FastQCFastQC Report
Mon 5 Dec 2016
JM73_5_TCATTC_L005_R1_001.fastq

Summary

[OK]Basic Statistics

MeasureValue
FilenameJM73_5_TCATTC_L005_R1_001.fastq
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences14306216
Sequences flagged as poor quality0
Sequence length50
%GC51

[OK]Per base sequence quality

Per base quality graph

[WARN]Per tile sequence quality

Per base quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[FAIL]Per base sequence content

Per base sequence content

[WARN]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[OK]Sequence Length Distribution

Sequence length distribution

[FAIL]Sequence Duplication Levels

Duplication level graph

[FAIL]Overrepresented sequences

SequenceCountPercentagePossible Source
TTCAAGTAATCCAGGATAGGCTTGGAATTCTCGGGTGCCAAGGAACTCCA8876416.204582679305275RNA PCR Primer, Index 1 (100% over 28bp)
AACTCTTAGCGGTGGATCACTCGGCTCGTGCGTCGATGAAGAACGCAGCT4814513.3653273514114423No Hit
TTCCCTTTGTCATCCTATGCCTTGGAATTCTCGGGTGCCAAGGAACTCCA4494983.141976886131175RNA PCR Primer, Index 1 (100% over 28bp)
AACATTCAACGCTGTCGGTGAGTTGGAATTCTCGGGTGCCAAGGAACTCC4493913.141228959495648RNA PCR Primer, Index 1 (100% over 27bp)
AACATTCAACGCTGTCGGTGAGTGGAATTCTCGGGTGCCAAGGAACTCCA4318613.0186948107032636RNA PCR Primer, Index 1 (100% over 28bp)
TACCCTGTAGAACCGAATTTGTTGGAATTCTCGGGTGCCAAGGAACTCCA3226872.2555719835349892RNA PCR Primer, Index 1 (100% over 28bp)
CAACTCTTAGCGGTGGATCACTCGGCTCGTGCGTCGATGAAGAACGCAGC3095782.163940485730119No Hit
TCCTTCATTCCACCGGAGTCTGTGGAATTCTCGGGTGCCAAGGAACTCCA2815521.968039626970542RNA PCR Primer, Index 1 (100% over 28bp)
TAGCTTATCAGACTGGTGTTGGCTGGAATTCTCGGGTGCCAAGGAACTCC2623931.8341188193999027RNA PCR Primer, Index 1 (100% over 27bp)
TGAGGTAGTAGGTTGTATAGTTTGGAATTCTCGGGTGCCAAGGAACTCCA2604571.8205862402748567RNA PCR Primer, Index 1 (100% over 28bp)
AAGCTGCCAGCTGAAGAACTGTTGGAATTCTCGGGTGCCAAGGAACTCCA2489621.7402365517198957RNA PCR Primer, Index 1 (100% over 28bp)
TACCCTGTAGAACCGAATTTGCTGGAATTCTCGGGTGCCAAGGAACTCCA2115671.4788466775561055RNA PCR Primer, Index 1 (100% over 28bp)
AACAGTAAGAGTTTATGTGCTGTGGAATTCTCGGGTGCCAAGGAACTCCA1914681.3383552995425205RNA PCR Primer, Index 1 (100% over 28bp)
CCTGTCTGAGGGTCGCTTGGAATTCTCGGGTGCCAAGGAACTCCAGTCAC1775071.240768348527661RNA PCR Primer, Index 1 (100% over 33bp)
TATTGCACTTGTCCCGGCCTGTTGGAATTCTCGGGTGCCAAGGAACTCCA1770331.2374551034319627RNA PCR Primer, Index 1 (100% over 28bp)
TACCCTGTAGAACCGAATTTGCGTGGAATTCTCGGGTGCCAAGGAACTCC1508261.0542689974763417RNA PCR Primer, Index 1 (100% over 27bp)
