FastQCFastQC Report
Mon 5 Dec 2016
JM77_1_GTTTCG_L008_R1_001.fastq

Summary

[OK]Basic Statistics

MeasureValue
FilenameJM77_1_GTTTCG_L008_R1_001.fastq
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences6720802
Sequences flagged as poor quality0
Sequence length50
%GC51

[OK]Per base sequence quality

Per base quality graph

[FAIL]Per tile sequence quality

Per base quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[FAIL]Per base sequence content

Per base sequence content

[FAIL]Per sequence GC content

Per sequence GC content graph

[WARN]Per base N content

N content graph

[OK]Sequence Length Distribution

Sequence length distribution

[FAIL]Sequence Duplication Levels

Duplication level graph

[FAIL]Overrepresented sequences

SequenceCountPercentagePossible Source
AACATTCAACGCTGTCGGTGAGTGGAATTCTCGGGTGCCAAGGAACTCCA5887548.76017475295359RNA PCR Primer, Index 1 (100% over 28bp)
TTCAAGTAATCCAGGATAGGCTTGGAATTCTCGGGTGCCAAGGAACTCCA3800725.655158417105578RNA PCR Primer, Index 1 (100% over 28bp)
AACATTCAACGCTGTCGGTGAGTTGGAATTCTCGGGTGCCAAGGAACTCC3373745.019847333696187RNA PCR Primer, Index 1 (100% over 27bp)
TGAGGTAGTAGGTTGTATAGTTTGGAATTCTCGGGTGCCAAGGAACTCCA2010582.9915774932813077RNA PCR Primer, Index 1 (100% over 28bp)
TCACAGTGAACCGGTCTCTTTTGGAATTCTCGGGTGCCAAGGAACTCCAG1255931.8687204294963609RNA PCR Primer, Index 1 (100% over 29bp)
AACATTCAACGCTGTCGGTGATGGAATTCTCGGGTGCCAAGGAACTCCAG1110191.6518713094062287RNA PCR Primer, Index 1 (100% over 29bp)
TCCCTGAGACCCTTAACCTGTGTGGAATTCTCGGGTGCCAAGGAACTCCA742451.1047044683060148RNA PCR Primer, Index 1 (100% over 28bp)
TATTGCACTCGTCCCGGCCTCCTGGAATTCTCGGGTGCCAAGGAACTCCA614570.9144295576629099RNA PCR Primer, Index 1 (100% over 28bp)
TGAGGTAGTAGTTTGTGCTGTTTGGAATTCTCGGGTGCCAAGGAACTCCA563510.838456481830591RNA PCR Primer, Index 1 (100% over 28bp)
TCCCTGAGACCCTTAACCTGTTGGAATTCTCGGGTGCCAAGGAACTCCAG554150.8245295725123281RNA PCR Primer, Index 1 (100% over 29bp)
TAAAGCTAGAGAACCGAAAGTATGGAATTCTCGGGTGCCAAGGAACTCCA517100.7694022231275375RNA PCR Primer, Index 1 (100% over 28bp)
TGAGGTAGTAGGTTGTATAGTTGGAATTCTCGGGTGCCAAGGAACTCCAG509940.7587487326661312RNA PCR Primer, Index 1 (100% over 29bp)
AACCCGTAGATCCGAACTTGTGTGGAATTCTCGGGTGCCAAGGAACTCCA509230.7576923111259638RNA PCR Primer, Index 1 (100% over 28bp)
TAAAGCTAGAGAACCGAAAGTTGGAATTCTCGGGTGCCAAGGAACTCCAG483100.7188130226124798RNA PCR Primer, Index 1 (100% over 29bp)
TCCAGCATCAGTGATTTTGTTTGGAATTCTCGGGTGCCAAGGAACTCCAG482620.7180988221346203RNA PCR Primer, Index 1 (100% over 29bp)
TCTTTGGTTATCTAGCTGTATGATGGAATTCTCGGGTGCCAAGGAACTCC475170.7070138355511738RNA PCR Primer, Index 1 (100% over 27bp)
