FastQCFastQC Report
Mon 5 Dec 2016
JM72_3_GTCCGC_L007_R1_001.fastq

Summary

[OK]Basic Statistics

MeasureValue
FilenameJM72_3_GTCCGC_L007_R1_001.fastq
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences12510422
Sequences flagged as poor quality0
Sequence length50
%GC54

[OK]Per base sequence quality

Per base quality graph

[OK]Per tile sequence quality

Per base quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[FAIL]Per base sequence content

Per base sequence content

[FAIL]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[OK]Sequence Length Distribution

Sequence length distribution

[FAIL]Sequence Duplication Levels

Duplication level graph

[FAIL]Overrepresented sequences

SequenceCountPercentagePossible Source
TGGAATTCTCGGGTGCCAAGGAACTCCAGTCACGTCCGCATCTCGTATGC485045738.77133001588596RNA PCR Primer, Index 18 (100% over 50bp)
GCATTGGTGGTTCAGTGGTAGAATTCTCGCCTTGGAATTCTCGGGTGCCA2806302.2431697348019113No Hit
TCCCTGGTGGTCTAGTGGTTAGGATTCGGCGCTCTGGAATTCTCGGGTGC1647281.3167261663915095No Hit
TTCAAGTAATCCAGGATAGGCTTGGAATTCTCGGGTGCCAAGGAACTCCA1455701.1635898453305573RNA PCR Primer, Index 1 (100% over 28bp)
ATGACCTATGAATTGACAGCCTGGAATTCTCGGGTGCCAAGGAACTCCAG1156850.9247090146119772RNA PCR Primer, Index 1 (100% over 29bp)
ATGACCTATGAATTGACAGCCATGGAATTCTCGGGTGCCAAGGAACTCCA1099280.8786913822731159RNA PCR Primer, Index 1 (100% over 28bp)
TGAGGTAGTAGGTTGTATAGTTTGGAATTCTCGGGTGCCAAGGAACTCCA1062660.8494197877577591RNA PCR Primer, Index 1 (100% over 28bp)
GCATTGTGGTTCAGTGGTAGAATTCTCGCCTTGGAATTCTCGGGTGCCAA1007500.8053285492687616No Hit
TCCCTGTGGTCTAGTGGTTAGGATTCGGCGCTCTGGAATTCTCGGGTGCC990870.7920356323711542No Hit
TATTGCACTTGTCCCGGCCTGTTGGAATTCTCGGGTGCCAAGGAACTCCA949650.7590871035365553RNA PCR Primer, Index 1 (100% over 28bp)
AACATTCAACGCTGTCGGTGAGTGGAATTCTCGGGTGCCAAGGAACTCCA808530.6462851532905924RNA PCR Primer, Index 1 (100% over 28bp)
AAGCTGCCAGCTGAAGAACTGTTGGAATTCTCGGGTGCCAAGGAACTCCA792420.6334078898377689RNA PCR Primer, Index 1 (100% over 28bp)
AACATTCAACGCTGTCGGTGAGTTGGAATTCTCGGGTGCCAAGGAACTCC779240.622872673679593RNA PCR Primer, Index 1 (100% over 27bp)
TGGAGTGTGACAATGGTGTTTGTGGAATTCTCGGGTGCCAAGGAACTCCA745170.5956393797107723RNA PCR Primer, Index 1 (100% over 28bp)
TAGCTTATCAGACTGGTGTTGGCTGGAATTCTCGGGTGCCAAGGAACTCC694730.5553209955667363RNA PCR Primer, Index 1 (100% over 27bp)
TGAGATGAAGCACTGTAGCTCTTGGAATTCTCGGGTGCCAAGGAACTCCA690410.5518678746408394RNA PCR Primer, Index 1 (100% over 28bp)
TCCCTGGTGGTCTAGTGGTTAGGATTCGGCGCTTGGAATTCTCGGGTGCC582780.46583560490605347No Hit
CCGTCGAGCAGCATTCCGGGCTTCACATCGGAGGGCTCCAGCCGGCCCCG526210.42061730611485365No Hit
GCATTGGTGGTTCAGTGGTAGAATTCTCGCCTGGAATTCTCGGGTGCCAA523330.4183152254975891No Hit
