FastQCFastQC Report
Mon 5 Dec 2016
JM62_5_TAATCG_L002_R1_001.fastq

Summary

[OK]Basic Statistics

MeasureValue
FilenameJM62_5_TAATCG_L002_R1_001.fastq
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences9725265
Sequences flagged as poor quality0
Sequence length50
%GC50

[OK]Per base sequence quality

Per base quality graph

[FAIL]Per tile sequence quality

Per base quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[FAIL]Per base sequence content

Per base sequence content

[FAIL]Per sequence GC content

Per sequence GC content graph

[WARN]Per base N content

N content graph

[OK]Sequence Length Distribution

Sequence length distribution

[FAIL]Sequence Duplication Levels

Duplication level graph

[FAIL]Overrepresented sequences

SequenceCountPercentagePossible Source
TTCAAGTAATCCAGGATAGGCTTGGAATTCTCGGGTGCCAAGGAACTCCA4754524.888833363409635RNA PCR Primer, Index 1 (100% over 28bp)
TACCCTGTAGAACCGAATTTGTTGGAATTCTCGGGTGCCAAGGAACTCCA4691874.824413524978496RNA PCR Primer, Index 1 (100% over 28bp)
AACATTCAACGCTGTCGGTGAGTGGAATTCTCGGGTGCCAAGGAACTCCA4628664.7594178667625RNA PCR Primer, Index 1 (100% over 28bp)
TTCCCTTTGTCATCCTATGCCTTGGAATTCTCGGGTGCCAAGGAACTCCA3344423.438898580141518RNA PCR Primer, Index 1 (100% over 28bp)
AACATTCAACGCTGTCGGTGAGTTGGAATTCTCGGGTGCCAAGGAACTCC2839932.9201569314563662RNA PCR Primer, Index 1 (100% over 27bp)
TAGCTTATCAGACTGGTGTTGGCTGGAATTCTCGGGTGCCAAGGAACTCC2777532.8559941554291837RNA PCR Primer, Index 1 (100% over 27bp)
TACCCTGTAGAACCGAATTTGCTGGAATTCTCGGGTGCCAAGGAACTCCA2729732.8068438237929763RNA PCR Primer, Index 1 (100% over 28bp)
TACCCTGTAGAACCGAATTTGCGTGGAATTCTCGGGTGCCAAGGAACTCC1887831.9411604722339184RNA PCR Primer, Index 1 (100% over 27bp)
TCCTTCATTCCACCGGAGTCTGTGGAATTCTCGGGTGCCAAGGAACTCCA1517601.5604716169687922RNA PCR Primer, Index 1 (100% over 28bp)
AACAGTAAGAGTTTATGTGCTGTGGAATTCTCGGGTGCCAAGGAACTCCA1419831.4599396520300476RNA PCR Primer, Index 1 (100% over 28bp)
AAGCTGCCAGCTGAAGAACTGTTGGAATTCTCGGGTGCCAAGGAACTCCA1293471.3300100305750022RNA PCR Primer, Index 1 (100% over 28bp)
TTCACAGTGGTTAAGTTCTGTGGAATTCTCGGGTGCCAAGGAACTCCAGT1122981.15470375357381RNA PCR Primer, Index 1 (100% over 30bp)
TAACGGAACCCATAATGCAGCTGTGGAATTCTCGGGTGCCAAGGAACTCC1035791.0650506695704436RNA PCR Primer, Index 1 (100% over 27bp)
TTCACAGTGGCTAAGTTCTGTGGAATTCTCGGGTGCCAAGGAACTCCAGT995091.02320091020656RNA PCR Primer, Index 1 (100% over 30bp)
