FastQCFastQC Report
Mon 5 Dec 2016
JM66_1_ATGTCA_L001_R1_001.fastq

Summary

[OK]Basic Statistics

MeasureValue
FilenameJM66_1_ATGTCA_L001_R1_001.fastq
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences2266482
Sequences flagged as poor quality0
Sequence length50
%GC51

[OK]Per base sequence quality

Per base quality graph

[FAIL]Per tile sequence quality

Per base quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[FAIL]Per base sequence content

Per base sequence content

[FAIL]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[OK]Sequence Length Distribution

Sequence length distribution

[FAIL]Sequence Duplication Levels

Duplication level graph

[FAIL]Overrepresented sequences

SequenceCountPercentagePossible Source
AACATTCAACGCTGTCGGTGAGTGGAATTCTCGGGTGCCAAGGAACTCCA1490736.577285855347627RNA PCR Primer, Index 1 (100% over 28bp)
TTCAAGTAATCCAGGATAGGCTTGGAATTCTCGGGTGCCAAGGAACTCCA1265355.582881311212708RNA PCR Primer, Index 1 (100% over 28bp)
AACATTCAACGCTGTCGGTGAGTTGGAATTCTCGGGTGCCAAGGAACTCC844693.726877160286294RNA PCR Primer, Index 1 (100% over 27bp)
TGAGGTAGTAGGTTGTATAGTTTGGAATTCTCGGGTGCCAAGGAACTCCA631952.7882418655872843RNA PCR Primer, Index 1 (100% over 28bp)
TCACAGTGAACCGGTCTCTTTTGGAATTCTCGGGTGCCAAGGAACTCCAG388811.7154779962955804RNA PCR Primer, Index 1 (100% over 29bp)
TCCCTGAGACCCTTAACCTGTTGGAATTCTCGGGTGCCAAGGAACTCCAG347991.535375087911574RNA PCR Primer, Index 1 (100% over 29bp)
TGGAATTCTCGGGTGCCAAGGAACTCCAGTCACATGTCAATCTCGTATGC302081.3328144675316196RNA PCR Primer, Index 15 (100% over 50bp)
AACATTCAACGCTGTCGGTGATGGAATTCTCGGGTGCCAAGGAACTCCAG274611.2116134167401287RNA PCR Primer, Index 1 (100% over 29bp)
TAAAGCTAGAGAACCGAAAGTATGGAATTCTCGGGTGCCAAGGAACTCCA258291.1396075503798397RNA PCR Primer, Index 1 (100% over 28bp)
AACCCGTAGATCCGAACTTGTGTGGAATTCTCGGGTGCCAAGGAACTCCA233451.0300103861402825RNA PCR Primer, Index 1 (100% over 28bp)
TAAAGCTAGAGAACCGAAAGTTGGAATTCTCGGGTGCCAAGGAACTCCAG227911.0055672182704296RNA PCR Primer, Index 1 (100% over 29bp)
TCCCTGAGACCCTTAACCTGTGTGGAATTCTCGGGTGCCAAGGAACTCCA215200.9494891201430233RNA PCR Primer, Index 1 (100% over 28bp)
TTCAAGTAATCAAGGATAGGCTTGGAATTCTCGGGTGCCAAGGAACTCCA191030.8428480790935026RNA PCR Primer, Index 1 (100% over 28bp)
TATTGCACTCGTCCCGGCCTCCTGGAATTCTCGGGTGCCAAGGAACTCCA175600.7747690032393816RNA PCR Primer, Index 1 (100% over 28bp)
TCCAGCATCAGTGATTTTGTTTGGAATTCTCGGGTGCCAAGGAACTCCAG172490.7610472970886157RNA PCR Primer, Index 1 (100% over 29bp)