AACATTCAACGCTGTCGGTGATGGAATTCTCGGGTGCCAAGGAACTCCAG1375790.9616728840106985RNA PCR Primer, Index 1 (100% over 29bp)
TTGGTCCCCTTCAACCAGCTGTTGGAATTCTCGGGTGCCAAGGAACTCCA1314340.9187195272320786RNA PCR Primer, Index 1 (100% over 28bp)
TCCTTCATTCCACCGGAGTCTGTTGGAATTCTCGGGTGCCAAGGAACTCC1158980.8101233757410067RNA PCR Primer, Index 1 (100% over 27bp)
TAACGGAACCCATAATGCAGCTGTGGAATTCTCGGGTGCCAAGGAACTCC1057270.7390284055546205RNA PCR Primer, Index 1 (100% over 27bp)
ACAGTAGTCTGCACATTGGTTTGGAATTCTCGGGTGCCAAGGAACTCCAG978000.6836189248086286RNA PCR Primer, Index 1 (100% over 29bp)
TTTGGTCCCCTTCAACCAGCTGTTGGAATTCTCGGGTGCCAAGGAACTCC928010.6486760719955578RNA PCR Primer, Index 1 (100% over 27bp)
CTGGACAACTCTTAGCGGTGGATCACTCGGCTCGTGCGTCGATGAAGAAC888530.6210796761351849No Hit
TTCACAGTGGCTAAGTTCTGTGGAATTCTCGGGTGCCAAGGAACTCCAGT841950.588520402599821RNA PCR Primer, Index 1 (100% over 30bp)
TTCCCTTTGTCATCCTATGCCTGTGGAATTCTCGGGTGCCAAGGAACTCC718050.5019146921869486RNA PCR Primer, Index 1 (100% over 27bp)
GCATTGGTGGTTCAGTGGTAGAATTCTCGCCTTGGAATTCTCGGGTGCCA703340.49163244844059395No Hit
TTCAAGTAATCCAGGATAGGCTGGAATTCTCGGGTGCCAAGGAACTCCAG640220.4475117669130677RNA PCR Primer, Index 1 (100% over 29bp)
TTCACAGTGGTTAAGTTCTGTGGAATTCTCGGGTGCCAAGGAACTCCAGT638920.4466030710007454RNA PCR Primer, Index 1 (100% over 30bp)
ACAACTCTTAGCGGTGGATCACTCGGCTCGTGCGTCGATGAAGAACGCAG621250.4342517965617183No Hit
AAGCTGCCAGCTGAAGAACTTGGAATTCTCGGGTGCCAAGGAACTCCAGT605670.4233614255509633RNA PCR Primer, Index 1 (100% over 30bp)
ACCCTGTAGAACCGAATTTGCGTGGAATTCTCGGGTGCCAAGGAACTCCA570870.3990363349749507RNA PCR Primer, Index 1 (100% over 28bp)
GTTTCCGTAGTGTAGTGGTTATCACGTTCGCCTCTGGAATTCTCGGGTGC559300.3909489413552822No Hit
TTCACAGTGGCTAAGTTCTGCTGGAATTCTCGGGTGCCAAGGAACTCCAG543350.3797999415079431RNA PCR Primer, Index 1 (100% over 29bp)
TTCAAGTAATCCAGGATAGGTTTGGAATTCTCGGGTGCCAAGGAACTCCA534680.373739638769609RNA PCR Primer, Index 1 (100% over 28bp)
TGAGGTAGTAGGTTGTATAGTTGGAATTCTCGGGTGCCAAGGAACTCCAG528200.3692101391451101RNA PCR Primer, Index 1 (100% over 29bp)
CTACGCCTGTCTGAGGGTCGCTTGGAATTCTCGGGTGCCAAGGAACTCCA486840.34029962919614803RNA PCR Primer, Index 1 (100% over 28bp)
TACGACCTCAGATCAGACGAGACAACCCGCTGAATTTAAGCATATTACTA451720.3157508596263331No Hit
TGAGGTAGTAGTTTGTATAGTTTGGAATTCTCGGGTGCCAAGGAACTCCA448140.31324845088316855RNA PCR Primer, Index 1 (100% over 28bp)
CTGTCTGAGGGTCGCTTGGAATTCTCGGGTGCCAAGGAACTCCAGTCACT447390.3127242032414441RNA PCR Primer, Index 3 (100% over 34bp)
TTCAAGTAATCCAGGATAGGCTTTGGAATTCTCGGGTGCCAAGGAACTCC427040.29849961722932183RNA PCR Primer, Index 1 (100% over 27bp)