ACCCTGTAGAACCGAATTTGCGTGGAATTCTCGGGTGCCAAGGAACTCCA857290.8815081131465311RNA PCR Primer, Index 1 (100% over 28bp)
GCATTGGTGGTTCAGTGGTAGAATTCTCGCCTTGGAATTCTCGGGTGCCA811810.8347433206190268No Hit
TATTGCACTTGTCCCGGCCTGTTGGAATTCTCGGGTGCCAAGGAACTCCA794600.8170471447307606RNA PCR Primer, Index 1 (100% over 28bp)
AACATTCAACGCTGTCGGTGATGGAATTCTCGGGTGCCAAGGAACTCCAG744000.7650177141702565RNA PCR Primer, Index 1 (100% over 29bp)
TGAGGTAGTAGGTTGTATAGTTTGGAATTCTCGGGTGCCAAGGAACTCCA735010.7557737501240326RNA PCR Primer, Index 1 (100% over 28bp)
TTCACGTAATCCAGGATAGGCTTGGAATTCTCGGGTGCCAAGGAACTCCA611420.6286923801048094RNA PCR Primer, Index 1 (100% over 28bp)
TTGGTCCCCTTCAACCAGCTGTTGGAATTCTCGGGTGCCAAGGAACTCCA562920.5788222737375279RNA PCR Primer, Index 1 (100% over 28bp)
TTTGGTCCCCTTCAACCAGCTGTTGGAATTCTCGGGTGCCAAGGAACTCC524440.5392552285207652RNA PCR Primer, Index 1 (100% over 27bp)
TCCTTCATTCCACCGGAGTCTGTTGGAATTCTCGGGTGCCAAGGAACTCC490740.5046032164676233RNA PCR Primer, Index 1 (100% over 27bp)
TACCATGTAGAACCGAATTTGTTGGAATTCTCGGGTGCCAAGGAACTCCA390820.4018605148548651RNA PCR Primer, Index 1 (100% over 28bp)
AAGCTGCCAGCTGAAGAACTTGGAATTCTCGGGTGCCAAGGAACTCCAGT373280.38382501659337814RNA PCR Primer, Index 1 (100% over 30bp)
TACCCTGTAGAACCGAATGTGTTGGAATTCTCGGGTGCCAAGGAACTCCA355060.36509030859313346RNA PCR Primer, Index 1 (100% over 28bp)
ACCCTGTAGAACCGAATTTGCTGGAATTCTCGGGTGCCAAGGAACTCCAG345590.3553527847313158RNA PCR Primer, Index 1 (100% over 29bp)
TTCAAGTAATCCAGGATAGGCTGGAATTCTCGGGTGCCAAGGAACTCCAG333620.34304463682994757RNA PCR Primer, Index 1 (100% over 29bp)
TTCACAGTGGCTAAGTTCTGCTGGAATTCTCGGGTGCCAAGGAACTCCAG326610.3358366070230477RNA PCR Primer, Index 1 (100% over 29bp)
TCCCTGGTGGTCTAGTGGTTAGGATTCGTGGAATTCTCGGGTGCCAAGGA300770.30926663695025275RNA PCR Primer, Index 1 (100% over 22bp)
TACCCTGTAGAACCGAATTTGTGGAATTCTCGGGTGCCAAGGAACTCCAG300150.30862912218844424RNA PCR Primer, Index 1 (100% over 29bp)
TCCCTGGTGGTCTAGTGGTTAGGATTCGGCGCTCTGGAATTCTCGGGTGC298500.30693251032234087No Hit
AAGCTGCCAGCTGAAGAACTGCTGGAATTCTCGGGTGCCAAGGAACTCCA295850.3042076488404172RNA PCR Primer, Index 1 (100% over 28bp)
TCCAGCATCAGTGATTTTGTTTGGAATTCTCGGGTGCCAAGGAACTCCAG284930.29297916303566024RNA PCR Primer, Index 1 (100% over 29bp)
CATTGCACTTGTCTCGGTCTGATGGAATTCTCGGGTGCCAAGGAACTCCA274770.28253214693892664RNA PCR Primer, Index 1 (100% over 28bp)