TGAGGTAGTAGGTTGTATAGTTGGAATTCTCGGGTGCCAAGGAACTCCAG167120.7373541903266825RNA PCR Primer, Index 1 (100% over 29bp)
TGGAATTCTCGGGTGCCAAGGAACTCCAGTCACATGTCAATCTCGTCTGC147170.6493323132502266RNA PCR Primer, Index 15 (98% over 50bp)
TGAGGTAGTAGTTTGTATAGTTTGGAATTCTCGGGTGCCAAGGAACTCCA143330.6323897564595704RNA PCR Primer, Index 1 (100% over 28bp)
AACATTCAACGATGTCGGTGAGTGGAATTCTCGGGTGCCAAGGAACTCCA131950.5821797834705945RNA PCR Primer, Index 1 (100% over 28bp)
TTAAAGGGAATTTGCGACTGTTTGGAATTCTCGGGTGCCAAGGAACTCCA124520.5493977009303405RNA PCR Primer, Index 1 (100% over 28bp)
AACATTCATTGCTGTCGGTGGGTGGAATTCTCGGGTGCCAAGGAACTCCA119760.5283959899085896RNA PCR Primer, Index 1 (100% over 28bp)
TGAGGTAGTAGTTTGTGCTGTTTGGAATTCTCGGGTGCCAAGGAACTCCA112050.4943785126023502RNA PCR Primer, Index 1 (100% over 28bp)
TAAAGCTAGAGAACCGAAAGTCTGGAATTCTCGGGTGCCAAGGAACTCCA101080.4459775105207101RNA PCR Primer, Index 1 (100% over 28bp)
TCTTTGGTTATCTAGCTGTATTGGAATTCTCGGGTGCCAAGGAACTCCAG99280.43803568702509RNA PCR Primer, Index 1 (100% over 29bp)
TCCCTGAGACCCTTAACCTGTGATGGAATTCTCGGGTGCCAAGGAACTCC98290.43366768410249895RNA PCR Primer, Index 1 (100% over 27bp)
ACCTTGGCTTTAGACTGCTTACTTGGAATTCTCGGGTGCCAAGGAACTCC96380.4252405269488132RNA PCR Primer, Index 1 (100% over 27bp)
TTCACAGTGGCTAAGTTCTGCTGGAATTCTCGGGTGCCAAGGAACTCCAG96060.4238286472162585RNA PCR Primer, Index 1 (100% over 29bp)
AACCCGTAGATCCGAACTTGTTGGAATTCTCGGGTGCCAAGGAACTCCAG94970.4190194318772441RNA PCR Primer, Index 1 (100% over 29bp)
TGGAATTCTCGGGTGCCAAGGCACTCCAGTCACATGTCAATCTCGTATGC94500.41694573352005443RNA PCR Primer, Index 15 (98% over 50bp)
TTGCGGCCCCGGGTTCCTCCCGGGGCTACGCCTGTCTGAGGGTCGCTTGG92770.40931275871593065No Hit
TAACAGTCTACAGTCATGGCTTGGAATTCTCGGGTGCCAAGGAACTCCAG91360.40309166364436166RNA PCR Primer, Index 1 (100% over 29bp)
AGCTACATCTGGCTACTGGGTCTCTGGAATTCTCGGGTGCCAAGGAACTC90420.39894426692998225RNA PCR Primer, Index 1 (100% over 26bp)
TCTTTGGTTATCTAGCTGTATGATGGAATTCTCGGGTGCCAAGGAACTCC88110.38875226011060315RNA PCR Primer, Index 1 (100% over 27bp)
TGAGGTAGTTGGTTGTATAGTTTGGAATTCTCGGGTGCCAAGGAACTCCA83020.3662945481146552RNA PCR Primer, Index 1 (100% over 28bp)
TCACAGTGAACCGGTCTCTTTTTGGAATTCTCGGGTGCCAAGGAACTCCA80200.3538523579715171RNA PCR Primer, Index 1 (100% over 28bp)
CCACGTTCCCGTGGTGGAATTCTCGGGTGCCAAGGAACTCCAGTCACATG76950.33951295443775864RNA PCR Primer, Index 15 (100% over 36bp)
AACATTCAACGATGTCGGTGAGTTGGAATTCTCGGGTGCCAAGGAACTCC75980.3352331939984522RNA PCR Primer, Index 1 (100% over 27bp)
