FastQCFastQC Report
Mon 5 Dec 2016
JM1_1_CGTACG_L001_R1_001.fastq

Summary

[OK]Basic Statistics

MeasureValue
FilenameJM1_1_CGTACG_L001_R1_001.fastq
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences2897196
Sequences flagged as poor quality0
Sequence length50
%GC51

[OK]Per base sequence quality

Per base quality graph

[FAIL]Per tile sequence quality

Per base quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[FAIL]Per base sequence content

Per base sequence content

[FAIL]Per sequence GC content

Per sequence GC content graph

[WARN]Per base N content

N content graph

[OK]Sequence Length Distribution

Sequence length distribution

[FAIL]Sequence Duplication Levels

Duplication level graph

[FAIL]Overrepresented sequences

SequenceCountPercentagePossible Source
AACATTCAACGCTGTCGGTGAGTGGAATTCTCGGGTGCCAAGGAACTCCA1976186.82100900318791RNA PCR Primer, Index 1 (100% over 28bp)
TTCAAGTAATCCAGGATAGGCTTGGAATTCTCGGGTGCCAAGGAACTCCA1326654.57908267165908RNA PCR Primer, Index 1 (100% over 28bp)
AACATTCAACGCTGTCGGTGAGTTGGAATTCTCGGGTGCCAAGGAACTCC1068803.6890842041753475RNA PCR Primer, Index 1 (100% over 27bp)
TGAGGTAGTAGGTTGTATAGTTTGGAATTCTCGGGTGCCAAGGAACTCCA945213.262499326935423RNA PCR Primer, Index 1 (100% over 28bp)
AACATTCAACGCTGTCGGTGATGGAATTCTCGGGTGCCAAGGAACTCCAG395811.3661830266229829RNA PCR Primer, Index 1 (100% over 29bp)
TCACAGTGAACCGGTCTCTTTTGGAATTCTCGGGTGCCAAGGAACTCCAG348241.2019897859861743RNA PCR Primer, Index 1 (100% over 29bp)
TGAGGTAGTAGGTTGTATAGTTGGAATTCTCGGGTGCCAAGGAACTCCAG237230.8188262029907538RNA PCR Primer, Index 1 (100% over 29bp)
TCCCTGAGACCCTTAACCTGTGTGGAATTCTCGGGTGCCAAGGAACTCCA236540.8164445898724146RNA PCR Primer, Index 1 (100% over 28bp)
TATTGCACTCGTCCCGGCCTCCTGGAATTCTCGGGTGCCAAGGAACTCCA217360.7502426484090133RNA PCR Primer, Index 1 (100% over 28bp)
TTCAAGTAATCAAGGATAGGCTTGGAATTCTCGGGTGCCAAGGAACTCCA197680.68231490033812RNA PCR Primer, Index 1 (100% over 28bp)
TCCCTGAGACCCTTAACCTGTTGGAATTCTCGGGTGCCAAGGAACTCCAG196880.6795536097661324RNA PCR Primer, Index 1 (100% over 29bp)
TCCAGCATCAGTGATTTTGTTTGGAATTCTCGGGTGCCAAGGAACTCCAG196670.6788287709909858RNA PCR Primer, Index 1 (100% over 29bp)
TACCCTGTAGAACCGAATTTGTTGGAATTCTCGGGTGCCAAGGAACTCCA193530.6679907054959346RNA PCR Primer, Index 1 (100% over 28bp)
TAAAGCTAGAGAACCGAAAGTATGGAATTCTCGGGTGCCAAGGAACTCCA187500.6471774778095786RNA PCR Primer, Index 1 (100% over 28bp)
TGAGGTAGTAGTTTGTGCTGTTTGGAATTCTCGGGTGCCAAGGAACTCCA185730.6410681224190562RNA PCR Primer, Index 1 (100% over 28bp)
TGGAATTCTCGGGTGCCAAGGAACTCCAGTCACCGTACGATCTCGTATGC182660.6304716698490541RNA PCR Primer, Index 22 (100% over 50bp)
