCTCGGGTGCCAAGGAACTCCA235580.20194339875763406RNA PCR Primer, Index 1 (100% over 28bp)
TGGAATTCTCGGGTGCCAAGGAACTCCAGTCACACTGATATCTCGTATGC234640.2011376139081894RNA PCR Primer, Index 25 (100% over 50bp)
TATTGCACTTGTCCCGGCCTGTATTGGAATTCTCGGGTGCCAAGGAACTC232360.1991831570393236RNA PCR Primer, Index 1 (100% over 26bp)
ATGACCTATGAATTGACAGCCATTGGAATTCTCGGGTGCCAAGGAACTCC229390.19663721980224838RNA PCR Primer, Index 1 (100% over 27bp)
AACATTCAACGCTGTCGGTGATGGAATTCTCGGGTGCCAAGGAACTCCAG225340.19316548720623677RNA PCR Primer, Index 1 (100% over 29bp)
TGAGGTAGTAGTTTGTGCTGTTTGGAATTCTCGGGTGCCAAGGAACTCCA224230.19221397530955212RNA PCR Primer, Index 1 (100% over 28bp)
CTCGTCGCCATGGAATTCTCGGGTGCCAAGGAACTCCAGTCACACTGATA223850.1918882324980745RNA PCR Primer, Index 25 (100% over 40bp)
TTCAAGTAATCCAGGATAGGCTTTGGAATTCTCGGGTGCCAAGGAACTCC222820.1910052980353851RNA PCR Primer, Index 1 (100% over 27bp)
TCAGTAACTGGAATCTGTCCCTGTGGAATTCTCGGGTGCCAAGGAACTCC221940.1902509462614369RNA PCR Primer, Index 1 (100% over 27bp)
TCAGTAACTGGAATCTGTCCCTGCTGGAATTCTCGGGTGCCAAGGAACTC212450.18211594815374546RNA PCR Primer, Index 1 (100% over 26bp)
AGAGATGATGACTTCTGTTACCGCCCCAGTCTGAGAAGTCATGACTGATC206860.1773240999533245No Hit
GCATTGTGGTTCAGTGGTAGAATTCTCGCCTTGGAATTCTCGGGTGCCAA203240.17422097106503756No Hit
TCCTCCCGGGGCTACGCCTGTCTGAGGGTCGCTTGGAATTCTCGGGTGCC197540.16933482889287305No Hit
GATCCATGATGACATTAAAACATAACGTGACTGTTGGATGAAGCTTGCGG197390.16920624620413185No Hit
GCCCGGCTAGCTCAGTCGGTAGAGCATGAGACTCTGGAATTCTCGGGTGC187210.16047976772823105No Hit
TGAGATGAAGCACTGTAGCTTGGAATTCTCGGGTGCCAAGGAACTCCAGT184110.15782239216091354RNA PCR Primer, Index 1 (100% over 30bp)
TACCCTGTAGATCCGGATTTGTGTGGAATTCTCGGGTGCCAAGGAACTCC183530.15732520576444767RNA PCR Primer, Index 1 (100% over 27bp)
TTGCGGCCCCGGGTTCCTCCCGGGGCTACGCCTGTCTGAGGGTCGCTTTG183150.15699946295297001No Hit
TATTGCACTTGTCCCGGCCTGTTTTGGAATTCTCGGGTGCCAAGGAACTC182220.15620225028277476RNA PCR Primer, Index 1 (100% over 26bp)
TGTAAACATCCTACACTCAGCTTGGAATTCTCGGGTGCCAAGGAACTCCA181880.1559107961882948RNA PCR Primer, Index 1 (100% over 28bp)
TGGACAACTCTTAGCGGTGGAATTCTCGGGTGCCAAGGAACTCCAGTCAC181550.1556279142730642RNA PCR Primer, Index 1 (100% over 33bp)
TCCCATATGGTCTAGCGGTTAGGATTCCTTGGAATTCTCGGGTGCCAAGG181210.1553364601785842Illumina Small RNA Adapter 2 (100% over 21bp)
ATCTATTGATGAAACAAACACTTCGGATCTGACTTCTGAGTTGGAATTCT181110.1552507383860901No Hit
GCATTGGTGGTTCAGTGGTAGAATTCTCGCCTGGAATTCTCGGGTGCCAA179290.15369060176269722No Hit
TACCCTGTAGAACCGAATTTGCGTGGAATTCTCGGGTGCCAAGGAACTCC174920.14994455943070445RNA PCR Primer, Index 1 (100% over 27bp)
TGGAATTCTCGGGTGCCAAGGAACTCCAGTCACAGTGATCTCGTATGCCG174580.14965310533622445RNA PCR Primer, Index 25 (97% over 39bp)
TGTAAACATCCCCGACTGGAAGCTTGGAATTCTCGGGTGCCAAGGAACTC173150.1484272837035586RNA PCR Primer, Index 1 (100% over 26bp)
GGAATACCAGGTGCTGTAAGCTTTGGAATTCTCGGGTGCCAAGGAACTCC169550.1453412991737705RNA PCR Primer, Index 1 (100% over 27bp)
ATGACCTATGAATTGACAGCTGGAATTCTCGGGTGCCAAGGAACTCCAGT167120.1432582596161635RNA PCR Primer, Index 1 (100% over 30bp)
TGAGGTAGTAGGTTGTGTGGTTTGGAATTCTCGGGTGCCAAGGAACTCCA160160.1372920228585732RNA PCR Primer, Index 1 (100% over 28bp)
TCCCTGTGGTCTAGTGGTTAGGATTCGGCGCTCTGGAATTCTCGGGTGCC159550.13676911992435908No Hit
CCGTCGAGCAGCATTCCGGGCTTCACATCGGAGGGCTCCAGCCGGCCCCG157500.13501182317822977No Hit