AAGCTGCCAGCTGAAGAACTGTTGGAATTCTCGGGTGCCAAGGAACTCCA74570.32901209892688316RNA PCR Primer, Index 1 (100% over 28bp)
TTCAAGTAATCCAGGATAGGCTGGAATTCTCGGGTGCCAAGGAACTCCAG73980.32640894566998546RNA PCR Primer, Index 1 (100% over 29bp)
CCCTGAGACCCTTAACCTGTGATGGAATTCTCGGGTGCCAAGGAACTCCA72950.3218644577808251RNA PCR Primer, Index 1 (100% over 28bp)
TCTTTGGTTATCTAGCTGTCTTGGAATTCTCGGGTGCCAAGGAACTCCAG72620.32040845680662805RNA PCR Primer, Index 1 (100% over 29bp)
AACATTCATTGCTGTCGGTGGGTTGGAATTCTCGGGTGCCAAGGAACTCC71530.3155992414676137RNA PCR Primer, Index 1 (100% over 27bp)
TCTTTGGTTATCTAGCTGTCTGATGGAATTCTCGGGTGCCAAGGAACTCC67860.2994067457848772RNA PCR Primer, Index 1 (100% over 27bp)
TGGAATTCTCGGGTGCCAAGGCACTCCAGTCACATGTCAATCTCGTCTGC66520.29349449940480443RNA PCR Primer, Index 15 (97% over 46bp)
TCCCTGAGACCCTAACTTGTGATGGAATTCTCGGGTGCCAAGGAACTCCA63840.281670006644659RNA PCR Primer, Index 1 (100% over 28bp)
TATTGCACTTGTCCCGGCCTGTTGGAATTCTCGGGTGCCAAGGAACTCCA59920.26437447992086416RNA PCR Primer, Index 1 (100% over 28bp)
TCCAGCATCAGTGATTTTGTTGTGGAATTCTCGGGTGCCAAGGAACTCCA57910.25550611035075504RNA PCR Primer, Index 1 (100% over 28bp)
TAGCTTATCAGACTGGTGTTGGCTGGAATTCTCGGGTGCCAAGGAACTCC57230.2525058659190763RNA PCR Primer, Index 1 (100% over 27bp)
TAAAGGGAATTTGCGACTGTTTGGAATTCTCGGGTGCCAAGGAACTCCAG55870.24650537705571898RNA PCR Primer, Index 1 (100% over 29bp)
TCACAGTGAACCGGTCTCTTTGGAATTCTCGGGTGCCAAGGAACTCCAGT55750.24597592215601094RNA PCR Primer, Index 1 (100% over 30bp)
TGGAATTCTCGGGTGCCAAGGAACTCCATTCACATGTCAATCTCGTATGC54090.23865179604338352RNA PCR Primer, Index 15 (98% over 50bp)
TTGCATAGTCACAAAAGTGATCTGGAATTCTCGGGTGCCAAGGAACTCCA52570.2319453673137488RNA PCR Primer, Index 1 (100% over 28bp)
TGAGGTAGTAGGTTGTATAGTTTTGGAATTCTCGGGTGCCAAGGAACTCC52370.23106294248090212RNA PCR Primer, Index 1 (100% over 27bp)
TAAAGCTAGAGAACCGAAAGTAATGGAATTCTCGGGTGCCAAGGAACTCC51710.2281509405325081RNA PCR Primer, Index 1 (100% over 27bp)
TCACAGTGAACAGGTCTCTTTTGGAATTCTCGGGTGCCAAGGAACTCCAG51410.22682730328323808RNA PCR Primer, Index 1 (100% over 29bp)
TTCACAGTGGCTAAGTTCTGTGGAATTCTCGGGTGCCAAGGAACTCCAGT51370.22665081831666875RNA PCR Primer, Index 1 (100% over 30bp)
TTCCCTTTGTCATCCTATGCCTTGGAATTCTCGGGTGCCAAGGAACTCCA50590.2232093614685667RNA PCR Primer, Index 1 (100% over 28bp)
AACATTCAACGCTGTCGGTGGTGGAATTCTCGGGTGCCAAGGAACTCCAG50400.22237105787736236RNA PCR Primer, Index 1 (100% over 29bp)