TGAGGTAGTAGTTTGTATAGTTTGGAATTCTCGGGTGCCAAGGAACTCCA173890.6002010219536407RNA PCR Primer, Index 1 (100% over 28bp)
TAAAGCTAGAGAACCGAAAGTTGGAATTCTCGGGTGCCAAGGAACTCCAG173800.5998903767642921RNA PCR Primer, Index 1 (100% over 29bp)
AACCCGTAGATCCGAACTTGTGTGGAATTCTCGGGTGCCAAGGAACTCCA163210.5633377928176071RNA PCR Primer, Index 1 (100% over 28bp)
AACATTCATTGCTGTCGGTGGGTGGAATTCTCGGGTGCCAAGGAACTCCA158510.5471152107071804RNA PCR Primer, Index 1 (100% over 28bp)
TTAAAGGGAATTTGCGACTGTTTGGAATTCTCGGGTGCCAAGGAACTCCA135320.4670723002516916RNA PCR Primer, Index 1 (100% over 28bp)
TCCCTGAGACCCTTAACCTGTGATGGAATTCTCGGGTGCCAAGGAACTCC127740.4409090720821097RNA PCR Primer, Index 1 (100% over 27bp)
TCTTTGGTTATCTAGCTGTATTGGAATTCTCGGGTGCCAAGGAACTCCAG126890.43797520084937297RNA PCR Primer, Index 1 (100% over 29bp)
TTCACAGTGGCTAAGTTCTGCTGGAATTCTCGGGTGCCAAGGAACTCCAG120220.4149529407054269RNA PCR Primer, Index 1 (100% over 29bp)
CCACGTTCCCGTGGTGGAATTCTCGGGTGCCAAGGAACTCCAGTCACCGT113170.39061906753978676RNA PCR Primer, Index 12 (97% over 36bp)
TCTTTGGTTATCTAGCTGTATGATGGAATTCTCGGGTGCCAAGGAACTCC111660.38540713158516027RNA PCR Primer, Index 1 (100% over 27bp)
TACCCTGTAGATCCGGATTTGTTGGAATTCTCGGGTGCCAAGGAACTCCA110110.38005713110193445RNA PCR Primer, Index 1 (100% over 28bp)
TAACAGTCTACAGTCATGGCTTGGAATTCTCGGGTGCCAAGGAACTCCAG108920.375949711376103RNA PCR Primer, Index 1 (100% over 29bp)
TGAGGTAGTTGGTTGTATAGTTTGGAATTCTCGGGTGCCAAGGAACTCCA107990.37273971108616744RNA PCR Primer, Index 1 (100% over 28bp)
TTGCGGCCCCGGGTTCCTCCCGGGGCTACGCCTGTCTGAGGGTCGCTTGG106150.36638874277059613No Hit
AGCTACATCTGGCTACTGGGTCTCTGGAATTCTCGGGTGCCAAGGAACTC96920.3345303527962899RNA PCR Primer, Index 1 (100% over 26bp)
ACCTTGGCTTTAGACTGCTTACTTGGAATTCTCGGGTGCCAAGGAACTCC96610.33346035269964475RNA PCR Primer, Index 1 (100% over 27bp)
AACATTCATTGCTGTCGGTGGGTTGGAATTCTCGGGTGCCAAGGAACTCC93770.323657771169089RNA PCR Primer, Index 1 (100% over 27bp)
AAGCTGCCAGCTGAAGAACTGTTGGAATTCTCGGGTGCCAAGGAACTCCA93590.3230364807903918RNA PCR Primer, Index 1 (100% over 28bp)
TCTTTGGTTATCTAGCTGTCTTGGAATTCTCGGGTGCCAAGGAACTCCAG92660.3198264805004563RNA PCR Primer, Index 1 (100% over 29bp)
TAGCTTATCAGACTGGTGTTGGCTGGAATTCTCGGGTGCCAAGGAACTCC89760.30981680217700147RNA PCR Primer, Index 1 (100% over 27bp)
TTCAAGTAATCCAGGATAGGCTGGAATTCTCGGGTGCCAAGGAACTCCAG86020.29690776875295977RNA PCR Primer, Index 1 (100% over 29bp)
TCTTTGGTTATCTAGCTGTCTGATGGAATTCTCGGGTGCCAAGGAACTCC84400.291316155344685RNA PCR Primer, Index 1 (100% over 27bp)
TTGCATAGTCACAAAAGTGATCTGGAATTCTCGGGTGCCAAGGAACTCCA83760.289107122887095RNA PCR Primer, Index 1 (100% over 28bp)