CCTGTCTGAGGGTCGCTTGGAATTCTCGGGTGCCAAGGAACTCCAGTCAC512130.40936268976378254RNA PCR Primer, Index 1 (100% over 33bp)
TGAGATGAAGCACTGTAGCTCTGGAATTCTCGGGTGCCAAGGAACTCCAG506360.40475053519377685RNA PCR Primer, Index 1 (100% over 29bp)
GTTCTACAGTCCGACTGGAATTCTCGGGTGCCAAGGAACTCCAGTCACGT498190.39821998010938403RNA PCR Primer, Index 1 (97% over 35bp)
TTGCGGCCCCGGGTTCCTCCCGGGGCTACGCCTGTCTGAGGGTCGCTTGG495200.3958299728018767No Hit
CTACAGTCCGACGATCTGGAATTCTCGGGTGCCAAGGAACTCCAGTCACG455040.36372873752779883RNA PCR Primer, Index 6 (100% over 34bp)
GTTTCCGTAGTGTAGTGGTTATCACGTTCGCCTTGGAATTCTCGGGTGCC446540.35693440237267776No Hit
CATGGAATTCTCGGGTGCCAAGGAACTCCAGTCACGTCCGCATCTCGTAT428010.34212275173451384RNA PCR Primer, Index 18 (100% over 48bp)
TGTAAACATCCTACACTCTCAGCTTGGAATTCTCGGGTGCCAAGGAACTC416220.3326986092075871RNA PCR Primer, Index 1 (100% over 26bp)
GTTTCCGTAGTGTAGTGGTTATCACGTTCGCCTCTGGAATTCTCGGGTGC405600.32420968693142405No Hit
GCCCGGCTAGCTCAGTCGGTAGAGCATGAGACTCTGGAATTCTCGGGTGC401040.3205647259540885No Hit
TTCAAGTAATCCAGGATAGGTTTGGAATTCTCGGGTGCCAAGGAACTCCA385670.3082789693265343RNA PCR Primer, Index 1 (100% over 28bp)
TAACACTGTCTGGTAACGATGTTGGAATTCTCGGGTGCCAAGGAACTCCA384680.3074876291143496RNA PCR Primer, Index 1 (100% over 28bp)
ACCACGTTCCCGTGGTGGAATTCTCGGGTGCCAAGGAACTCCAGTCACGT371150.2966726462144922RNA PCR Primer, Index 1 (97% over 35bp)
GATCCATGATGACATTAAAACATAACGTGACTGTTGGATGAAGCTTGCGG367960.29412277219745264No Hit
TGGACGTGATGAGCAGGTGTTACCGCCCCAGTCTGATGTTTGGTGACTGA356860.2852501698184122No Hit
GCATTGGTGGTTCAGTGGTAGAATTCTCGCCTGCTGGAATTCTCGGGTGC356850.2852421764829356No Hit
TCCCTGTGGTCTAGTGGTTAGGATTCGGCGCTTGGAATTCTCGGGTGCCA343560.27461903363451684No Hit
ATCCATGATGACATTAAAACATAACGTGACTGTTGGATGAAGCTTGCGGA330260.26398789745062157No Hit
TTCAGTGATGTTTGACAAATGTCTGACCTGAACTGCAATGTGGACAGATC315010.25179806084878675No Hit
TGTAAACATCCTTGACTGGAAGCTTGGAATTCTCGGGTGCCAAGGAACTC313740.25078290724325686RNA PCR Primer, Index 1 (100% over 26bp)
GGACAACTCTTAGCGGTGGAATTCTCGGGTGCCAAGGAACTCCAGTCACG311240.24878457337410362RNA PCR Primer, Index 6 (100% over 34bp)
TGGAGTGTGACAATGGTGTTTTGGAATTCTCGGGTGCCAAGGAACTCCAG309370.24728981963997695RNA PCR Primer, Index 1 (100% over 29bp)
AGTTCTACAGTCCGACGATCTGGAATTCTCGGGTGCCAAGGAACTCCAGT307350.24567516587370117RNA PCR Primer, Index 1 (100% over 30bp)
GCATTGGTGGTTCAGTGGTAGAATTCTCGCCTGTGGAATTCTCGGGTGCC294080.23506800969623565No Hit
TGGAATTCTCGGGTGCCAGGAACTCCAGTCACGTCCGCATCTCGTATGCC292300.23364519598139855RNA PCR Primer, Index 18 (97% over 35bp)
CACCACGTTCCCGTGGTGGAATTCTCGGGTGCCAAGGAACTCCAGTCACG286850.22928882814664447RNA PCR Primer, Index 6 (100% over 34bp)
GCCCGGCTAGCTCAGTCGGTAGAGCATGAGACTTGGAATTCTCGGGTGCC286330.22887317470186058No Hit
TGGAGTGTGACAATGGTGTTTGTTGGAATTCTCGGGTGCCAAGGAACTCC285630.22831364121849765RNA PCR Primer, Index 1 (100% over 27bp)
