FastQCFastQC Report
Mon 5 Dec 2016
JM27_1_GTAGAG_L003_R1_001.fastq

Summary

[OK]Basic Statistics

MeasureValue
FilenameJM27_1_GTAGAG_L003_R1_001.fastq
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences3813639
Sequences flagged as poor quality0
Sequence length50
%GC51

[OK]Per base sequence quality

Per base quality graph

[WARN]Per tile sequence quality

Per base quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[FAIL]Per base sequence content

Per base sequence content

[FAIL]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[OK]Sequence Length Distribution

Sequence length distribution

[FAIL]Sequence Duplication Levels

Duplication level graph

[FAIL]Overrepresented sequences

SequenceCountPercentagePossible Source
AACATTCAACGCTGTCGGTGAGTGGAATTCTCGGGTGCCAAGGAACTCCA3447829.040761330582155RNA PCR Primer, Index 1 (100% over 28bp)
TTCAAGTAATCCAGGATAGGCTTGGAATTCTCGGGTGCCAAGGAACTCCA2213035.802935201784962RNA PCR Primer, Index 1 (100% over 28bp)
AACATTCAACGCTGTCGGTGAGTTGGAATTCTCGGGTGCCAAGGAACTCC1828254.7939776156054625RNA PCR Primer, Index 1 (100% over 27bp)
TGAGGTAGTAGGTTGTATAGTTTGGAATTCTCGGGTGCCAAGGAACTCCA1750304.589579663937777RNA PCR Primer, Index 1 (100% over 28bp)
TCACAGTGAACCGGTCTCTTTTGGAATTCTCGGGTGCCAAGGAACTCCAG698371.831243072561404RNA PCR Primer, Index 1 (100% over 29bp)
AACATTCAACGCTGTCGGTGATGGAATTCTCGGGTGCCAAGGAACTCCAG647641.6982205185126331RNA PCR Primer, Index 1 (100% over 29bp)
TCCCTGAGACCCTTAACCTGTTGGAATTCTCGGGTGCCAAGGAACTCCAG644521.690039356111053RNA PCR Primer, Index 1 (100% over 29bp)
AACCCGTAGATCCGAACTTGTGTGGAATTCTCGGGTGCCAAGGAACTCCA485951.2742422657204837RNA PCR Primer, Index 1 (100% over 28bp)
TCCCTGAGACCCTTAACCTGTGTGGAATTCTCGGGTGCCAAGGAACTCCA443531.1630099230682296RNA PCR Primer, Index 1 (100% over 28bp)
TATTGCACTCGTCCCGGCCTCCTGGAATTCTCGGGTGCCAAGGAACTCCA440131.1540945537844562RNA PCR Primer, Index 1 (100% over 28bp)
TGAGGTAGTAGGTTGTATAGTTGGAATTCTCGGGTGCCAAGGAACTCCAG380900.9987835765262523RNA PCR Primer, Index 1 (100% over 29bp)
TGAGGTAGTAGTTTGTGCTGTTTGGAATTCTCGGGTGCCAAGGAACTCCA369630.9692317495179801RNA PCR Primer, Index 1 (100% over 28bp)
TAAAGCTAGAGAACCGAAAGTATGGAATTCTCGGGTGCCAAGGAACTCCA353900.9279850557433464RNA PCR Primer, Index 1 (100% over 28bp)
TAAAGCTAGAGAACCGAAAGTTGGAATTCTCGGGTGCCAAGGAACTCCAG314960.8258778557697778RNA PCR Primer, Index 1 (100% over 29bp)