TACCCTGTAGAACCGAATGTGTTGGAATTCTCGGGTGCCAAGGAACTCCA81330.28071970277468283RNA PCR Primer, Index 1 (100% over 28bp)
AACATTCAACGATGTCGGTGAGTGGAATTCTCGGGTGCCAAGGAACTCCA80680.278476154184943RNA PCR Primer, Index 1 (100% over 28bp)
TGGAATTCTCGGGTGCCAAGGAACTCCAGTCACCGTACGATCTCGTCTGC79490.27436873445911153RNA PCR Primer, Index 22 (98% over 50bp)
CCCTGAGACCCTTAACCTGTGATGGAATTCTCGGGTGCCAAGGAACTCCA79300.27371292794826446RNA PCR Primer, Index 1 (100% over 28bp)
TCCCTGAGACCCTAACTTGTGATGGAATTCTCGGGTGCCAAGGAACTCCA75560.26080389452422276RNA PCR Primer, Index 1 (100% over 28bp)
TCCAGCATCAGTGATTTTGTTGTGGAATTCTCGGGTGCCAAGGAACTCCA74230.25621324894829345RNA PCR Primer, Index 1 (100% over 28bp)
TCACAGTGAACCGGTCTCTTTTTGGAATTCTCGGGTGCCAAGGAACTCCA72750.2511048613901165RNA PCR Primer, Index 1 (100% over 28bp)
TACCCTGTAGAACCGAATTTGCGTGGAATTCTCGGGTGCCAAGGAACTCC72380.24982776450057226RNA PCR Primer, Index 1 (100% over 27bp)
TAAAGCTAGAGAACCGAAAGTCTGGAATTCTCGGGTGCCAAGGAACTCCA70860.24458131241379596RNA PCR Primer, Index 1 (100% over 28bp)
TGAGGTAGTAGGTTGTATAGTTTTGGAATTCTCGGGTGCCAAGGAACTCC70600.2436838929779RNA PCR Primer, Index 1 (100% over 27bp)
TATTGCACTTGTCCCGGCCTGTTGGAATTCTCGGGTGCCAAGGAACTCCA67450.23281131135069907RNA PCR Primer, Index 1 (100% over 28bp)
TACCCTGTAGAACCGAATTTGCTGGAATTCTCGGGTGCCAAGGAACTCCA65900.22746131086747323RNA PCR Primer, Index 1 (100% over 28bp)
TAAAGGGAATTTGCGACTGTTTGGAATTCTCGGGTGCCAAGGAACTCCAG65020.22442389123828693RNA PCR Primer, Index 1 (100% over 29bp)
TTCCCTTTGTCATCCTATGCCTTGGAATTCTCGGGTGCCAAGGAACTCCA64550.2228016330272443RNA PCR Primer, Index 1 (100% over 28bp)
TTGCATAGTCACAAAAGTGCTCTGGAATTCTCGGGTGCCAAGGAACTCCA63560.2193845359444097RNA PCR Primer, Index 1 (100% over 28bp)
TTCACAGTGGCTAAGTTCTGTGGAATTCTCGGGTGCCAAGGAACTCCAGT62590.21603647112587482RNA PCR Primer, Index 1 (100% over 30bp)
TGAGATGAAGCACTGTAGCTCTTGGAATTCTCGGGTGCCAAGGAACTCCA61240.21137679328564588RNA PCR Primer, Index 1 (100% over 28bp)
AGCTACATTGTCTGCTGGGTTTTGGAATTCTCGGGTGCCAAGGAACTCCA60410.2085119543172088RNA PCR Primer, Index 1 (100% over 28bp)
AGCTACATCTGGCTACTGGGTCTTGGAATTCTCGGGTGCCAAGGAACTCC59500.20537098629157297RNA PCR Primer, Index 1 (100% over 27bp)
TCTTTGGTTATCTAGCTGTATGTGGAATTCTCGGGTGCCAAGGAACTCCA57550.19864034052235335RNA PCR Primer, Index 1 (100% over 28bp)
TGGAATTCTCGGGTGCCAAGGCACTCCAGTCACCGTACGATCTCGTATGC54790.18911388804899634RNA PCR Primer, Index 22 (98% over 50bp)
TCACAGTGAACCGGTCTCTTTGGAATTCTCGGGTGCCAAGGAACTCCAGT54490.18807840408450102RNA PCR Primer, Index 1 (100% over 30bp)
TCACAGTGAACAGGTCTCTTTTGGAATTCTCGGGTGCCAAGGAACTCCAG52480.18114066152238234RNA PCR Primer, Index 1 (100% over 29bp)