TTCCATTTGTCATCCTATGCCTTGGAATTCTCGGGTGCCAAGGAACTCCA268190.27576626446682945RNA PCR Primer, Index 1 (100% over 28bp)
TAGCTTATCAGACTGGTGTTGGTGGAATTCTCGGGTGCCAAGGAACTCCA252060.259180598163649RNA PCR Primer, Index 1 (100% over 28bp)
TACCCTGTAGATCCGGATTTGTTGGAATTCTCGGGTGCCAAGGAACTCCA250870.25795698112082294RNA PCR Primer, Index 1 (100% over 28bp)
ACAGTAGTCTGCACATTGGTTTGGAATTCTCGGGTGCCAAGGAACTCCAG240440.24723233762781785RNA PCR Primer, Index 1 (100% over 29bp)
GCATTGGTGGTTCAGTGGTAGAATTCTCGCCTGGAATTCTCGGGTGCCAA239700.24647143291211088No Hit
TTCCAGTGATGACAGCCTATAATCTGACTTGGAATTCTCGGGTGCCAAGG235700.24235843444882993Illumina Small RNA Adapter 2 (100% over 21bp)
TTCAAGTAATCCAGGATAGGTTTGGAATTCTCGGGTGCCAAGGAACTCCA234750.24138159731380068RNA PCR Primer, Index 1 (100% over 28bp)
TTCAAGTAATCCAGGATGGGCTTGGAATTCTCGGGTGCCAAGGAACTCCA229260.2357365069229476RNA PCR Primer, Index 1 (100% over 28bp)
TACCATGTAGAACCGAATTTGCTGGAATTCTCGGGTGCCAAGGAACTCCA222250.22852847711604773RNA PCR Primer, Index 1 (100% over 28bp)
TATTGCACTTGTCCCGGCCTGTTTGGAATTCTCGGGTGCCAAGGAACTCC218760.22493988595683512RNA PCR Primer, Index 1 (100% over 27bp)
TTGTTCCCCTTCAACCAGCTGTTGGAATTCTCGGGTGCCAAGGAACTCCA210550.21649795661095095RNA PCR Primer, Index 1 (100% over 28bp)
ACCCTGTAGAACCGAATTTGTTGGAATTCTCGGGTGCCAAGGAACTCCAG207520.21338236027501567RNA PCR Primer, Index 1 (100% over 29bp)
TGGAATTCTCGGGTGCCAAGGAACTCCAGTCACTAATCGATCTCGTATGC197940.2035317289554578RNA PCR Primer, Index 42 (100% over 50bp)
TTTTGTCCCCTTCAACCAGCTGTTGGAATTCTCGGGTGCCAAGGAACTCC197560.2031409941014461RNA PCR Primer, Index 1 (100% over 27bp)
TTAGGTAGTAGGTTGTATAGTTTGGAATTCTCGGGTGCCAAGGAACTCCA195880.20141353474686807RNA PCR Primer, Index 1 (100% over 28bp)
TCCAGTGATGACAGCCTATAATCTGACTTGGAATTCTCGGGTGCCAAGGA194650.2001487877194092RNA PCR Primer, Index 1 (100% over 22bp)
ACCCTGTAGAACCGAATTTGTGTGGAATTCTCGGGTGCCAAGGAACTCCA191580.19699206139884104RNA PCR Primer, Index 1 (100% over 28bp)
GCCCGGCTAGCTCAGTCGGTAGAGCATGAGACTCTGGAATTCTCGGGTGC191130.19652934907172193No Hit
AGCCTGTGATGATACAAGTTATCCCTGTCTGAACTCTGGTGTGGAATTCT186710.19198448576979651No Hit
AACATTCATTGCTGTCGGTGGGTGGAATTCTCGGGTGCCAAGGAACTCCA185200.19043182884990795RNA PCR Primer, Index 1 (100% over 28bp)
TTATGTAGTAGGTTGTATAGTTTGGAATTCTCGGGTGCCAAGGAACTCCA182230.18737792749092183RNA PCR Primer, Index 1 (100% over 28bp)
CATTATTACTTTTGGTACGCGTGGAATTCTCGGGTGCCAAGGAACTCCAG180040.1851260608322755RNA PCR Primer, Index 1 (100% over 29bp)
