FastQCFastQC Report
Mon 5 Dec 2016
JM1_3_GTTTCG_L004_R1_001.fastq

Summary

[OK]Basic Statistics

MeasureValue
FilenameJM1_3_GTTTCG_L004_R1_001.fastq
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences14180611
Sequences flagged as poor quality0
Sequence length50
%GC50

[OK]Per base sequence quality

Per base quality graph

[OK]Per tile sequence quality

Per base quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[FAIL]Per base sequence content

Per base sequence content

[FAIL]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[OK]Sequence Length Distribution

Sequence length distribution

[FAIL]Sequence Duplication Levels

Duplication level graph

[FAIL]Overrepresented sequences

SequenceCountPercentagePossible Source
TGGAATTCTCGGGTGCCAAGGAACTCCAGTCACGTTTCGATCTCGTATGC446132531.46073889199838RNA PCR Primer, Index 21 (100% over 50bp)
ACTGTATAAGGTACATATGGTTGAGTGTCGTATGGAATTCTCGGGTGCCA11166107.8742023175165015No Hit
ATGACCTATGAATTGACAGCCATGGAATTCTCGGGTGCCAAGGAACTCCA7048924.970815432423892RNA PCR Primer, Index 1 (100% over 28bp)
ATGACCTATGAATTGACAGCCTGGAATTCTCGGGTGCCAAGGAACTCCAG6006454.2356778561939255RNA PCR Primer, Index 1 (100% over 29bp)
TGAGATGAAGCACTGTAGCTCTTGGAATTCTCGGGTGCCAAGGAACTCCA2074021.4625744969663155RNA PCR Primer, Index 1 (100% over 28bp)
CTGTATAAGGTACATATGGTTGAGTGTCGTATGGAATTCTCGGGTGCCAA1954511.378297451358055No Hit
TGTAACAGCAACTCCATGTGGATGGAATTCTCGGGTGCCAAGGAACTCCA1495151.0543621850990765RNA PCR Primer, Index 1 (100% over 28bp)
TTCAAGTAATCCAGGATAGGCTTGGAATTCTCGGGTGCCAAGGAACTCCA1479991.0436715315017104RNA PCR Primer, Index 1 (100% over 28bp)
TGAGATGAAGCACTGTAGCTCTGGAATTCTCGGGTGCCAAGGAACTCCAG1346950.9498532891142701RNA PCR Primer, Index 1 (100% over 29bp)
TGAGGTAGTAGGTTGTATAGTTTGGAATTCTCGGGTGCCAAGGAACTCCA1023050.7214428207642111RNA PCR Primer, Index 1 (100% over 28bp)
TAGCTTATCAGACTGGTGTTGGCTGGAATTCTCGGGTGCCAAGGAACTCC869310.6130271819740348RNA PCR Primer, Index 1 (100% over 27bp)
TCCCTGGTGGTCTAGTGGTTAGGATTCGGCGCTCTGGAATTCTCGGGTGC858830.6056368093025046No Hit
GCATTGGTGGTTCAGTGGTAGAATTCTCGCCTTGGAATTCTCGGGTGCCA706520.49822958968411163No Hit
AAGCTGCCAGCTGAAGAACTGTTGGAATTCTCGGGTGCCAAGGAACTCCA664860.46885144793831524RNA PCR Primer, Index 1 (100% over 28bp)
TATTGCACTTGTCCCGGCCTGTTGGAATTCTCGGGTGCCAAGGAACTCCA610000.4301648215299045RNA PCR Primer, Index 1 (100% over 28bp)
TCAGTAACTGGAATCTGTCCCTTGGAATTCTCGGGTGCCAAGGAACTCCA582290.41062405562073456RNA PCR Primer, Index 1 (100% over 28bp)