AAGCTGCCAGCTGAAGAACTTGGAATTCTCGGGTGCCAAGGAACTCCAGT52020.1795529194434895RNA PCR Primer, Index 1 (100% over 30bp)
ACCATCGACCGTTGACTGTGCCTGGAATTCTCGGGTGCCAAGGAACTCCA49610.17123453159537705RNA PCR Primer, Index 1 (100% over 28bp)
AACATTCAACGCTGTCGGTGGTGGAATTCTCGGGTGCCAAGGAACTCCAG48690.16805904743759137RNA PCR Primer, Index 1 (100% over 29bp)
TGAGGTAGTTGGTTGTATTGTTTGGAATTCTCGGGTGCCAAGGAACTCCA47100.16257098242576618RNA PCR Primer, Index 1 (100% over 28bp)
AGCTACATCTGGCTACTGGGTCTCTGGAATTCTCGGGTGCCAAGGACCTC46560.16070711128967458RNA PCR Primer, Index 1 (96% over 26bp)
AAGCTGCCAGTTGAAGAGCTGTTGGAATTCTCGGGTGCCAAGGAACTCCA46370.16005130477882754RNA PCR Primer, Index 1 (100% over 28bp)
AGCTACATTGTCTGCTGGGTTTCTGGAATTCTCGGGTGCCAAGGAACTCC46160.1593264660036808RNA PCR Primer, Index 1 (100% over 27bp)
TGAGGTAGTAGGTTGTGTGGTTTGGAATTCTCGGGTGCCAAGGAACTCCA45650.15756614326403873RNA PCR Primer, Index 1 (100% over 28bp)
AACATTCAACGATGTCGGTGAGTTGGAATTCTCGGGTGCCAAGGAACTCC45470.15694485288534155RNA PCR Primer, Index 1 (100% over 27bp)
AGAATAATGCCAGCAGTCGGTCTGGAATTCTCGGGTGCCAAGGAACTCCA45200.15601291731729575RNA PCR Primer, Index 1 (100% over 28bp)
AACCCGTAGATCCGAACTTGTTGGAATTCTCGGGTGCCAAGGAACTCCAG44870.1548738849563509RNA PCR Primer, Index 1 (100% over 29bp)
TCCCTGAGACCCTAACTTGTGTGGAATTCTCGGGTGCCAAGGAACTCCAG44310.15294098155595962RNA PCR Primer, Index 1 (100% over 29bp)
TTCAAGTAATCCAGGATAGGCTTTGGAATTCTCGGGTGCCAAGGAACTCC40960.14137807728576182RNA PCR Primer, Index 1 (100% over 27bp)
TTCCCTTTGTCATCCTATGCCTGTGGAATTCTCGGGTGCCAAGGAACTCC40850.1409983998321135RNA PCR Primer, Index 1 (100% over 27bp)
TCTTTGGTTATCTAGCTGTCTGTGGAATTCTCGGGTGCCAAGGAACTCCA40560.13999743199976805RNA PCR Primer, Index 1 (100% over 28bp)
AGCTGGTGTTGTGAATCAGGCCGTGGAATTCTCGGGTGCCAAGGAACTCC40380.13937614162107087RNA PCR Primer, Index 1 (100% over 27bp)
GTACAGTACTGTGATAACTGATGGAATTCTCGGGTGCCAAGGAACTCCAG39490.13630420585973474RNA PCR Primer, Index 1 (100% over 29bp)
AACATTCAACGCTGTCGGTGAGATGGAATTCTCGGGTGCCAAGGAACTCC38810.1339571088735453RNA PCR Primer, Index 1 (100% over 27bp)
TCCTCCCGGGGCTACGCCTGTCTGAGGGTCGCTTGGAATTCTCGGGTGCC38080.13143743122660667No Hit
TGAGATGAAGCACTGTAGCTCTGGAATTCTCGGGTGCCAAGGAACTCCAG36960.12757162442582412RNA PCR Primer, Index 1 (100% over 29bp)
CTTTGGTTATCTAGCTGTATGATGGAATTCTCGGGTGCCAAGGAACTCCA36570.1262254952719802RNA PCR Primer, Index 1 (100% over 28bp)
TAAAGCTAGAGAACCGAAAGTAATGGAATTCTCGGGTGCCAAGGAACTCC36540.1261219468755307RNA PCR Primer, Index 1 (100% over 27bp)
TGAGGTAGTAGATTGAATAGTTTGGAATTCTCGGGTGCCAAGGAACTCCA35580.12280839818914564RNA PCR Primer, Index 1 (100% over 28bp)
TTCACCGTGGCTAAGTTCTGCTGGAATTCTCGGGTGCCAAGGAACTCCAG35490.12249775299979704RNA PCR Primer, Index 1 (100% over 29bp)