TCCTTCATTCCACCGGAGTCTTGGAATTCTCGGGTGCCAAGGAACTCCAG177820.1828433466851546RNA PCR Primer, Index 1 (100% over 29bp)
TCCCATATGGTCTAGCGGTTAGGATTCCTTGGAATTCTCGGGTGCCAAGG177250.18225724440413707Illumina Small RNA Adapter 2 (100% over 21bp)
TGATGTAGTAGGTTGTATAGTTTGGAATTCTCGGGTGCCAAGGAACTCCA165980.17066887123384297RNA PCR Primer, Index 1 (100% over 28bp)
TTCAAGTAATCCAGGATAGGCTTTGGAATTCTCGGGTGCCAAGGAACTCC163730.16835530959824746RNA PCR Primer, Index 1 (100% over 27bp)
TGAGGTAGTAGGTTGTATAGTTGGAATTCTCGGGTGCCAAGGAACTCCAG163320.16793372725576117RNA PCR Primer, Index 1 (100% over 29bp)
CCTGTCTGAGGGTCGCTTGGAATTCTCGGGTGCCAAGGAACTCCAGTCAC162020.16659700275519485RNA PCR Primer, Index 1 (100% over 33bp)
TACCATGTAGAACCGAATTTGCGTGGAATTCTCGGGTGCCAAGGAACTCC160290.16481813091982583RNA PCR Primer, Index 1 (100% over 27bp)
TTTGGTCCCCTTCAACCAGCTGTGGAATTCTCGGGTGCCAAGGAACTCCA154380.15874117569032825RNA PCR Primer, Index 1 (100% over 28bp)
AACATTCAACGCTGTCGGTGAGATGGAATTCTCGGGTGCCAAGGAACTCC151520.15580038178908234RNA PCR Primer, Index 1 (100% over 27bp)
GCATTGGTGGTTCAGTGGTAGAATTCTCGCTGGAATTCTCGGGTGCCAAG148650.15284930539167826No Hit
TTCCCTTTGTCATCCTATGCCTGTGGAATTCTCGGGTGCCAAGGAACTCC146180.15030952884060228RNA PCR Primer, Index 1 (100% over 27bp)
TCCCTGTGGTCTAGTGGTTAGGATTCGGCGCTCTGGAATTCTCGGGTGCC142910.1469471525968701No Hit
TCCCATATGGTCTAGCGGTTAGGATTCCTGTGGAATTCTCGGGTGCCAAG139460.1433996914222903No Hit
TACCCTGTAGAACCGAATTTGTGTGGAATTCTCGGGTGCCAAGGAACTCC136240.14008872765934913RNA PCR Primer, Index 1 (100% over 27bp)
TGAGAACTGAATTCCATAGATGGTGGAATTCTCGGGTGCCAAGGAACTCC134990.13880341563957385RNA PCR Primer, Index 1 (100% over 27bp)
GTTTCCGTAGTGTAGTGGTTATCACGTTCGCCTTGGAATTCTCGGGTGCC134790.1385977657164098No Hit
TCCAGCATCAGTGATTTTGTTGTGGAATTCTCGGGTGCCAAGGAACTCCA132870.13662352645403492RNA PCR Primer, Index 1 (100% over 28bp)
TGGACGGAGAACTGATAAGGGCTGGAATTCTCGGGTGCCAAGGAACTCCA131090.13479324213787489RNA PCR Primer, Index 1 (100% over 28bp)
TTCACAGTGGCTAAGTTCAGTTGGAATTCTCGGGTGCCAAGGAACTCCAG130950.13464928719166006RNA PCR Primer, Index 1 (100% over 29bp)
TCCCTGGTGGTCTAGTGGTTAGGATTCGGCGCTTGGAATTCTCGGGTGCC129830.1334976476219414No Hit
AACATTCATTGCTGTCGGTGGGTTGGAATTCTCGGGTGCCAAGGAACTCC128390.13201696817516026RNA PCR Primer, Index 1 (100% over 27bp)
TGAGGTAGTAGTTTGTATAGTTTGGAATTCTCGGGTGCCAAGGAACTCCA127910.13152340835956655RNA PCR Primer, Index 1 (100% over 28bp)
