FastQCFastQC Report
Mon 5 Dec 2016
JM74_3_GTGAAA_L006_R1_001.fastq

Summary

[OK]Basic Statistics

MeasureValue
FilenameJM74_3_GTGAAA_L006_R1_001.fastq
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences10415044
Sequences flagged as poor quality0
Sequence length50
%GC50

[OK]Per base sequence quality

Per base quality graph

[WARN]Per tile sequence quality

Per base quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[FAIL]Per base sequence content

Per base sequence content

[FAIL]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[OK]Sequence Length Distribution

Sequence length distribution

[FAIL]Sequence Duplication Levels

Duplication level graph

[FAIL]Overrepresented sequences

SequenceCountPercentagePossible Source
TGGAATTCTCGGGTGCCAAGGAACTCCAGTCACGTGAAAATCTCGTATGC575088755.2171167015713RNA PCR Primer, Index 19 (100% over 50bp)
TCCCTGGTGGTCTAGTGGTTAGGATTCGGCGCTCTGGAATTCTCGGGTGC1071351.0286562399544352No Hit
TGGAGTGTGACAATGGTGTTTGTGGAATTCTCGGGTGCCAAGGAACTCCA1046891.0051709815148164RNA PCR Primer, Index 1 (100% over 28bp)
GCATTGGTGGTTCAGTGGTAGAATTCTCGCCTTGGAATTCTCGGGTGCCA962730.9243647938501268No Hit
TTCAAGTAATCCAGGATAGGCTTGGAATTCTCGGGTGCCAAGGAACTCCA796650.7649031535536479RNA PCR Primer, Index 1 (100% over 28bp)
AAGCTGCCAGCTGAAGAACTGTTGGAATTCTCGGGTGCCAAGGAACTCCA637960.6125370185666043RNA PCR Primer, Index 1 (100% over 28bp)
CCGTCGAGCAGCATTCCGGGCTTCACATCGGAGGGCTCCAGCCGGCCCCG613890.5894262184586065No Hit
TCCCTGTGGTCTAGTGGTTAGGATTCGGCGCTCTGGAATTCTCGGGTGCC594710.5710105497393962No Hit
TGAGGTAGTAGGTTGTATAGTTTGGAATTCTCGGGTGCCAAGGAACTCCA562090.5396904708227829RNA PCR Primer, Index 1 (100% over 28bp)
TATTGCACTTGTCCCGGCCTGTTGGAATTCTCGGGTGCCAAGGAACTCCA513150.4927007509521803RNA PCR Primer, Index 1 (100% over 28bp)
TGGAGTGTGACAATGGTGTTTTGGAATTCTCGGGTGCCAAGGAACTCCAG455940.4377705941520747RNA PCR Primer, Index 1 (100% over 29bp)
TGGAATTCTCGGGTGCCAAGGAACTCCAGTCACGGGAAAATCTCGTATGC418170.40150574495892677RNA PCR Primer, Index 19 (98% over 50bp)
TGGAGTGTGACAATGGTGTTTGTTGGAATTCTCGGGTGCCAAGGAACTCC410910.3945350590933653RNA PCR Primer, Index 1 (100% over 27bp)
GTTCTACAGTCCGACTGGAATTCTCGGGTGCCAAGGAACTCCAGTCACGT378620.36353182953427754RNA PCR Primer, Index 1 (97% over 35bp)
GATCCATGATGACATTAAAACATAACGTGACTGTTGGATGAAGCTTGCGG362400.3479582035371142No Hit
TGGACGTGATGAGCAGGTGTTACCGCCCCAGTCTGATGTTTGGTGACTGA358830.34453046957842903No Hit
ATCCATGATGACATTAAAACATAACGTGACTGTTGGATGAAGCTTGCGGA350190.33623477730867No Hit
GCATTGTGGTTCAGTGGTAGAATTCTCGCCTTGGAATTCTCGGGTGCCAA347750.3338920123621177No Hit
ACCACGTTCCCGTGGTGGAATTCTCGGGTGCCAAGGAACTCCAGTCACGT344590.33085793972641886RNA PCR Primer, Index 1 (97% over 35bp)
GTTTCCGTAGTGTAGTGGTTATCACGTTCGCCTTGGAATTCTCGGGTGCC343040.32936970789561715No Hit
AACATTCAACGCTGTCGGTGAGTTGGAATTCTCGGGTGCCAAGGAACTCC331810.31858722824406693RNA PCR Primer, Index 1 (100% over 27bp)