TGAGATGAAGCACTGTAGCTTGGAATTCTCGGGTGCCAAGGAACTCCAGT35280.12177291422465031RNA PCR Primer, Index 1 (100% over 30bp)
AACATTCAACGCTGTCGGTGTTGGAATTCTCGGGTGCCAAGGAACTCCAG35100.12115162384595311RNA PCR Primer, Index 1 (100% over 29bp)
TACCCTGTAGATCCGGATTTGTGTGGAATTCTCGGGTGCCAAGGAACTCC34670.11966743016350982RNA PCR Primer, Index 1 (100% over 27bp)
ACCATCGACCGTTGACTGTGCCTTGGAATTCTCGGGTGCCAAGGAACTCC34620.11949484950276061RNA PCR Primer, Index 1 (100% over 27bp)
TGGAATTCTCGGGTGCCAAGGCACTCCAGTCACCGTACGATCTCGTCTGC34280.1183213010096659RNA PCR Primer, Index 22 (97% over 46bp)
TGTGGTCGGCGTCCTGGAATTCTCGGGTGCCAAGGAACTCCAGTCACCGT34020.11742388157376996RNA PCR Primer, Index 12 (97% over 36bp)
TTCAAGTAATCCAGGATAGGTTTGGAATTCTCGGGTGCCAAGGAACTCCA33550.11580162336272727RNA PCR Primer, Index 1 (100% over 28bp)
TGAGGTAGTTGGTTGTATAGTTGGAATTCTCGGGTGCCAAGGAACTCCAG33250.11476613939823195RNA PCR Primer, Index 1 (100% over 29bp)
TCTTTGGTTATCTAGCTGTATGTTGGAATTCTCGGGTGCCAAGGAACTCC33150.11442097807673351RNA PCR Primer, Index 1 (100% over 27bp)
TCCCTGAGACCCTAACTTGTGCTGGAATTCTCGGGTGCCAAGGAACTCCA32620.11259162307279177RNA PCR Primer, Index 1 (100% over 28bp)
ACCGTGGCTTTAGATTGTTACTTGGAATTCTCGGGTGCCAAGGAACTCCA32300.11148710684399674RNA PCR Primer, Index 1 (100% over 28bp)
TAAAGCTAGAGAACCGAAAGTATTGGAATTCTCGGGTGCCAAGGAACTCC31910.11014097769015281RNA PCR Primer, Index 1 (100% over 27bp)
TGGAATTCTCGGGTGCCAAGGAACTCCATTCACCGTACGATCTCGTATGC30870.10655129994656903RNA PCR Primer, Index 22 (98% over 50bp)
TGAGGTAGTAGTTTGTGCTGTTTTGGAATTCTCGGGTGCCAAGGAACTCC30260.10444581588542852RNA PCR Primer, Index 1 (100% over 27bp)
ATCTTCGGTTGGTCCCGGATAGCTGGCCCTCGGGCCGGTGCGGAGAGCCG30180.10416968682822977No Hit
GTTTCCGTAGTGTAGTGGTTATCACGTTCGCCTTGGAATTCTCGGGTGCC30060.10375549324243166No Hit
CCCTGAGACCCTTAACCTGTGCTGGAATTCTCGGGTGCCAAGGAACTCCA30050.1037209771102818RNA PCR Primer, Index 1 (100% over 28bp)
TAAGGCACGCGGTGAATGCCTGGAATTCTCGGGTGCCAAGGAACTCCAGT29060.10030388002744722RNA PCR Primer, Index 1 (100% over 30bp)

[FAIL]Adapter Content

Adapter graph

[FAIL]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
TTGGCAA8950.046.643942
CAACGAT15500.046.643947
GGATCCG501.4551915E-1146.643948
TCGATAG253.1488686E-546.643944
GAGCGGC4750.046.643943
GTCAAAA2100.046.643948
GCGGCAT4750.046.643945
TTCATCG253.1488686E-546.643945
TCGACGC3900.046.643946
TTCGATA253.1488686E-546.643943
TTCGACG3900.046.643945
TGTCATC12450.046.6439368
AGGTAGG600.046.6439363
TCGCAGG452.7102942E-1046.6439367
ATCTACG404.965841E-946.6439368
TAAAGTA205.8949576E-446.6439363
GTACAAG650.046.6439363
CATGCCA1900.046.6439366
ATGTGCC650.046.6439362
CGCATCA700.046.6439367