TCTACAGTCCGACGATCTGGAATTCTCGGGTGCCAAGGAACTCCAGTCAC284380.22731447428392101RNA PCR Primer, Index 1 (100% over 33bp)
TACCCTGTAGATCCGGATTTGTTGGAATTCTCGGGTGCCAAGGAACTCCA279700.22357359328086615RNA PCR Primer, Index 1 (100% over 28bp)
TCAGTAACTGGAATCTGTCCCTTGGAATTCTCGGGTGCCAAGGAACTCCA273960.21898541871729027RNA PCR Primer, Index 1 (100% over 28bp)
TGGACAACTCTTAGCGGTGGAATTCTCGGGTGCCAAGGAACTCCAGTCAC270750.2164195580292975RNA PCR Primer, Index 1 (100% over 33bp)
TGAGGTAGTAGTTTGTATAGTTTGGAATTCTCGGGTGCCAAGGAACTCCA269290.21525253104971198RNA PCR Primer, Index 1 (100% over 28bp)
ACAGTCCGACGATCTGGAATTCTCGGGTGCCAAGGAACTCCAGTCACGTC247790.198066859774994RNA PCR Primer, Index 1 (97% over 36bp)
AGCCTGTGATGATACAAGTTATCCCTGTCTGAACTCTGGTGTGGAATTCT237900.19016145098862372No Hit
TAGCTTATCAGACTGGTGTTGGTGGAATTCTCGGGTGCCAAGGAACTCCA231260.18485387623215266RNA PCR Primer, Index 1 (100% over 28bp)
TAGTTCTACAGTCCGACGATCTGGAATTCTCGGGTGCCAAGGAACTCCAG220570.17630900060765337RNA PCR Primer, Index 1 (100% over 29bp)
TGAGAACTGAATTCCATAGATGGTGGAATTCTCGGGTGCCAAGGAACTCC220550.17629301393670013RNA PCR Primer, Index 1 (100% over 27bp)
TAACGGAACCCATAATGCAGCTGTGGAATTCTCGGGTGCCAAGGAACTCC210620.16835563180842342RNA PCR Primer, Index 1 (100% over 27bp)
AACATTCAACGCTGTCGGTGATGGAATTCTCGGGTGCCAAGGAACTCCAG204200.16322391043243786RNA PCR Primer, Index 1 (100% over 29bp)
TGGAATTCTCGGGTGCCAAGGAAATCCAGTCACGTCCGCATCTCGTATGC204020.16308003039385882RNA PCR Primer, Index 18 (98% over 50bp)
TCCCTGGTGGTCTAGTGGTTAGGATTCGGCGCTCTTGGAATTCTCGGGTG203820.16292016368432657No Hit
TTCTACAGTCCGACGATCTGGAATTCTCGGGTGCCAAGGAACTCCAGTCA198930.1590114226362628RNA PCR Primer, Index 1 (100% over 32bp)
TAACACTGTCTGGTAACGATGTGGAATTCTCGGGTGCCAAGGAACTCCAG198660.15879560257839426RNA PCR Primer, Index 1 (100% over 29bp)
TACAGTCCGACGATCTGGAATTCTCGGGTGCCAAGGAACTCCAGTCACGT196070.15672532868995145RNA PCR Primer, Index 1 (97% over 35bp)
GCATTGTGGTTCAGTGGTAGAATTCTCGCCTGGAATTCTCGGGTGCCAAG192510.15387970126027722No Hit
TATTGCACTTGTCCCGGCCTGTTTGGAATTCTCGGGTGCCAAGGAACTCC191490.1530643810416627RNA PCR Primer, Index 1 (100% over 27bp)
TACCCTGTAGATCCGGATTTGTGTGGAATTCTCGGGTGCCAAGGAACTCC181390.14499111221028355RNA PCR Primer, Index 1 (100% over 27bp)
AGAGATGATGACTTCTGTTACCGCCCCAGTCTGAGAAGTCATGACTGATC174470.13945972406046733No Hit
GTTCTACAGTCCGACGTGGAATTCTCGGGTGCCAAGGAACTCCAGTCACG168920.13502342287094712RNA PCR Primer, Index 6 (100% over 34bp)
AGAGTTCTACAGTCCGACGATCTGGAATTCTCGGGTGCCAAGGAACTCCA164370.1313864552290882RNA PCR Primer, Index 1 (100% over 28bp)
TGTAACAGCAACTCCATGTGGATGGAATTCTCGGGTGCCAAGGAACTCCA163430.1306350816942866RNA PCR Primer, Index 1 (100% over 28bp)
TGGAATTCTCGGGTGCCAAGGAACTCCAGTCACGGCCGCATCTCGTATGC163060.13033932828165187RNA PCR Primer, Index 18 (98% over 50bp)