TGGAGTGTGACAATGGTGTTTGTGGAATTCTCGGGTGCCAAGGAACTCCA523250.3689897424024959RNA PCR Primer, Index 1 (100% over 28bp)
AACATTCAACGCTGTCGGTGAGTGGAATTCTCGGGTGCCAAGGAACTCCA485270.34220669335051923RNA PCR Primer, Index 1 (100% over 28bp)
AACATTCAACGCTGTCGGTGAGTTGGAATTCTCGGGTGCCAAGGAACTCC484280.34150855700082317RNA PCR Primer, Index 1 (100% over 27bp)
TCCCTGTGGTCTAGTGGTTAGGATTCGGCGCTCTGGAATTCTCGGGTGCC460910.3250283080186037No Hit
GTTCTACAGTCCGACTGGAATTCTCGGGTGCCAAGGAACTCCAGTCACGT460610.32481675154899886RNA PCR Primer, Index 1 (97% over 35bp)
TGGACGTGATGAGCAGGTGTTACCGCCCCAGTCTGATGTTTGGTGACTGA435990.30745501727675906No Hit
TGAGATGAAGCACTGTAGCTTGGAATTCTCGGGTGCCAAGGAACTCCAGT430630.30367520835315204RNA PCR Primer, Index 1 (100% over 30bp)
TAACGGAACCCATAATGCAGCTGTGGAATTCTCGGGTGCCAAGGAACTCC412800.29110170217630255RNA PCR Primer, Index 1 (100% over 27bp)
GATCCATGATGACATTAAAACATAACGTGACTGTTGGATGAAGCTTGCGG364860.25729497833344417No Hit
TGTAACAGCAACTCCATGTGGAATGGAATTCTCGGGTGCCAAGGAACTCC357100.2518227176529982RNA PCR Primer, Index 1 (100% over 27bp)
ACCACGTTCCCGTGGTGGAATTCTCGGGTGCCAAGGAACTCCAGTCACGT353050.24896670531333243RNA PCR Primer, Index 1 (97% over 35bp)
ATGACCTATGAATTGACAGCCTTGGAATTCTCGGGTGCCAAGGAACTCCA351960.24819805014043472RNA PCR Primer, Index 1 (100% over 28bp)
TAACACTGTCTGGTAACGATGTTGGAATTCTCGGGTGCCAAGGAACTCCA331110.23349487550289616RNA PCR Primer, Index 1 (100% over 28bp)
ATCCATGATGACATTAAAACATAACGTGACTGTTGGATGAAGCTTGCGGA325030.22920733105223748No Hit
CTACAGTCCGACGATCTGGAATTCTCGGGTGCCAAGGAACTCCAGTCACG305610.21551257558648212RNA PCR Primer, Index 6 (100% over 34bp)
TCAGTAACTGGAATCTGTCCCTGTGGAATTCTCGGGTGCCAAGGAACTCC286710.20218451800137527RNA PCR Primer, Index 1 (100% over 27bp)
ATGACCTATGAATTGACAGCCATTGGAATTCTCGGGTGCCAAGGAACTCC285650.20143701847543805RNA PCR Primer, Index 1 (100% over 27bp)
TGAGAACTGAATTCCATAGATGGTGGAATTCTCGGGTGCCAAGGAACTCC284580.20068246706718065RNA PCR Primer, Index 1 (100% over 27bp)
CTGTATAAGGTACATATGGTTGAGTGTCGTATGGCATTCTCGGGTGCCAA283190.1997022554246781No Hit
TTGCGGCCCCGGGTTCCTCCCGGGGCTACGCCTGTCTGAGGGTCGCTTGG278700.1965359602629252No Hit
GTTTCCGTAGTGTAGTGGTTATCACGTTCGCCTTGGAATTCTCGGGTGCC277180.19546407415026051No Hit
TAGCTTATCAGACTGGTGTTGGTGGAATTCTCGGGTGCCAAGGAACTCCA275360.19418063156799095RNA PCR Primer, Index 1 (100% over 28bp)
TGGAATTCTCGGGTGCCAGGAACTCCAGTCACGTTTCGATCTCGTATGCC268750.18951933735436363RNA PCR Primer, Index 21 (97% over 35bp)