TACCCTGTAGAACCGAATTTGTTGGAATTCTCGGGTGCCAAGGAACTCCA49070.21650293273893198RNA PCR Primer, Index 1 (100% over 28bp)
TCCCTGAGACCCTAACTTGTTGGAATTCTCGGGTGCCAAGGAACTCCAGT48900.21575287163101228RNA PCR Primer, Index 1 (100% over 30bp)
AACCCGTAGATCCGAACTTGTGATGGAATTCTCGGGTGCCAAGGAACTCC47890.21129662622513656RNA PCR Primer, Index 1 (100% over 27bp)
AGCTACATCTGGCTACTGGGTCTTGGAATTCTCGGGTGCCAAGGAACTCC46790.2064432896444799RNA PCR Primer, Index 1 (100% over 27bp)
TGAGATGAAGCACTGTAGCTCTTGGAATTCTCGGGTGCCAAGGAACTCCA45890.2024723778966698RNA PCR Primer, Index 1 (100% over 28bp)
AAGCTGCCAGCTGAAGAACTTGGAATTCTCGGGTGCCAAGGAACTCCAGT44730.1973543138661591RNA PCR Primer, Index 1 (100% over 30bp)
TGGAATTCTCGGGTGCCAAGGAACTCCATTCACATGTCAATCTCGTCTGC44430.19603067661688905RNA PCR Primer, Index 15 (97% over 46bp)
AGCTACATTGTCTGCTGGGTTTTGGAATTCTCGGGTGCCAAGGAACTCCA44100.19457467564269207RNA PCR Primer, Index 1 (100% over 28bp)
TCCCTGAGACCCTAACTTGTGTGGAATTCTCGGGTGCCAAGGAACTCCAG42680.18830945932948065RNA PCR Primer, Index 1 (100% over 29bp)
TCTTTGGTTATCTAGCTGTATGTGGAATTCTCGGGTGCCAAGGAACTCCA42520.18760351946320333RNA PCR Primer, Index 1 (100% over 28bp)
AGAATAATGCCAGCAGTCGGTCTGGAATTCTCGGGTGCCAAGGAACTCCA41680.18389733516524728RNA PCR Primer, Index 1 (100% over 28bp)
AGCTACATCTGGCTACTGGGTCTCTGGAATTCTCGGGTGCCAAGGACCTC41660.1838090926819626RNA PCR Primer, Index 1 (96% over 26bp)
ACCATCGACCGTTGACTGTGCCTGGAATTCTCGGGTGCCAAGGAACTCCA41590.1835002439904663RNA PCR Primer, Index 1 (100% over 28bp)
TCCCTGAGACCATTAACCTGTTGGAATTCTCGGGTGCCAAGGAACTCCAG41430.18279430412418896RNA PCR Primer, Index 1 (100% over 29bp)
TGAGGTAGTTGGTTGTATTGTTTGGAATTCTCGGGTGCCAAGGAACTCCA39850.1758231479447002RNA PCR Primer, Index 1 (100% over 28bp)
TAAAGCTAGAGAACCGAAAGTATTGGAATTCTCGGGTGCCAAGGAACTCC39750.17538193552827686RNA PCR Primer, Index 1 (100% over 27bp)
TTGCATAGTCACAAAAGTGCTCTGGAATTCTCGGGTGCCAAGGAACTCCA39640.1748966018702112RNA PCR Primer, Index 1 (100% over 28bp)
TTCCCTTTGTCATCCTATGCCTGTGGAATTCTCGGGTGCCAAGGAACTCC39260.1732199946878025RNA PCR Primer, Index 1 (100% over 27bp)
TTCAAGTAATCCAGGATAGGCTTTGGAATTCTCGGGTGCCAAGGAACTCC38230.16867550679864213RNA PCR Primer, Index 1 (100% over 27bp)
AGCCTGTGATGATACAAGTTATCCCTGTCTGAACTCTGGTGTGGAATTCT36600.16148374441094174No Hit
AGCTACATTGTCTGCTGGGTTTCTGGAATTCTCGGGTGCCAAGGAACTCC35390.15614507417221932RNA PCR Primer, Index 1 (100% over 27bp)
TGAGATGAAGCACTGTAGCTCTGGAATTCTCGGGTGCCAAGGAACTCCAG35050.15464495195637998RNA PCR Primer, Index 1 (100% over 29bp)