TTCACAGTGGCTAAGTTCTGCTTGGAATTCTCGGGTGCCAAGGAACTCCA127730.1313383234287189RNA PCR Primer, Index 1 (100% over 28bp)
TCCCTGTGGTCTAGTGGTTAGGATTCGTGGAATTCTCGGGTGCCAAGGAA124650.12817131461199258RNA PCR Primer, Index 1 (100% over 23bp)
GCATTGTGGTTCAGTGGTAGAATTCTCGCCTTGGAATTCTCGGGTGCCAA119200.12256735420577228No Hit
TTCACAGTGGTTAAGTTCTGCCTGGAATTCTCGGGTGCCAAGGAACTCCA118770.12212520687096959RNA PCR Primer, Index 1 (100% over 28bp)
GCCTGTGATGATACAAGTTATCCCTGTCTGAACTCTGGTGTGGAATTCTC118010.12134373716294619No Hit
AACATTCAACGCTGTCGGTGGTGGAATTCTCGGGTGCCAAGGAACTCCAG117570.1208913073319853RNA PCR Primer, Index 1 (100% over 29bp)
ACCCTGTAGAACCGAATTTGTGTTGGAATTCTCGGGTGCCAAGGAACTCC116100.11937978039672954RNA PCR Primer, Index 1 (100% over 27bp)
GCATTGGTGGTTCAGTGGTAGAATTCTCGCCTGCTGGAATTCTCGGGTGC111300.1144441822407924No Hit
TGAGATGAAGCACTGTAGCTTGGAATTCTCGGGTGCCAAGGAACTCCAGT110400.1135187575865542RNA PCR Primer, Index 1 (100% over 30bp)
AACATTCAACGCTGTCGGTGTTGGAATTCTCGGGTGCCAAGGAACTCCAG110120.11323084769412452RNA PCR Primer, Index 1 (100% over 29bp)
CAGGGCGCAAGGGGTCTGCGGCGATGTCGGCTGGAATTCTCGGGTGCCAA105260.10823355456123816No Hit
CATTGATCATCGACACTTCGAACGCACCTTGCGGCCCCGGGTTGGAATTC104280.10722586993773434No Hit
CATTGATCATCGACACTTCGAACGCACCTTGCGGCCCCGGGTTTGGAATT101660.10453185594428534No Hit
TTCACAGTGGTTAAGTTCTGCCTTGGAATTCTCGGGTGCCAAGGAACTCC101470.10433648851727949RNA PCR Primer, Index 1 (100% over 27bp)
TGAGGTAGTAGGTTGTATAGTTTTGGAATTCTCGGGTGCCAAGGAACTCC100590.10343162885535766RNA PCR Primer, Index 1 (100% over 27bp)
AACACTCAACGCTGTCGGTGAGTGGAATTCTCGGGTGCCAAGGAACTCCA98900.10169388700462148RNA PCR Primer, Index 1 (100% over 28bp)
TTCACAGTGGTTAAGTTCTGCTGGAATTCTCGGGTGCCAAGGAACTCCAG97870.10063478990032662RNA PCR Primer, Index 1 (100% over 29bp)

[WARN]Adapter Content

Adapter graph

[FAIL]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
GTTCGCC37400.045.6833726
ACGTTCG38000.045.56468624
TTCGCCT37650.045.2583627
TAACTAT11800.043.81946623
TTCACGA551.8189894E-1243.715351
TTGTACG351.5233309E-743.715351
TAGCCGC2550.043.715351
GCTTCCG455.12955E-1043.7153471
CACCCCG900.043.7153471
GATGTCG29700.043.6798323
AACATTC1068150.043.6785161
AACAGTA158500.043.673981
TCCTTCA253550.043.646391
TACCCTG1208000.043.639361
GGTCTCC208.186965E-443.6366213
TTCAAGT664900.043.6265951
CTTCGCA351.547869E-743.6265215
CGCGATA551.8189894E-1243.6265218
ACGATAT208.196304E-443.6265216
CATACGC208.196304E-443.6265215