TCTTTGGTTATCTAGCTGTATTGGAATTCTCGGGTGCCAAGGAACTCCAG471250.7011811983153201RNA PCR Primer, Index 1 (100% over 29bp)
AACATTCATTGCTGTCGGTGGGTGGAATTCTCGGGTGCCAAGGAACTCCA467870.6961520366170585RNA PCR Primer, Index 1 (100% over 28bp)
TCCCTGAGACCCTTAACCTGTGATGGAATTCTCGGGTGCCAAGGAACTCC455910.6783565413770559RNA PCR Primer, Index 1 (100% over 27bp)
TTAAAGGGAATTTGCGACTGTTTGGAATTCTCGGGTGCCAAGGAACTCCA454300.6759609939409017RNA PCR Primer, Index 1 (100% over 28bp)
AACANTCAACGCTGTCGGTGAGTGGAATTCTCGGGTGCCAAGGAACTCCA445970.6635666398147125RNA PCR Primer, Index 1 (100% over 28bp)
AACAGTCAACGCTGTCGGTGAGTGGAATTCTCGGGTGCCAAGGAACTCCA445360.662659010040766RNA PCR Primer, Index 1 (100% over 28bp)
TGAGGTAGTAGTTTGTATAGTTTGGAATTCTCGGGTGCCAAGGAACTCCA430040.639864111455746RNA PCR Primer, Index 1 (100% over 28bp)
TGGAATTCTCGGGTGCCAAGGAACTCCAGTCACGTTTCGATCTCGTATGC387180.5760919604535292RNA PCR Primer, Index 21 (100% over 50bp)
CCACGTTCCCGTGGTGGAATTCTCGGGTGCCAAGGAACTCCAGTCACGTT348860.519074955637735RNA PCR Primer, Index 9 (97% over 36bp)
AACATTCATTGCTGTCGGTGGGTTGGAATTCTCGGGTGCCAAGGAACTCC297840.4431613965119044RNA PCR Primer, Index 1 (100% over 27bp)
TTCANGTAATCCAGGATAGGCTTGGAATTCTCGGGTGCCAAGGAACTCCA287110.4271960399964171RNA PCR Primer, Index 1 (100% over 28bp)
TTCAGGTAATCCAGGATAGGCTTGGAATTCTCGGGTGCCAAGGAACTCCA284210.4228810787760151RNA PCR Primer, Index 1 (100% over 28bp)
AGCTACATCTGGCTACTGGGTCTCTGGAATTCTCGGGTGCCAAGGAACTC277160.4123912592574517RNA PCR Primer, Index 1 (100% over 26bp)
TAAAGCTAGAGAACCGAAAGTCTGGAATTCTCGGGTGCCAAGGAACTCCA275300.4096237324057456RNA PCR Primer, Index 1 (100% over 28bp)
TAGCTTATCAGACTGGTGTTGGCTGGAATTCTCGGGTGCCAAGGAACTCC272540.4055170796580527RNA PCR Primer, Index 1 (100% over 27bp)
TGAGGTAGTTGGTTGTATAGTTTGGAATTCTCGGGTGCCAAGGAACTCCA266660.3967681238042722RNA PCR Primer, Index 1 (100% over 28bp)
TCACAGTGAACCGGTCTCTTTTTGGAATTCTCGGGTGCCAAGGAACTCCA265220.39462552237069326RNA PCR Primer, Index 1 (100% over 28bp)
TCTTTGGTTATCTAGCTGTATGTGGAATTCTCGGGTGCCAAGGAACTCCA254720.3790023869175137RNA PCR Primer, Index 1 (100% over 28bp)
AACANTCAACGCTGTCGGTGAGTTGGAATTCTCGGGTGCCAAGGAACTCC254710.3789875077408916RNA PCR Primer, Index 1 (100% over 27bp)
AACAGTCAACGCTGTCGGTGAGTTGGAATTCTCGGGTGCCAAGGAACTCC247750.3686316008119269RNA PCR Primer, Index 1 (100% over 27bp)
AAGCTGCCAGCTGAAGAACTGTTGGAATTCTCGGGTGCCAAGGAACTCCA243980.3630221512254043RNA PCR Primer, Index 1 (100% over 28bp)
ACCTTGGCTTTAGACTGCTTACTTGGAATTCTCGGGTGCCAAGGAACTCC235350.35018142180055295RNA PCR Primer, Index 1 (100% over 27bp)
TTCAAGTAATCCAGGATAGGCTGGAATTCTCGGGTGCCAAGGAACTCCAG230240.3425781625466722RNA PCR Primer, Index 1 (100% over 29bp)
TTCACAGTGGCTAAGTTCTGCTGGAATTCTCGGGTGCCAAGGAACTCCAG220480.32805608616352633RNA PCR Primer, Index 1 (100% over 29bp)