TGAGGTAGTAGTTTGTATAGTTTGGAATTCTCGGGTGCCAAGGAACTCCA290370.7613987585086056RNA PCR Primer, Index 1 (100% over 28bp)
AACATTCATTGCTGTCGGTGGGTGGAATTCTCGGGTGCCAAGGAACTCCA276690.7255275079785999RNA PCR Primer, Index 1 (100% over 28bp)
TCCAGCATCAGTGATTTTGTTTGGAATTCTCGGGTGCCAAGGAACTCCAG275770.7231151139371084RNA PCR Primer, Index 1 (100% over 29bp)
TTAAAGGGAATTTGCGACTGTTTGGAATTCTCGGGTGCCAAGGAACTCCA262270.6877158535456555RNA PCR Primer, Index 1 (100% over 28bp)
TCCCTGAGACCCTTAACCTGTGATGGAATTCTCGGGTGCCAAGGAACTCC257060.674054361201991RNA PCR Primer, Index 1 (100% over 27bp)
TTGCATAGTCACAAAAGTGATCTGGAATTCTCGGGTGCCAAGGAACTCCA212970.5584429989309424RNA PCR Primer, Index 1 (100% over 28bp)
AAGCTGCCAGCTGAAGAACTGTTGGAATTCTCGGGTGCCAAGGAACTCCA187030.49042397563062473RNA PCR Primer, Index 1 (100% over 28bp)
TAGCTTATCAGACTGGTGTTGGCTGGAATTCTCGGGTGCCAAGGAACTCC186880.4900306505151641RNA PCR Primer, Index 1 (100% over 27bp)
TCTTTGGTTATCTAGCTGTATGATGGAATTCTCGGGTGCCAAGGAACTCC186270.48843112837895775RNA PCR Primer, Index 1 (100% over 27bp)
AACATTCATTGCTGTCGGTGGGTTGGAATTCTCGGGTGCCAAGGAACTCC162890.42712485371583414RNA PCR Primer, Index 1 (100% over 27bp)
AGCTACATCTGGCTACTGGGTCTCTGGAATTCTCGGGTGCCAAGGAACTC161100.4224311740046711RNA PCR Primer, Index 1 (100% over 26bp)
TCTTTGGTTATCTAGCTGTATTGGAATTCTCGGGTGCCAAGGAACTCCAG159860.4191796863835303RNA PCR Primer, Index 1 (100% over 29bp)
AACCCGTAGATCCGAACTTGTTGGAATTCTCGGGTGCCAAGGAACTCCAG156030.4091367851021033RNA PCR Primer, Index 1 (100% over 29bp)
ACCTTGGCTTTAGACTGCTTACTTGGAATTCTCGGGTGCCAAGGAACTCC155040.40654083934006335RNA PCR Primer, Index 1 (100% over 27bp)
TCACAGTGAACCGGTCTCTTTTTGGAATTCTCGGGTGCCAAGGAACTCCA146930.38527506143082757RNA PCR Primer, Index 1 (100% over 28bp)
TACCCTGTAGAACCGAATTTGTTGGAATTCTCGGGTGCCAAGGAACTCCA146720.3847244062691828RNA PCR Primer, Index 1 (100% over 28bp)
TGAGGTAGTAGGTTGTATAGTTTTGGAATTCTCGGGTGCCAAGGAACTCC146180.38330843585352464RNA PCR Primer, Index 1 (100% over 27bp)
TGAGGTAGTTGGTTGTATAGTTTGGAATTCTCGGGTGCCAAGGAACTCCA145070.3803978299991163RNA PCR Primer, Index 1 (100% over 28bp)
TTCAAGTAATCCAGGATAGGCTGGAATTCTCGGGTGCCAAGGAACTCCAG137060.35939426883352094RNA PCR Primer, Index 1 (100% over 29bp)
TTCACAGTGGCTAAGTTCTGCTGGAATTCTCGGGTGCCAAGGAACTCCAG132590.34767318039279543RNA PCR Primer, Index 1 (100% over 29bp)
TCCCTGAGACCCTAACTTGTGATGGAATTCTCGGGTGCCAAGGAACTCCA124940.32761359950430546RNA PCR Primer, Index 1 (100% over 28bp)