ATGACCTATGAATTGACAGCCATGGAATTCTCGGGTGCCAAGGAACTCCA328860.3157547870177025RNA PCR Primer, Index 1 (100% over 28bp)
TAGCTTATCAGACTGGTGTTGGCTGGAATTCTCGGGTGCCAAGGAACTCC327240.3141993447171227RNA PCR Primer, Index 1 (100% over 27bp)
GCATTGGTGGTTCAGTGGTAGAATTCTCGCCTGGAATTCTCGGGTGCCAA326080.31308557121794206No Hit
AACATTCAACGCTGTCGGTGAGTGGAATTCTCGGGTGCCAAGGAACTCCA319500.30676778705879687RNA PCR Primer, Index 1 (100% over 28bp)
TTGCGGCCCCGGGTTCCTCCCGGGGCTACGCCTGTCTGAGGGTCGCTTGG293250.2815638608919943No Hit
CCTGTCTGAGGGTCGCTTGGAATTCTCGGGTGCCAAGGAACTCCAGTCAC292890.281218207047421RNA PCR Primer, Index 1 (100% over 33bp)
ATGACCTATGAATTGACAGCCTGGAATTCTCGGGTGCCAAGGAACTCCAG286000.2746027765221155RNA PCR Primer, Index 1 (100% over 29bp)
GGACAACTCTTAGCGGTGGAATTCTCGGGTGCCAAGGAACTCCAGTCACG265820.255226958234646RNA PCR Primer, Index 6 (100% over 34bp)
CTACAGTCCGACGATCTGGAATTCTCGGGTGCCAAGGAACTCCAGTCACG264060.2535370949945099RNA PCR Primer, Index 6 (100% over 34bp)
TGGAATTCTCGGGTGCCAGGAACTCCAGTCACGTGAAAATCTCGTATGCC225000.21603365285830767RNA PCR Primer, Index 19 (97% over 35bp)
TGGACAACTCTTAGCGGTGGAATTCTCGGGTGCCAAGGAACTCCAGTCAC223560.2146510374800145RNA PCR Primer, Index 1 (100% over 33bp)
TAACGGAACCCATAATGCAGCTGTGGAATTCTCGGGTGCCAAGGAACTCC216440.20781477255400935RNA PCR Primer, Index 1 (100% over 27bp)
AGCCTGTGATGATACAAGTTATCCCTGTCTGAACTCTGGTGTGGAATTCT210590.2021978975796934No Hit
TTCAGTGATGTTTGACAAATGTCTGACCTGAACTGCAATGTGGACAGATC207910.19962469673675884No Hit
CACCACGTTCCCGTGGTGGAATTCTCGGGTGCCAAGGAACTCCAGTCACG206520.19829008883687865RNA PCR Primer, Index 6 (100% over 34bp)
TGGAATTCTCGGGTGCCAAGGAACTCCAGTGACGTGAAAATCTCGTATGC193140.1854432876135713RNA PCR Primer, Index 19 (98% over 50bp)
ACAGTCCGACGATCTGGAATTCTCGGGTGCCAAGGAACTCCAGTCACGTG187230.17976880366515977RNA PCR Primer, Index 15 (97% over 36bp)
TCTACAGTCCGACGATCTGGAATTCTCGGGTGCCAAGGAACTCCAGTCAC185850.1784437972609621RNA PCR Primer, Index 1 (100% over 33bp)
TGAGGTAGTAGTTTGTATAGTTTGGAATTCTCGGGTGCCAAGGAACTCCA183100.17580338594824946RNA PCR Primer, Index 1 (100% over 28bp)
AGTTCTACAGTCCGACGATCTGGAATTCTCGGGTGCCAAGGAACTCCAGT180620.1734222150189668RNA PCR Primer, Index 1 (100% over 30bp)
AGAGATGATGACTTCTGTTACCGCCCCAGTCTGAGAAGTCATGACTGATC178420.17130988596879668No Hit
TGTAAACATCCTACACTCTCAGCTTGGAATTCTCGGGTGCCAAGGAACTC172900.16600986035200618RNA PCR Primer, Index 1 (100% over 26bp)
TTCAAGTAATCCAGGATAGGTTTGGAATTCTCGGGTGCCAAGGAACTCCA171880.16503050779238185RNA PCR Primer, Index 1 (100% over 28bp)
TGGAATTCTCGGGTGCCAAGGAACTCCAGTCACGTTAAAATCTCGTATGC170680.1638783283104709RNA PCR Primer, Index 19 (98% over 50bp)
CATGGAATTCTCGGGTGCCAAGGAACTCCAGTCACGTGAAAATCTCGTAT162130.1556690495018552RNA PCR Primer, Index 19 (100% over 48bp)
TGGAATTCTCGGGTGCAAGGAACTCCAGTCACGTGAAAATCTCGTATGCC161120.15469929843791347RNA PCR Primer, Index 19 (100% over 35bp)