ACTGGACAACTCTTAGCGGTGGATCACTCGGCTCGTGCGTCGATGAAGAA421580.2946830943975682No Hit
AAGCTGCCAGCTGAAGAACTGCTGGAATTCTCGGGTGCCAAGGAACTCCA406540.2841701816888547RNA PCR Primer, Index 1 (100% over 28bp)
TACCCTGTAGAACCGAATTTGTGGAATTCTCGGGTGCCAAGGAACTCCAG405420.2833873052105462RNA PCR Primer, Index 1 (100% over 29bp)
TACCCTGTAGATCCGGATTTGTTGGAATTCTCGGGTGCCAAGGAACTCCA390100.27267867338225565RNA PCR Primer, Index 1 (100% over 28bp)
TGCCTGTGATGAGACTCTCGACGGGCGGACTGAATGGGTTTTCACCCTCC386070.2698617160540565No Hit
TTCCAGTGATGACAGCCTATAATCTGACTTGGAATTCTCGGGTGCCAAGG383470.2680443242294119Illumina Small RNA Adapter 2 (100% over 21bp)
GTTTCCGTAGTGTAGTGGTTATCACGTTCGCCTTGGAATTCTCGGGTGCC382260.2671985380340965No Hit
TATTGCACTTGTCCCGGCCTGTTTGGAATTCTCGGGTGCCAAGGAACTCC373430.26102639579886117RNA PCR Primer, Index 1 (100% over 27bp)
TTCACAGTGGCTAAGTTCAGTTGGAATTCTCGGGTGCCAAGGAACTCCAG355970.2488219106995169RNA PCR Primer, Index 1 (100% over 29bp)
CACCACGTTCCCGTGGTGGAATTCTCGGGTGCCAAGGAACTCCAGTCACT351250.2455226455409313RNA PCR Primer, Index 3 (100% over 34bp)
CATTGCACTTGTCTCGGTCTGATGGAATTCTCGGGTGCCAAGGAACTCCA337430.23586250899608951RNA PCR Primer, Index 1 (100% over 28bp)
TGAGATGAAGCACTGTAGCTCTTGGAATTCTCGGGTGCCAAGGAACTCCA322970.22575501446364293RNA PCR Primer, Index 1 (100% over 28bp)
TGTCTGAGGGTCGCTTGGAATTCTCGGGTGCCAAGGAACTCCAGTCACTC319970.22365802389674533RNA PCR Primer, Index 5 (97% over 35bp)
CCACGTTCCCGTGGTGGAATTCTCGGGTGCCAAGGAACTCCAGTCACTCA318280.22247671921072631RNA PCR Primer, Index 3 (97% over 36bp)
TCCTTCATTCCACCGGAGTCTTGGAATTCTCGGGTGCCAAGGAACTCCAG313890.21940812301449944RNA PCR Primer, Index 1 (100% over 29bp)
TGAGGTAGTAGGTTGTATAGTTTTGGAATTCTCGGGTGCCAAGGAACTCC293080.20486199844878616RNA PCR Primer, Index 1 (100% over 27bp)
AACATTCATTGCTGTCGGTGGGTTGGAATTCTCGGGTGCCAAGGAACTCC292730.2046173495493148RNA PCR Primer, Index 1 (100% over 27bp)
GCCCGGCTAGCTCAGTCGGTAGAGCATGAGACTCTGGAATTCTCGGGTGC291250.20358283420297862No Hit
TCCAGTGATGACAGCCTATAATCTGACTTGGAATTCTCGGGTGCCAAGGA277380.19388774781535523RNA PCR Primer, Index 1 (100% over 22bp)
ACAGTAGTCTGCACATTGGTTATGGAATTCTCGGGTGCCAAGGAACTCCA277360.19387376787824256RNA PCR Primer, Index 1 (100% over 28bp)
TAGCTTATCAGACTGGTGTTGGTGGAATTCTCGGGTGCCAAGGAACTCCA270560.18912058925994127RNA PCR Primer, Index 1 (100% over 28bp)
TCCAGCATCAGTGATTTTGTTTGGAATTCTCGGGTGCCAAGGAACTCCAG266450.18624771218329153RNA PCR Primer, Index 1 (100% over 29bp)
CCTTTCTGAGGGTCGCTTGGAATTCTCGGGTGCCAAGGAACTCCAGTCAC263470.18416470155350653RNA PCR Primer, Index 1 (100% over 33bp)