TATTGCACTTGTCCCGGCCTGTTGGAATTCTCGGGTGCCAAGGAACTCCA122990.3225003730033178RNA PCR Primer, Index 1 (100% over 28bp)
TACCCTGTAGATCCGGATTTGTTGGAATTCTCGGGTGCCAAGGAACTCCA115400.3025981221610121RNA PCR Primer, Index 1 (100% over 28bp)
TAAAGGGAATTTGCGACTGTTTGGAATTCTCGGGTGCCAAGGAACTCCAG114710.3007888266298934RNA PCR Primer, Index 1 (100% over 29bp)
TTCACCGTGGCTAAGTTCTGCTGGAATTCTCGGGTGCCAAGGAACTCCAG114280.2996612946322397RNA PCR Primer, Index 1 (100% over 29bp)
TCCAGCATCAGTGATTTTGTTGTGGAATTCTCGGGTGCCAAGGAACTCCA111130.2914014672075674RNA PCR Primer, Index 1 (100% over 28bp)
TCACAGTGAACCGGTCTCTTTGGAATTCTCGGGTGCCAAGGAACTCCAGT110240.28906773818916787RNA PCR Primer, Index 1 (100% over 30bp)
TAACAGTCTACAGTCATGGCTTGGAATTCTCGGGTGCCAAGGAACTCCAG110060.28859574805061516RNA PCR Primer, Index 1 (100% over 29bp)
CCACGTTCCCGTGGTGGAATTCTCGGGTGCCAAGGAACTCCAGTCACGTA108840.28539670377820237RNA PCR Primer, Index 3 (97% over 36bp)
TATGGCTTTTTATTCCTATCTGTGGAATTCTCGGGTGCCAAGGAACTCCA108500.2845051668498251RNA PCR Primer, Index 1 (100% over 28bp)
AACCCGTAGATCCGAACTTGTGATGGAATTCTCGGGTGCCAAGGAACTCC104200.2732298468732882RNA PCR Primer, Index 1 (100% over 27bp)
CCCTGAGACCCTTAACCTGTGATGGAATTCTCGGGTGCCAAGGAACTCCA103150.2704765710650641RNA PCR Primer, Index 1 (100% over 28bp)
TAAAGCTAGAGAACCGAAAGTCTGGAATTCTCGGGTGCCAAGGAACTCCA101260.2655206746102607RNA PCR Primer, Index 1 (100% over 28bp)
AACATTCAACGCTGTCGGTGGTGGAATTCTCGGGTGCCAAGGAACTCCAG97010.25437646300554406RNA PCR Primer, Index 1 (100% over 29bp)
TGAGATGAAGCACTGTAGCTCTTGGAATTCTCGGGTGCCAAGGAACTCCA95720.250993867012583RNA PCR Primer, Index 1 (100% over 28bp)
TTGCGGCCCCGGGTTCCTCCCGGGGCTACGCCTGTCTGAGGGTCGCTTGG95040.2492107931558283No Hit
AAGCTGCCAGCTGAAGAACTTGGAATTCTCGGGTGCCAAGGAACTCCAGT90530.23738481801764666RNA PCR Primer, Index 1 (100% over 30bp)
TTCCCTTTGTCATCCTATGCCTGTGGAATTCTCGGGTGCCAAGGAACTCC89030.23345156686304078RNA PCR Primer, Index 1 (100% over 27bp)
CCCTGCGACCCTTAACCTGTGATGGAATTCTCGGGTGCCAAGGAACTCCA88340.23164227133192208RNA PCR Primer, Index 1 (100% over 28bp)
TTCACAGTGGCTAAGTTCTGTGGAATTCTCGGGTGCCAAGGAACTCCAGT84090.22049805972720543RNA PCR Primer, Index 1 (100% over 30bp)
TCCCTGAGACCCTAACTTGTGTGGAATTCTCGGGTGCCAAGGAACTCCAG79030.20722989249900162RNA PCR Primer, Index 1 (100% over 29bp)
TCTTTGGTTATCTAGCTGTATGTGGAATTCTCGGGTGCCAAGGAACTCCA77690.20371618813422038RNA PCR Primer, Index 1 (100% over 28bp)