TTGCATAGTCACAAAAGTGATCTGGAATTCTCGGGTGCCAAGGAACTCCA220150.3275650733349978RNA PCR Primer, Index 1 (100% over 28bp)
TCCCTGAGACCCTAACTTGTGATGGAATTCTCGGGTGCCAAGGAACTCCA216080.321509248449813RNA PCR Primer, Index 1 (100% over 28bp)
TATTGCACTTGTCCCGGCCTGTTGGAATTCTCGGGTGCCAAGGAACTCCA206150.30673422606409173RNA PCR Primer, Index 1 (100% over 28bp)
TCACAGTGAACCGGTCTCTTTGGAATTCTCGGGTGCCAAGGAACTCCAGT202390.30113965565419126RNA PCR Primer, Index 1 (100% over 30bp)
TAAAGGGAATTTGCGACTGTTTGGAATTCTCGGGTGCCAAGGAACTCCAG200270.2979852702103112RNA PCR Primer, Index 1 (100% over 29bp)
TGGAATTCTCGGGTGCCAAGGCACTCCAGTCACGTTTCGATCTCGTATGC198910.2959617021897089RNA PCR Primer, Index 21 (98% over 50bp)
TCCAGCATCAGTGATTTTGTTGTGGAATTCTCGGGTGCCAAGGAACTCCA181220.2696404387452569RNA PCR Primer, Index 1 (100% over 28bp)
CCCTGAGACCCTTAACCTGTGATGGAATTCTCGGGTGCCAAGGAACTCCA172750.2570377761463587RNA PCR Primer, Index 1 (100% over 28bp)
TGAGATGAAGCACTGTAGCTCTTGGAATTCTCGGGTGCCAAGGAACTCCA156460.2327995974289973RNA PCR Primer, Index 1 (100% over 28bp)
TAACAGTCTACAGTCATGGCTTGGAATTCTCGGGTGCCAAGGAACTCCAG156270.23251689307317788RNA PCR Primer, Index 1 (100% over 29bp)
TTCCCTTTGTCATCCTATGCCTTGGAATTCTCGGGTGCCAAGGAACTCCA152410.22677353089705665RNA PCR Primer, Index 1 (100% over 28bp)
TGAGGTAGTAGGTTGTATAGTTTTGGAATTCTCGGGTGCCAAGGAACTCC145080.21586709443307509RNA PCR Primer, Index 1 (100% over 27bp)
TGAGNTAGTAGGTTGTATAGTTTGGAATTCTCGGGTGCCAAGGAACTCCA143760.2139030431189611RNA PCR Primer, Index 1 (100% over 28bp)
AAGCTGCCAGCTGAAGAACTTGGAATTCTCGGGTGCCAAGGAACTCCAGT140980.20976663201802406RNA PCR Primer, Index 1 (100% over 30bp)
TTCCCTTTGTCATCCTATGCCTGTGGAATTCTCGGGTGCCAAGGAACTCC139110.20698422598969587RNA PCR Primer, Index 1 (100% over 27bp)
TCTTTGGTTATCTAGCTGTATGTTGGAATTCTCGGGTGCCAAGGAACTCC137270.20424645749123393RNA PCR Primer, Index 1 (100% over 27bp)
TTCAAGTAATCCAGGATAGGCTTGGAATTCTCGGGGGCCAAGGAACTCCA134950.20079448851491236RNA PCR Primer, Index 1 (96% over 28bp)
AGCTGGTGTTGTGAATCAGGCCGTGGAATTCTCGGGTGCCAAGGAACTCC132440.19705981518277133RNA PCR Primer, Index 1 (100% over 27bp)
TCCCTGAGACCCTAACTTGTGTGGAATTCTCGGGTGCCAAGGAACTCCAG131080.19503624716216905RNA PCR Primer, Index 1 (100% over 29bp)
ACCATCGACCGTTGACTGTGCCTGGAATTCTCGGGTGCCAAGGAACTCCA126550.18829598015236873RNA PCR Primer, Index 1 (100% over 28bp)
TGAGGTAGTAGGTTGTGTGGTTTGGAATTCTCGGGTGCCAAGGAACTCCA124680.18551357412404057RNA PCR Primer, Index 1 (100% over 28bp)
TTCACAGTGGCTAAGTTCTGTGGAATTCTCGGGTGCCAAGGAACTCCAGT123640.18396613975534468RNA PCR Primer, Index 1 (100% over 30bp)
TGAGGTAGTTGGTTGTATTGTTTGGAATTCTCGGGTGCCAAGGAACTCCA123470.18371319375276937RNA PCR Primer, Index 1 (100% over 28bp)