GTTTCCGTAGTGTAGTGGTTATCACGTTCGCCTCTGGAATTCTCGGGTGC157290.15102192559148095No Hit
TGGAATTCTCGGTGCCAAGGAACTCCAGTCACGTGAAAATCTCGTATGCC154810.14864075466219825RNA PCR Primer, Index 19 (97% over 41bp)
CTCCCGGGGCTACGCCTGTCTGAGGGTCGCTTGGAATTCTCGGGTGCCAA153820.1476902065896217No Hit
TACAGTCCGACGATCTGGAATTCTCGGGTGCCAAGGAACTCCAGTCACGT145450.13965375470329267RNA PCR Primer, Index 1 (97% over 35bp)
CAGAGTTCTACAGTCCGACGATCTGGAATTCTCGGGTGCCAAGGAACTCC143630.137906282489061RNA PCR Primer, Index 1 (100% over 27bp)
TGGAATTCTCGGGTGCCAAGGAACTCCAGTCACGTGCAAATCTCGTATGC142500.13682131347692816RNA PCR Primer, Index 19 (98% over 50bp)
TCAGTAACTGGAATCTGTCCCTTGGAATTCTCGGGTGCCAAGGAACTCCA136970.13151168636445512RNA PCR Primer, Index 1 (100% over 28bp)
TTCTACAGTCCGACGATCTGGAATTCTCGGGTGCCAAGGAACTCCAGTCA134800.12942816180133276RNA PCR Primer, Index 1 (100% over 32bp)
TAGTTCTACAGTCCGACGATCTGGAATTCTCGGGTGCCAAGGAACTCCAG130630.12542433810169212RNA PCR Primer, Index 1 (100% over 29bp)
TGAGATGAAGCACTGTAGCTCTGGAATTCTCGGGTGCCAAGGAACTCCAG128930.12379208383565159RNA PCR Primer, Index 1 (100% over 29bp)
AGAGTTCTACAGTCCGACGATCTGGAATTCTCGGGTGCCAAGGAACTCCA126020.12099804859201747RNA PCR Primer, Index 1 (100% over 28bp)
GTGGGATGATGATTCTTAGACTAGAGTCTCTGAGAACACATGAAGTTGTT124740.11976905714464577No Hit
TGAATTCTCGGGTGCCAAGGAACTCCAGTCACGTGAAAATCTCGTATGCC116590.11194383816333373RNA PCR Primer, Index 19 (98% over 50bp)
GTTCTACAGTCCGACGTGGAATTCTCGGGTGCCAAGGAACTCCAGTCACG115850.11123332748282197RNA PCR Primer, Index 6 (100% over 34bp)
TGCCTGTGATGAGACTCTCGACGGGCGGACTGAATGGGTTTTCACCCTCC113330.10881375057080891No Hit
TGGAATTCTCGGGTGCCAAGGAAATCCAGTCACGTGAAAATCTCGTATGC111630.10718149630476836RNA PCR Primer, Index 19 (98% over 50bp)
GCATTGGTGGTTCAGTGGTAGAATTCTCGCCTGCCACGCGGGAGGCCCGG111530.10708548134794246No Hit
CTGGACAACTCTTAGCGGTGGAATTCTCGGGTGCCAAGGAACTCCAGTCA108570.1042434386258954RNA PCR Primer, Index 1 (100% over 32bp)
GCATTGTGGTTCAGTGGTAGAATTCTCGCCTGGAATTCTCGGGTGCCAAG108300.10398419824246541No Hit
TGAGATGAAGCACTGTAGCTCTTGGAATTCTCGGGTGCCAAGGAACTCCA107930.10362894290220953RNA PCR Primer, Index 1 (100% over 28bp)

[OK]Adapter Content

Adapter graph

[WARN]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
AAGTACG254.4219174E-544.0393641
TACTTAA1950.044.0393641
TCAGTAA28500.044.0393641
TATTGAA1150.044.039361
TGCATAT1600.044.039361
GTTCCTA207.8248756E-444.039361
GTCCAAT207.8248756E-444.039361
ACGCCGC502.7284841E-1144.03280344
ATACTTA408.269126E-944.03280344
CTAGTAT750.044.03026642
GCATATT950.044.0182140
ATCACTA207.860124E-443.99918722
CATCACT454.802132E-1043.99918722
GTATTTA254.4469394E-543.99728824
AGTTTGC207.861797E-443.99728828
AGTCACC351.4482976E-743.99728828
GCCATTC207.861797E-443.99728824
CTGACCG351.4482976E-743.99728826
CTGCGTC254.4469394E-543.99728826
CCACTCA207.861797E-443.99728826