TGAGATGAAGCACTGTAGCTTGGAATTCTCGGGTGCCAAGGAACTCCAGT76680.2010677990234524RNA PCR Primer, Index 1 (100% over 30bp)
ACCATCGACCGTTGACTGTGCCTGGAATTCTCGGGTGCCAAGGAACTCCA76680.2010677990234524RNA PCR Primer, Index 1 (100% over 28bp)
TCCCTGAGACCCTAACTTGTTGGAATTCTCGGGTGCCAAGGAACTCCAGT75350.1975803163330352RNA PCR Primer, Index 1 (100% over 30bp)
TACCCTGTAGAACCGAATTTGCGTGGAATTCTCGGGTGCCAAGGAACTCC75130.19700343949702634RNA PCR Primer, Index 1 (100% over 27bp)
TAAAGCTAGAGAACCGAAAGTAATGGAATTCTCGGGTGCCAAGGAACTCC72300.18958270565200325RNA PCR Primer, Index 1 (100% over 27bp)
TGAGATGAAGCACTGTAGCTCTGGAATTCTCGGGTGCCAAGGAACTCCAG71430.18730141998233182RNA PCR Primer, Index 1 (100% over 29bp)
TAAAGCTAGAGAACCGAAAGTATTGGAATTCTCGGGTGCCAAGGAACTCC71320.18701298156432739RNA PCR Primer, Index 1 (100% over 27bp)
AACATTCAACGCTGTCGGTGAGATGGAATTCTCGGGTGCCAAGGAACTCC70050.1836828289200944RNA PCR Primer, Index 1 (100% over 27bp)
TGAGGTAGTAGATTGAATAGTTTGGAATTCTCGGGTGCCAAGGAACTCCA68530.17969713441676047RNA PCR Primer, Index 1 (100% over 28bp)
TCCCTGAGACCCTTAACCTGTGTTGGAATTCTCGGGTGCCAAGGAACTCC67160.1761047650288871RNA PCR Primer, Index 1 (100% over 27bp)
TTCCCTTTGTCATCCTATGCCTTGGAATTCTCGGGTGCCAAGGAACTCCA66570.1745576862414088RNA PCR Primer, Index 1 (100% over 28bp)
TACCCTGTAGAACCGAATGTGTTGGAATTCTCGGGTGCCAAGGAACTCCA66040.17316793750011472RNA PCR Primer, Index 1 (100% over 28bp)
AAGCTGCCAGTTGAAGAGCTGTTGGAATTCTCGGGTGCCAAGGAACTCCA65960.1729581641052024RNA PCR Primer, Index 1 (100% over 28bp)
ACCGTGGCTTTAGATTGTTACTTGGAATTCTCGGGTGCCAAGGAACTCCA64860.1700737799251581RNA PCR Primer, Index 1 (100% over 28bp)
CCTGTCTGAGGGTCGCTTGGAATTCTCGGGTGCCAAGGAACTCCAGTCAC64350.1687364745325921RNA PCR Primer, Index 1 (100% over 33bp)
TTCAAGTAATCCAGGATAGGCTTTGGAATTCTCGGGTGCCAAGGAACTCC64050.1679498243016709RNA PCR Primer, Index 1 (100% over 27bp)
TTCACCGTGGCTAAGTTCTGTGGAATTCTCGGGTGCCAAGGAACTCCAGT62970.1651178834703547RNA PCR Primer, Index 1 (100% over 30bp)
AGCTGGTGTTGTGAATCAGGCCGTGGAATTCTCGGGTGCCAAGGAACTCC62590.1641214598445212RNA PCR Primer, Index 1 (100% over 27bp)
CCTTGGCTTTAGACTGCTTACTTGGAATTCTCGGGTGCCAAGGAACTCCA61430.16107974561829266RNA PCR Primer, Index 1 (100% over 28bp)
TGAGGTAGTAGGTTGTGTGGTTTGGAATTCTCGGGTGCCAAGGAACTCCA61160.1603717604104636RNA PCR Primer, Index 1 (100% over 28bp)
AGCTACATCTGGCTACTGGGTCTTGGAATTCTCGGGTGCCAAGGAACTCC60520.1586935732511651RNA PCR Primer, Index 1 (100% over 27bp)