TATTGCACTTGTCCCGGCCTGTATTGGAATTCTCGGGTGCCAAGGAACTC254170.17766403079612386RNA PCR Primer, Index 1 (100% over 26bp)
TGAGATGAAGCACTGTAGCTCTGGAATTCTCGGGTGCCAAGGAACTCCAG253930.17749627155077205RNA PCR Primer, Index 1 (100% over 29bp)
AACATTCATTGCTGTCGGTGGGTGGAATTCTCGGGTGCCAAGGAACTCCA245430.17155479827789544RNA PCR Primer, Index 1 (100% over 28bp)
TCCCTGGTGGTCTAGTGGTTAGGATTCGGCGCTCTGGAATTCTCGGGTGC243900.1704853330887776No Hit
TATTGCACTTGTCCCGGCCTGTATGGAATTCTCGGGTGCCAAGGAACTCC242840.16974439642180714RNA PCR Primer, Index 1 (100% over 27bp)
TTCAAGTAATCCAGGATGGGCTTGGAATTCTCGGGTGCCAAGGAACTCCA242020.16917121900018844RNA PCR Primer, Index 1 (100% over 28bp)
TGAGGTAGTAGATTGAATAGTTTGGAATTCTCGGGTGCCAAGGAACTCCA238440.16666881025702393RNA PCR Primer, Index 1 (100% over 28bp)
GCATTGTGGTTCAGTGGTAGAATTCTCGCCTTGGAATTCTCGGGTGCCAA237410.16594884349572242No Hit
GATCCATGATGACATTAAAACATAACGTGACTGTTGGATGAAGCTTGCGG235230.16442503035044348No Hit
TACAGTAGTCTGCACATTGGTTTGGAATTCTCGGGTGCCAAGGAACTCCA228400.1596508818264732RNA PCR Primer, Index 1 (100% over 28bp)
AACATTCAACGCTGTCGGTGGTGGAATTCTCGGGTGCCAAGGAACTCCAG223950.15654034581890836RNA PCR Primer, Index 1 (100% over 29bp)
TTTGGTCCCCTTCAACCAGCTGTGGAATTCTCGGGTGCCAAGGAACTCCA223570.156274727013768RNA PCR Primer, Index 1 (100% over 28bp)
TACCCTGTAGAACCGAATGTGTTGGAATTCTCGGGTGCCAAGGAACTCCA221580.15488372327105923RNA PCR Primer, Index 1 (100% over 28bp)
AGCCTGTGATGATACAAGTTATCCCTGTCTGAACTCTGGTGTGGAATTCT219130.15317118097475949No Hit
GCCCGGCTAGCTCAGTCGGTAGAGCATGAGACTTGGAATTCTCGGGTGCC217980.15236733459078208No Hit
AACATTCAACGCTGTCGGTGAGATGGAATTCTCGGGTGCCAAGGAACTCC214940.15024238414965915RNA PCR Primer, Index 1 (100% over 27bp)
ATCCATGATGACATTAAAACATAACGTGACTGTTGGATGAAGCTTGCGGA208090.14545425568857623No Hit
ACCCTGTAGAACCGAATTTGCTGGAATTCTCGGGTGCCAAGGAACTCCAG204820.1431685359706578RNA PCR Primer, Index 1 (100% over 29bp)
TATTGCACTTGTCCCGGCCTGTTTTGGAATTCTCGGGTGCCAAGGAACTC203850.1424905090206942RNA PCR Primer, Index 1 (100% over 26bp)
TGGAATTCTCGGGTGCCAAGGAACTCCAGTCACTCATTCATCTCGTATGC203220.14205014100164573RNA PCR Primer, Index 45 (100% over 50bp)
TGTTGCTGGAGAAAAAGTTACACCTCTGACCTGGAATTCTCGGGTGCCAA199270.13928910342189715No Hit
TTCACAGTGGCTAAGTTCTGCTTGGAATTCTCGGGTGCCAAGGAACTCCA199090.1391632839878833RNA PCR Primer, Index 1 (100% over 28bp)
AGAGATGATGACTTCTGTTACCGCCCCAGTCTGAGAAGTCATGACTGATC197620.13813575861010347No Hit
TTCACAGTGGTTAAGTTCTGCCTGGAATTCTCGGGTGCCAAGGAACTCCA196620.13743676175447092RNA PCR Primer, Index 1 (100% over 28bp)