CAGAGTTCTACAGTCCGACGATCTGGAATTCTCGGGTGCCAAGGAACTCC160350.12817313436748978RNA PCR Primer, Index 1 (100% over 27bp)
TGGAATTCTCGGGGGCCAAGGAACTCCAGTCACGTCCGCATCTCGTATGC159630.12759761421317364RNA PCR Primer, Index 18 (98% over 50bp)
CTCCCGGGGCTACGCCTGTCTGAGGGTCGCTTGGAATTCTCGGGTGCCAA152820.12215415275360017No Hit
TGAGATGAAGCACTGTAGCTTGGAATTCTCGGGTGCCAAGGAACTCCAGT149000.11910069860153398RNA PCR Primer, Index 1 (100% over 30bp)
TGGAATTCTCGGGTGCCAAGGAACTCCAGTCACGTCCGGATCTCGTATGC147800.11814149834434041RNA PCR Primer, Index 18 (98% over 50bp)
CATTGCACTTGTCTCGGTCTGATGGAATTCTCGGGTGCCAAGGAACTCCA146680.11724624477095977RNA PCR Primer, Index 1 (100% over 28bp)
TGGAATTCTCGGTGCCAAGGAACTCCAGTCACGTCCGCATCTCGTATGCC143460.11467239074749037RNA PCR Primer, Index 18 (97% over 41bp)
TGAGGTAGTAGGTTGTATAGTTGGAATTCTCGGGTGCCAAGGAACTCCAG142460.11387305719982907RNA PCR Primer, Index 1 (100% over 29bp)
CTACGCCTGTCTGAGGGTCGCTTGGAATTCTCGGGTGCCAAGGAACTCCA134370.10740644879924915RNA PCR Primer, Index 1 (100% over 28bp)
TGGCTGTGATGAGAAACTTGCCCTCACTGAAACGTGATTGAGACATCTTT134080.10717464207042737No Hit
AACTCTTAGCGGTGGATCACTCGGCTCGTGCGTCGATGAAGAACGCAGCT133680.10685490865136284No Hit
CTGTCTGAGGGTCGCTTGGAATTCTCGGGTGCCAAGGAACTCCAGTCACG131910.10544008827200234RNA PCR Primer, Index 6 (100% over 34bp)
TCGCTGCGATCCATTGAAAGTCAGCCCTCGATCCAAGTTTTTGTTGGAAT131720.10528821489794668No Hit
TGGAATTCTCGGGTGCAAGGAACTCCAGTCACGTCCGCATCTCGTATGCC131470.10508838151103138RNA PCR Primer, Index 18 (100% over 35bp)
GCATTGTGGTTCAGTGGTAGAATTCTCGCCTGCTGGAATTCTCGGGTGCC127740.10210686737825471No Hit
TGAGAACTGAATTCCATAGATGTGGAATTCTCGGGTGCCAAGGAACTCCA127690.10206690070087164RNA PCR Primer, Index 1 (100% over 28bp)
TAGCAGCACGTAAATATTGGAGTGGAATTCTCGGGTGCCAAGGAACTCCA125950.10067606032794096RNA PCR Primer, Index 1 (100% over 28bp)
TGTAAACATCCTACACTCTCAGCTGGAATTCTCGGGTGCCAAGGAACTCC125580.1003803069153063RNA PCR Primer, Index 1 (100% over 27bp)
TGAGGTAGTAGGTTGTATAGTTTTGGAATTCTCGGGTGCCAAGGAACTCC125390.10022843354125066RNA PCR Primer, Index 1 (100% over 27bp)

[WARN]Adapter Content

Adapter graph

[FAIL]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
ATCAAAT700.044.0469631
TTGAGAG1600.044.0469631
AACAGTA3100.044.0469631
TCGTACG454.802132E-1044.01068543
CTAGTAT650.044.0106842
AACATTC215500.044.0060841
TCGCATA207.8581163E-444.00153741
ATAACTA1450.044.0013622
ATAGGCG351.4475881E-744.00013416
TACGCGA700.044.00013416
GCCAGTA3500.044.0001316
TATGTGT254.4452943E-544.0001317
CACTATC207.8598177E-443.99960720
ACATACC454.802132E-1043.99960719
TGCGAAA207.86121E-443.99802427
ATGCGAC15150.043.9980226
ACCAACC302.5305162E-643.99801627
TAAGTGA351.4481702E-743.9978452
AGAGTAT454.802132E-1043.9978452
GTCCTTA207.8615197E-443.9976729