AGCTACATTGTCTGCTGGGTTTTGGAATTCTCGGGTGCCAAGGAACTCCA58530.1534754600527213RNA PCR Primer, Index 1 (100% over 28bp)
ACCATCGACCGTTGACTGTGCCTTGGAATTCTCGGGTGCCAAGGAACTCC57260.15014530740848833RNA PCR Primer, Index 1 (100% over 27bp)
TACCCTGTAGAACCGAATTTGCTGGAATTCTCGGGTGCCAAGGAACTCCA56910.14922754880574696RNA PCR Primer, Index 1 (100% over 28bp)
AGCCTGTGATGATACAAGTTATCCCTGTCTGAACTCTGGTGTGGAATTCT54910.1439832139329391No Hit
TGAGGTAGTAGTTTGTGCTGTTTTGGAATTCTCGGGTGCCAAGGAACTCC54810.1437209971892987RNA PCR Primer, Index 1 (100% over 27bp)
AGCTACATTGTCTGCTGGGTTTCTGGAATTCTCGGGTGCCAAGGAACTCC54700.1434325587712943RNA PCR Primer, Index 1 (100% over 27bp)
AACATTCAACGCTGTCGGTGTTGGAATTCTCGGGTGCCAAGGAACTCCAG53720.14086283468361846RNA PCR Primer, Index 1 (100% over 29bp)
TCCCTGAGACCCTTAACCTGTGGAATTCTCGGGTGCCAAGGAACTCCAGT52560.13782112045738992RNA PCR Primer, Index 1 (100% over 30bp)
TAAGGCACGCGGTGAATGCCTGGAATTCTCGGGTGCCAAGGAACTCCAGT52110.13664114511100814RNA PCR Primer, Index 1 (100% over 30bp)
AGCTACATCTGGCTACTGGGTCTCTGGAATTCTCGGGTGCCAAGGACCTC51720.13561849981081062RNA PCR Primer, Index 1 (96% over 26bp)
AGAATAATGCCAGCAGTCGGTCTGGAATTCTCGGGTGCCAAGGAACTCCA50530.13249812056148996RNA PCR Primer, Index 1 (100% over 28bp)
TGAGGTAGTTGGTTGTATTGTTTGGAATTCTCGGGTGCCAAGGAACTCCA50320.13194746539984512RNA PCR Primer, Index 1 (100% over 28bp)
TATGGCTTTTTATTCCTATCTGATGGAATTCTCGGGTGCCAAGGAACTCC50150.13150169693565647RNA PCR Primer, Index 1 (100% over 27bp)
CAGGCTGGTTAGATGGTTGTCTTGGAATTCTCGGGTGCCAAGGAACTCCA49180.12895819452234467RNA PCR Primer, Index 1 (100% over 28bp)
TTCAAGTAATCCAGGATAGGTTTGGAATTCTCGGGTGCCAAGGAACTCCA48640.12754222410668656RNA PCR Primer, Index 1 (100% over 28bp)
TGAGGTAGTAGTTTGTGCTGGAATTCTCGGGTGCCAAGGAACTCCAGTCA48450.1270440122937698RNA PCR Primer, Index 1 (100% over 32bp)
TCCCTGAGACCCTTAACCTGTGGTGGAATTCTCGGGTGCCAAGGAACTCC48060.12602136699357228RNA PCR Primer, Index 1 (100% over 27bp)
TTGCATAGTCACAAAAGTGCTCTGGAATTCTCGGGTGCCAAGGAACTCCA47900.12560182020374766RNA PCR Primer, Index 1 (100% over 28bp)
TGAGGTAGTAGTTTGTATAGTTGGAATTCTCGGGTGCCAAGGAACTCCAG47730.125156051739559RNA PCR Primer, Index 1 (100% over 29bp)
TCTTTGGTTATCTAGCTGTATGTTGGAATTCTCGGGTGCCAAGGAACTCC45790.12006904691293539RNA PCR Primer, Index 1 (100% over 27bp)
CATTGCACTTGTCTCGGTCTGATGGAATTCTCGGGTGCCAAGGAACTCCA45120.11831219473054477RNA PCR Primer, Index 1 (100% over 28bp)