TTCAGTCATTGTTTCTGGTTGTTGGAATTCTCGGGTGCCAAGGAACTCCA192260.13438913546391304RNA PCR Primer, Index 1 (100% over 28bp)
TTGCGGCCCCGGGTTCCTCCCGGGGCTACGCCTGTCTGAGGGTCGCTTGG191060.13355033923715398No Hit
GCATTGGTGGTTCAGTGGTAGAATTCTCGCCTGCTGGAATTCTCGGGTGC177860.12432358074280438No Hit
TTGTTCCCCTTCAACCAGCTGTTGGAATTCTCGGGTGCCAAGGAACTCCA175670.12279277762896912RNA PCR Primer, Index 1 (100% over 28bp)
TAAGATGATGATTAACTCACCATCTTTCGGCTGAAGAATGATGTATACTC174660.12208679080478024No Hit
ACCACGTTCCCGTGGTGGAATTCTCGGGTGCCAAGGAACTCCAGTCACTC169290.11833317769003347RNA PCR Primer, Index 5 (97% over 35bp)
TCCTCCCGGGGCTACGCCTGTCTGAGGGTCGCTTGGAATTCTCGGGTGCC167720.11723575262669039No Hit
TTCACAGTGGTTAAGTTCTGCTGGAATTCTCGGGTGCCAAGGAACTCCAG162750.11376173825419665RNA PCR Primer, Index 1 (100% over 29bp)
ACCCTGTAGAACCGAATTTGTGTGGAATTCTCGGGTGCCAAGGAACTCCA162430.11353805926039423RNA PCR Primer, Index 1 (100% over 28bp)
TCCAGCATCAGTGATTTTGTTGTGGAATTCTCGGGTGCCAAGGAACTCCA160940.11249655394550172RNA PCR Primer, Index 1 (100% over 28bp)
TGAGAACTGAATTCCATAGATGGTGGAATTCTCGGGTGCCAAGGAACTCC157610.11016889441624535RNA PCR Primer, Index 1 (100% over 27bp)
TCCCTGAGACCCTTAACCTGTGTGGAATTCTCGGGTGCCAAGGAACTCCA157450.11005705491934416RNA PCR Primer, Index 1 (100% over 28bp)
TCCCTGAGACCCTTAACCTGTGATGGAATTCTCGGGTGCCAAGGAACTCC157040.10977046620853481RNA PCR Primer, Index 1 (100% over 27bp)
GCATTGGTGGTTCAGTGGTAGAATTCTCGCCTGGAATTCTCGGGTGCCAA156610.1094698975606128No Hit
CCCTGAGACCCTTAACCTGTGATGGAATTCTCGGGTGCCAAGGAACTCCA154200.10778531513853838RNA PCR Primer, Index 1 (100% over 28bp)
TTACATGATGAAACATGTGTTGGTAGGGACATCTGAATGAATGTGATGAA152510.10660401045251937No Hit
TATGTGCCCTTGGACTACATCGTGGAATTCTCGGGTGCCAAGGAACTCCA150990.10554153523195792RNA PCR Primer, Index 1 (100% over 28bp)
AACTGGACAACTCTTAGCGGTGGATCACTCGGCTCGTGCGTCGATGAAGA150730.10535979604949346No Hit
TCCCTGTGGTCTAGTGGTTAGGATTCGGCGCTCTGGAATTCTCGGGTGCC146740.1025707985955196No Hit

[WARN]Adapter Content

Adapter graph

[FAIL]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
GCTTACG5150.044.1021731
TTCGTTA351.4214856E-744.102171
CCGTTAT207.77025E-444.102171
AACATTC1274950.044.0744971
AACAGTA215850.044.071521
TACGCGC351.4480429E-743.99843216
CTATGCG408.3273335E-943.9984315
CGTTATC207.861293E-443.997972
TATACAG1500.043.997972
CTTACAC454.802132E-1043.9979672
CTTCATA207.8618346E-443.9973563
GCTCCGC351.448334E-743.9973563
AGTAAGG207.8618346E-443.9973564
CGAGTAA7900.043.9973533
GCTATAG254.446983E-543.9973534
TAAATCG302.5308054E-643.9973534
TACACCA454.802132E-1043.9973534
GCATATC254.446983E-543.9973533
GCCCCTA1250.043.99725
TATCGAT750.043.99725