TTCAAGTAATCCAGGATAGGTTTGGAATTCTCGGGTGCCAAGGAACTCCA264550.18655754677989544RNA PCR Primer, Index 1 (100% over 28bp)
AGTTCTACAGTCCGACGATCTGGAATTCTCGGGTGCCAAGGAACTCCAGT250240.1764663031797431RNA PCR Primer, Index 1 (100% over 30bp)
TTTGTTCGTTCGGCTCGCGTTATGGAATTCTCGGGTGCCAAGGAACTCCA249640.17604319024053336RNA PCR Primer, Index 1 (100% over 28bp)
CATGGAATTCTCGGGTGCCAAGGAACTCCAGTCACGTTTCGATCTCGTAT239360.16879385521540644RNA PCR Primer, Index 21 (100% over 48bp)
TTCACAGTGGTTAAGTTCTGTGGAATTCTCGGGTGCCAAGGAACTCCAGT238480.16817328957123215RNA PCR Primer, Index 1 (100% over 30bp)
CCTGTCTGAGGGTCGCTTGGAATTCTCGGGTGCCAAGGAACTCCAGTCAC223460.15758136232634828RNA PCR Primer, Index 1 (100% over 33bp)
ACAGTCCGACGATCTGGAATTCTCGGGTGCCAAGGAACTCCAGTCACGTT223340.15749673973850634RNA PCR Primer, Index 9 (97% over 36bp)
AGCCTGTGATGATACAAGTTATCCCTGTCTGAACTCTGGTGTGGAATTCT218590.1541470956364292No Hit
TGAGGTAGTAGTTTGTATAGTTTGGAATTCTCGGGTGCCAAGGAACTCCA211920.1494434901288809RNA PCR Primer, Index 1 (100% over 28bp)
GCATTGTGGTTCAGTGGTAGAATTCTCGCCTTGGAATTCTCGGGTGCCAA211010.14880176883774612No Hit
ATGACCTATGAATTGACAGCTGGAATTCTCGGGTGCCAAGGAACTCCAGT210260.14827287766373395RNA PCR Primer, Index 1 (100% over 30bp)
GTCCAGTTTTCCCAGGAATCCCTTGGAATTCTCGGGTGCCAAGGAACTCC207210.14612205355608443RNA PCR Primer, Index 1 (100% over 27bp)
GACTGTATAAGGTACATATGGTTGAGTGTCGTATGGAATTCTCGGGTGCC203850.14375262109650988No Hit
TAGTTCTACAGTCCGACGATCTGGAATTCTCGGGTGCCAAGGAACTCCAG199700.14082608993364248RNA PCR Primer, Index 1 (100% over 29bp)
TGAGGTAGTAGGTTGTATAGTTGGAATTCTCGGGTGCCAAGGAACTCCAG198260.1398106188795391RNA PCR Primer, Index 1 (100% over 29bp)
GTTTCCGTAGTGTAGTGGTTATCACGTTCGCCTCTGGAATTCTCGGGTGC195990.13820984159286226No Hit
TCTACAGTCCGACGATCTGGAATTCTCGGGTGCCAAGGAACTCCAGTCAC195550.1378995587707751RNA PCR Primer, Index 1 (100% over 33bp)
TGGAATTCTCGGGGGCCAAGGAACTCCAGTCACGTTTCGATCTCGTATGC189980.13397166031844468RNA PCR Primer, Index 21 (98% over 50bp)
TGGAGTGTGACAATGGTGTTTTGGAATTCTCGGGTGCCAAGGAACTCCAG189830.13386588208364225RNA PCR Primer, Index 1 (100% over 29bp)
CACCACGTTCCCGTGGTGGAATTCTCGGGTGCCAAGGAACTCCAGTCACG188230.13273758091241628RNA PCR Primer, Index 6 (100% over 34bp)
TGGAGTGTGACAATGGTGTTTGTTGGAATTCTCGGGTGCCAAGGAACTCC185880.1310803885671781RNA PCR Primer, Index 1 (100% over 27bp)
TTCAGTGATGTTTGACAAATGTCTGACCTGAACTGCAATGTGGACAGATC182810.12891546069488824No Hit