ATTGATCATCGACACTTCGAACGCACCTTGCGGCCCCGGGTTTGGAATTC44290.1161357957583295No Hit
AGAATCATGCCAGCAGTCGGTCTGGAATTCTCGGGTGCCAAGGAACTCCA44040.11548025389922854RNA PCR Primer, Index 1 (100% over 28bp)
TGAGGTAGTAGGTTGTGTGGTTTTGGAATTCTCGGGTGCCAAGGAACTCC43370.11372340171683791RNA PCR Primer, Index 1 (100% over 27bp)
GTTTCCGTAGTGTAGTGGTTATCACGTTCGCCTTGGAATTCTCGGGTGCC42630.111782997813899No Hit
TATTGCACTCGTCCCGGCCTCTGGAATTCTCGGGTGCCAAGGAACTCCAG42600.11170433279080688RNA PCR Primer, Index 1 (100% over 29bp)
TAGCTTATCAGACTGGTGTTGGTGGAATTCTCGGGTGCCAAGGAACTCCA41480.1087675052620345RNA PCR Primer, Index 1 (100% over 28bp)
TCCTCCCGGGGCTACGCCTGTCTGAGGGTCGCTTGGAATTCTCGGGTGCC41260.10819062842602564No Hit
ATTGATCATCGACACTTCGAACGCACCTTGCGGCCCCGGGTTGGAATTCT41250.10816440675166161No Hit
TGAGGTAGTTGGTTGTATAGTTGGAATTCTCGGGTGCCAAGGAACTCCAG41040.10761375159001679RNA PCR Primer, Index 1 (100% over 29bp)
TCTTTGGTTATCTAGCTGTCTGATGGAATTCTCGGGTGCCAAGGAACTCC40580.10640755456927098RNA PCR Primer, Index 1 (100% over 27bp)
TCCCTGAGACCCTAACTTGTGCTGGAATTCTCGGGTGCCAAGGAACTCCA39040.10236941671720895RNA PCR Primer, Index 1 (100% over 28bp)
GTACAGTACTGTGATAACTGATGGAATTCTCGGGTGCCAAGGAACTCCAG38820.10179253988120009RNA PCR Primer, Index 1 (100% over 29bp)
CATTATTACTTTTGGTACGCGTGGAATTCTCGGGTGCCAAGGAACTCCAG38740.10158276648628776RNA PCR Primer, Index 1 (100% over 29bp)
TAACAGTCTACAGCCATGGTCGTGGAATTCTCGGGTGCCAAGGAACTCCA38470.10087478127845872RNA PCR Primer, Index 1 (100% over 28bp)
CTTTGGTTATCTAGCTGTATGATGGAATTCTCGGGTGCCAAGGAACTCCA38350.10056012118609024RNA PCR Primer, Index 1 (100% over 28bp)
AGCAGCATTGTACAGGGCTATGATGGAATTCTCGGGTGCCAAGGAACTCC38200.10016679607062966RNA PCR Primer, Index 1 (100% over 27bp)

[FAIL]Adapter Content

Adapter graph

[FAIL]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
CCCTGCG16200.044.090461
AACCCGG254.3912245E-544.090461
TCCGAAT254.3912245E-544.090461
CATAGCG254.3912245E-544.090461
ACCACCG207.779693E-444.090461
CATAAAG254.3912245E-544.090461
AGGGGGG207.779693E-444.090461
CTTTCAG1350.044.090461
AGAGGTA207.779693E-444.090461
AGTAGAG3550.044.090461
AGGGCGA302.4937726E-644.090461
TATTGCG351.4240868E-744.0904581
ATTGCCC2850.044.0904581
GGAGGTA351.4240868E-744.0904581
AACATTC756400.044.043831
TGCTTCC2200.043.99970215
ATCAGGT302.5293866E-643.99970215
TCCTATA302.5293866E-643.99970214
TACGCAA302.5293866E-643.99970211
CTACGCA302.5293866E-643.99970210