AGCTGGTGTTGTGAATCAGGCCGTGGAATTCTCGGGTGCCAAGGAACTCC34930.15411549705667196RNA PCR Primer, Index 1 (100% over 27bp)
TCCCTGAGACCCTTAACCTGTGTTGGAATTCTCGGGTGCCAAGGAACTCC33810.14917391799273058RNA PCR Primer, Index 1 (100% over 27bp)
TACCCTGTAGATCCGGATTTGTTGGAATTCTCGGGTGCCAAGGAACTCCA33710.14873270557630724RNA PCR Primer, Index 1 (100% over 28bp)
ACCGTGGCTTTAGATTGTTACTTGGAATTCTCGGGTGCCAAGGAACTCCA31900.1407467608390448RNA PCR Primer, Index 1 (100% over 28bp)
TGAGGTAGTAGGTTGTGTGGTTTGGAATTCTCGGGTGCCAAGGAACTCCA31670.13973197228127116RNA PCR Primer, Index 1 (100% over 28bp)
TGAGATGAAGCACTGTAGCTTGGAATTCTCGGGTGCCAAGGAACTCCAGT31540.13915839613992081RNA PCR Primer, Index 1 (100% over 30bp)
TCTTTGGTTATCTAGCTGTCTGTGGAATTCTCGGGTGCCAAGGAACTCCA31530.1391142748982785RNA PCR Primer, Index 1 (100% over 28bp)
TCCTCCCGGGGCTACGCCTGTCTGAGGGTCGCTTGGAATTCTCGGGTGCC31330.1382318500654318No Hit
TAACGGAACCCATAATGCAGCTGTGGAATTCTCGGGTGCCAAGGAACTCC30870.13620227294988443RNA PCR Primer, Index 1 (100% over 27bp)
AACATTCAACGCTGTCGGTGAGATGGAATTCTCGGGTGCCAAGGAACTCC30370.13399621086776775RNA PCR Primer, Index 1 (100% over 27bp)
TGGAATTCTCGGGTGCCAAGGCACTCCATTCACATGTCAATCTCGTCTGC29900.13192251251057807RNA PCR Primer, Index 1 (96% over 28bp)
CCCTGAGACCCTTAACCTGTGCTGGAATTCTCGGGTGCCAAGGAACTCCA29790.1314371788525124RNA PCR Primer, Index 1 (100% over 28bp)
AAGCTGCCAGTTGAAGAGCTGTTGGAATTCTCGGGTGCCAAGGAACTCCA29730.1311724514026584RNA PCR Primer, Index 1 (100% over 28bp)
TTCACCGTGGCTAAGTTCTGCTGGAATTCTCGGGTGCCAAGGAACTCCAG29220.12892226807889937RNA PCR Primer, Index 1 (100% over 29bp)
GGAATTCTCGGGTGCCAAGGAACTCCAGTCACATGTCAATCTCGTATGCC28660.12645147854692868RNA PCR Primer, Index 15 (100% over 50bp)
AACCCGTAGATACGAACTTGTGTGGAATTCTCGGGTGCCAAGGAACTCCA28060.12380420404838864RNA PCR Primer, Index 1 (100% over 28bp)
TTCAAGTAATCCAGGATAGGTTTGGAATTCTCGGGTGCCAAGGAACTCCA27930.12323062790703831RNA PCR Primer, Index 1 (100% over 28bp)
TGGAATTCTCGGGTGCCAAGGCACTCCATTCACATGTCAATCTCGTATGC27720.1223040818325493RNA PCR Primer, Index 1 (96% over 28bp)
AACATTCAACGCTGTCGGTGTTGGAATTCTCGGGTGCCAAGGAACTCCAG27550.12155402072462963RNA PCR Primer, Index 1 (100% over 29bp)
TCGCTGCGATCCATTGAAAGTCAGCCCTCGATCCAAGTTTTTGTTGGAAT27020.11921559491758593No Hit
GTACAGTACTGTGATAACTGATGGAATTCTCGGGTGCCAAGGAACTCCAG26700.11780371518503126RNA PCR Primer, Index 1 (100% over 29bp)
TCCCTGAGACCCTAACTTGTGCTGGAATTCTCGGGTGCCAAGGAACTCCA26230.11573001682784158RNA PCR Primer, Index 1 (100% over 28bp)