TCAGTAACAAGGATTCATCCTGTGGAATTCTCGGGTGCCAAGGAACTCCA180630.12737815034909286RNA PCR Primer, Index 1 (100% over 28bp)
TACAGTCCGACGATCTGGAATTCTCGGGTGCCAAGGAACTCCAGTCACGT179700.12672232529331776RNA PCR Primer, Index 1 (97% over 35bp)
TAACACTGTCTGGTAACGATGTGGAATTCTCGGGTGCCAAGGAACTCCAG179430.12653192447067338RNA PCR Primer, Index 1 (100% over 29bp)
TGGAATTCTCGGGTGCCAAGGAAATCCAGTCACGTTTCGATCTCGTATGC176050.12414838824645849RNA PCR Primer, Index 21 (98% over 50bp)
CAGAGTTCTACAGTCCGACGATCTGGAATTCTCGGGTGCCAAGGAACTCC173220.12215270554985255RNA PCR Primer, Index 1 (100% over 27bp)
TTCTACAGTCCGACGATCTGGAATTCTCGGGTGCCAAGGAACTCCAGTCA165870.1169695720445332RNA PCR Primer, Index 1 (100% over 32bp)
TGTAACAGCAACTCCATGTGGTGGAATTCTCGGGTGCCAAGGAACTCCAG163610.1153758466401765RNA PCR Primer, Index 1 (100% over 29bp)
GGACAACTCTTAGCGGTGGAATTCTCGGGTGCCAAGGAACTCCAGTCACG158600.11184285359777517RNA PCR Primer, Index 6 (100% over 34bp)
TCAGTAACAAGGATTCATCCTGTTGGAATTCTCGGGTGCCAAGGAACTCC158460.11174412724529288RNA PCR Primer, Index 1 (100% over 27bp)
CATTGCACTTGTCTCGGTCTGATGGAATTCTCGGGTGCCAAGGAACTCCA157030.11073570807350967RNA PCR Primer, Index 1 (100% over 28bp)
TATTGCACTTGTCCCGGCCTGTTTGGAATTCTCGGGTGCCAAGGAACTCC152080.1072450263250293RNA PCR Primer, Index 1 (100% over 27bp)
TGGAATTCTCGGGTGCCAAGGAACTCCAGTCACGCTTCGATCTCGTATGC150920.10642700797589046RNA PCR Primer, Index 21 (98% over 50bp)
CACATGATCATTGACATGTTGAACGCATATTGCGCCTTATACATTTGGAA150520.10614493268308396No Hit
TGCCTGTGATGAGACTCTCGACGGGCGGACTGAATGGGTTTTCACCCTCC144120.10163172799818004No Hit
AGAGTTCTACAGTCCGACGATCTGGAATTCTCGGGTGCCAAGGAACTCCA143950.10151184599873728RNA PCR Primer, Index 1 (100% over 28bp)
TGGACAACTCTTAGCGGTGGAATTCTCGGGTGCCAAGGAACTCCAGTCAC143650.10130028952913242RNA PCR Primer, Index 1 (100% over 33bp)

[FAIL]Adapter Content

Adapter graph

[FAIL]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
CATTACG1200.043.99893633
CGTTACG1600.043.99893633
CGCTTAT302.5301779E-643.99893633
ACGTCTA408.3273335E-943.9981632
ACTAGTC207.862899E-443.99614323
AGGGCCA1900.043.99598725
GCATGCG3350.043.99598724
TAGGGCC1800.043.99598324
GTATCAT502.7284841E-1143.99490418
TAGTTAT3600.043.994918
TTAATAG408.3327905E-943.99474719
TCAATAC408.3327905E-943.9942812
TTAACAG408.3327905E-943.9942813
ATATTAG351.4491161E-743.9942814
CACATTA1200.043.9941331
AATTGAG600.043.9941311
ATCTATA502.7284841E-1143.99412510
TTATCTA502.7284841E-1143.9941258
TCGTGTA254.4489076E-543.9941258
CGCTCTA254.4489076E-543.99412530