TCACAGTGAACCGGTCTCTTTTGGAATTCTCGGGTGCCAAGGAACTCCAG155630.1334088256585898RNA PCR Primer, Index 1 (100% over 29bp)
CATGGAATTCTCGGGTGCCAAGGAACTCCAGTCACACTGATATCTCGTAT155330.13315166028110748RNA PCR Primer, Index 25 (100% over 48bp)
GAAGGATCATTATGGAATTCTCGGGTGCCAAGGAACTCCAGTCACACTGA147170.12615676201358778RNA PCR Primer, Index 25 (100% over 38bp)
TATTGCACTTGTCCCGGCCTGTAATGGAATTCTCGGGTGCCAAGGAACTC145420.12465663064494077RNA PCR Primer, Index 1 (100% over 26bp)
TTGTTGTGATGAAACTAAACTGAAAATAGCTGGAATTCTCGGGTGCCAAG145410.12464805846569135No Hit
AAGCTGCCAGCTGAAGAACTTGGAATTCTCGGGTGCCAAGGAACTCCAGT141040.12090201613369858RNA PCR Primer, Index 1 (100% over 30bp)
TACCCTGTAGAACCGAATTTGTTGGAATTCTCGGGTGCCAAGGAACTCCA140570.12049912370897622RNA PCR Primer, Index 1 (100% over 28bp)
TGGAGTGTGACAATGGTGTTTGTTGGAATTCTCGGGTGCCAAGGAACTCC138820.11899899234032922RNA PCR Primer, Index 1 (100% over 27bp)
AACAGTAAGAGTTTATGTGCTGTGGAATTCTCGGGTGCCAAGGAACTCCA138630.11883612093459041RNA PCR Primer, Index 1 (100% over 28bp)
TGGAGTGTGACAATGGTGTTTTGGAATTCTCGGGTGCCAAGGAACTCCAG137700.11803890826439516RNA PCR Primer, Index 1 (100% over 29bp)
TACAGTACTGTGATAACTGAAGTGGAATTCTCGGGTGCCAAGGAACTCCA136380.11690738060347285RNA PCR Primer, Index 1 (100% over 28bp)
CCCCTTCACTCTCCAATGAGTGAGATCCTCCGTCTGACATGGAATTCTCG135660.11629018369751522No Hit
TCTATTGATGAAACAAACACTTCGGATCTGACTTGGAATTCTCGGGTGCC135130.11583585819729642No Hit
GTTGGGCGCCATGGAATTCTCGGGTGCCAAGGAACTCCAGTCACACTGAT134720.11548439884807055RNA PCR Primer, Index 25 (100% over 39bp)
GCTTACGGCCTGGAATTCTCGGGTGCCAAGGAACTCCAGTCACACTGATA132250.11336707057346593RNA PCR Primer, Index 25 (100% over 40bp)
TTCACAGTGGTTAAGTTCTGCTGGAATTCTCGGGTGCCAAGGAACTCCAG130560.11191837228031541RNA PCR Primer, Index 1 (100% over 29bp)
GAATACCAGGTGCTGTAAGCTTTGGAATTCTCGGGTGCCAAGGAACTCCA129610.11110401525162132RNA PCR Primer, Index 1 (100% over 28bp)
TGTAACAGCAACTCCATGTGGATGGAATTCTCGGGTGCCAAGGAACTCCA127740.10950101773198137RNA PCR Primer, Index 1 (100% over 28bp)
TTTGTTGGAATTCTCGGGTGCCAAGGAACTCCAGTCACACTGATATCTCG124800.10698079703265442RNA PCR Primer, Index 25 (100% over 45bp)
TTCAGTGATGTTTGACAAATGTCTGACCTGAACTGCAATGTGGACAGATC123180.10559210399424979No Hit
GTTTCCGTAGTGTAGTGGTTATCACGTTCGCCTGGAATTCTCGGGTGCCA122320.10485489657880041No Hit
TGTAAACATCCCCGACTGGAAGCTGGAATTCTCGGGTGCCAAGGAACTCC121060.10377480199337456RNA PCR Primer, Index 1 (100% over 27bp)
GTCGCTTGGAATTCTCGGGTGCCAAGGAACTCCAGTCACACTGATATCTC120430.10323475470066165RNA PCR Primer, Index 25 (100% over 44bp)
CTACGCCTGTCTGAGGGTCGCTTTGGAATTCTCGGGTGCCAAGGAACTCC120200.10303759457792519RNA PCR Primer, Index 1 (100% over 27bp)
TGTAAACATCCCCGACTGGATGGAATTCTCGGGTGCCAAGGAACTCCAGT116850.10016591452937237RNA PCR Primer, Index 1 (100% over 30bp)

[FAIL]Adapter Content

Adapter graph

[FAIL]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
TACAGCA700.044.0416371
TTCGCAG254.4206045E-544.0416341
CTACTAT850.044.0008617
ATAGGCG5200.044.0008616
ATAGGCA11750.044.0008616
GTTAGCC1500.044.0008618
CGTTAGG551.8189894E-1244.0008616
TACGCGA1700.044.0008616
AGGCTTA207.858695E-444.0008618
TATAGGC302.529452E-644.0006715
ATTCCTA1050.044.00066812
CACCCGC2400.043.996924
GCACGAA207.862179E-443.99689521
TGGATAC800.043.99689526
ACGAAGG207.862179E-443.99689523
TTAGCCC1050.043.9965219
CCGATTA254.4475426E-543.9963345
CGATTAA351.4485522E-743.9963348
ACGATTA351.4485522E-743.9963347
CATAGTC700.043.9963344