TCTTTGGTTATCTAGCTGTATGTTGGAATTCTCGGGTGCCAAGGAACTCC26150.11537704689470289RNA PCR Primer, Index 1 (100% over 27bp)
AACATTCAACGATGTCGGTGATGGAATTCTCGGGTGCCAAGGAACTCCAG26130.11528880441141823RNA PCR Primer, Index 1 (100% over 29bp)
TGAGGTAGTTGGTTGTATAGTTGGAATTCTCGGGTGCCAAGGAACTCCAG26080.11506819820320657RNA PCR Primer, Index 1 (100% over 29bp)
CTTTGGTTATCTAGCTGTATGATGGAATTCTCGGGTGCCAAGGAACTCCA25690.11334746977915554RNA PCR Primer, Index 1 (100% over 28bp)
TCCCTGAGACCATTAACCTGTGTGGAATTCTCGGGTGCCAAGGAACTCCA25610.11299449984601687RNA PCR Primer, Index 1 (100% over 28bp)
TGAGGTAGTAGATTGAATAGTTTGGAATTCTCGGGTGCCAAGGAACTCCA25340.11180322632167385RNA PCR Primer, Index 1 (100% over 28bp)
CCACGTTCCCGTGGTGGAATTCTCGGGTGCCAAGGAACTCCAGTCACCTG24380.10756758712400982RNA PCR Primer, Index 7 (97% over 36bp)
ACCATCGACCGTTGACTGTGCCTTGGAATTCTCGGGTGCCAAGGAACTCC24290.10717049594922881RNA PCR Primer, Index 1 (100% over 27bp)
TAACAGTCTACAGCCATGGTCGTGGAATTCTCGGGTGCCAAGGAACTCCA23960.1057144949750318RNA PCR Primer, Index 1 (100% over 28bp)
TGAGGTAGTAGTTTGTATAGTTGGAATTCTCGGGTGCCAAGGAACTCCAG23690.10452322145068878RNA PCR Primer, Index 1 (100% over 29bp)
ACCGTGGCTTTAGATTGTTCCTTGGAATTCTCGGGTGCCAAGGAACTCCA23400.1032437054430611RNA PCR Primer, Index 1 (100% over 28bp)
CCTGTCTGAGGGTCGCTTGGAATTCTCGGGTGCCAAGGAACTCCAGTCAC23260.10262600806006843RNA PCR Primer, Index 1 (100% over 33bp)
CCTTGGCTTTAGACTGCTTACTTGGAATTCTCGGGTGCCAAGGAACTCCA23170.10222891688528742RNA PCR Primer, Index 1 (100% over 28bp)
TCCCTGAGACCCTTAACCTGTGGTGGAATTCTCGGGTGCCAAGGAACTCC22920.10112588584422907RNA PCR Primer, Index 1 (100% over 27bp)
TCCCTGAGACCCTTAACCTGTGGAATTCTCGGGTGCCAAGGAACTCCAGT22850.10081703715273274RNA PCR Primer, Index 1 (100% over 30bp)

[FAIL]Adapter Content

Adapter graph

[FAIL]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
AGAGTAT406.9412636E-944.910232
GATATGT207.104243E-444.910232
AACCGTT302.1964006E-644.9102252
GAGCTTA1050.044.9102252
ATGTGCC302.1964006E-644.9102252
GAATCGA253.938144E-544.9102252
GAGGTAA253.938144E-544.9102252
TATACAG302.1964006E-644.9102252
TGAGCGC1000.044.9102252
CCTGCGA4700.044.9102252
CTTACGG302.1964006E-644.9102252
GTGCATC207.105827E-444.9081955
ACGCAAC207.105827E-444.9081957
TAGCGTC800.044.9081953
CTCCCTA207.105827E-444.9081953
TCCCTAC207.105827E-444.9081954
GCCGGGA207.105827E-444.9081955
GTAATAG207.105827E-444.9081955
TGCGAGC207.105827E-444.9081955
TCGACGA207.105827E-444.9081956