TCCCTGAGACCCTAACTTGTGCTGGAATTCTCGGGTGCCAAGGAACTCCA121430.18067784172186593RNA PCR Primer, Index 1 (100% over 28bp)
AAGCTGCCAGTTGAAGAGCTGTTGGAATTCTCGGGTGCCAAGGAACTCCA121280.1804546540725348RNA PCR Primer, Index 1 (100% over 28bp)
TTCACCGTGGCTAAGTTCTGCTGGAATTCTCGGGTGCCAAGGAACTCCAG121240.1803951373660465RNA PCR Primer, Index 1 (100% over 29bp)
ACCGTGGCTTTAGATTGTTACTTGGAATTCTCGGGTGCCAAGGAACTCCA121190.18032074148293611RNA PCR Primer, Index 1 (100% over 28bp)
TTCAAGTAATCCAGGATAGGCTTTGGAATTCTCGGGTGCCAAGGAACTCC114910.17097661856427254RNA PCR Primer, Index 1 (100% over 27bp)
AACATTCAACGCTGTCGGTGGTGGAATTCTCGGGTGCCAAGGAACTCCAG114840.17087246432791803RNA PCR Primer, Index 1 (100% over 29bp)
AACAATCAACGCTGTCGGTGAGTGGAATTCTCGGGTGCCAAGGAACTCCA112310.16710803264253282RNA PCR Primer, Index 1 (100% over 28bp)
AGAATAATGCCAGCAGTCGGTCTGGAATTCTCGGGTGCCAAGGAACTCCA112260.16703363675942248RNA PCR Primer, Index 1 (100% over 28bp)
AACCCGTAGATCCGAACTTGTTGGAATTCTCGGGTGCCAAGGAACTCCAG109730.16326920507403728RNA PCR Primer, Index 1 (100% over 29bp)
AACATTCAACGCTGTCGGTGAGATGGAATTCTCGGGTGCCAAGGAACTCC108830.1619300791780505RNA PCR Primer, Index 1 (100% over 27bp)
CCTGTCTGAGGGTCGCTTGGAATTCTCGGGTGCCAAGGAACTCCAGTCAC105180.1564991797109928RNA PCR Primer, Index 1 (100% over 33bp)
CCTTGGCTTTAGACTGCTTACTTGGAATTCTCGGGTGCCAAGGAACTCCA100760.14992258364403535RNA PCR Primer, Index 1 (100% over 28bp)
TAAAGCTAGAGAACCGAAAGTAATGGAATTCTCGGGTGCCAAGGAACTCC100140.14900007469346666RNA PCR Primer, Index 1 (100% over 27bp)
TGAGATGAAGCACTGTAGCTCTGGAATTCTCGGGTGCCAAGGAACTCCAG99590.14818171997925247RNA PCR Primer, Index 1 (100% over 29bp)
AACATTCAACGCTGTCGGTGTTGGAATTCTCGGGTGCCAAGGAACTCCAG99470.14800316985978756RNA PCR Primer, Index 1 (100% over 29bp)
TGAGGTAGTAGTTTGTGCTGTTTTGGAATTCTCGGGTGCCAAGGAACTCC95500.1420961367408235RNA PCR Primer, Index 1 (100% over 27bp)
TCACNGTGAACCGGTCTCTTTTGGAATTCTCGGGTGCCAAGGAACTCCAG94430.14050406484226138RNA PCR Primer, Index 1 (100% over 29bp)
TCCTCCCGGGGCTACGCCTGTCTGAGGGTCGCTTGGAATTCTCGGGTGCC94340.1403701522526627No Hit
TCACGGTGAACCGGTCTCTTTTGGAATTCTCGGGTGCCAAGGAACTCCAG92170.13714137092567227RNA PCR Primer, Index 1 (100% over 29bp)
TGAGATGAAGCACTGTAGCTTGGAATTCTCGGGTGCCAAGGAACTCCAGT91490.1361295869153711RNA PCR Primer, Index 1 (100% over 30bp)
CCCTGCGACCCTTAACCTGTGATGGAATTCTCGGGTGCCAAGGAACTCCA91210.135712969969953RNA PCR Primer, Index 1 (100% over 28bp)
TTCAAGTAATCCAGGATAGGTTTGGAATTCTCGGGTGCCAAGGAACTCCA90850.13517731961155827RNA PCR Primer, Index 1 (100% over 28bp)
AACATTCAACGCTGTCGGTGAGTGGAATTCTCGGGGGCCAAGGAACTCCA90120.13409113971814673RNA PCR Primer, Index 1 (96% over 28bp)
CCCTGAGACCCTTAACCTGTGCTGGAATTCTCGGGTGCCAAGGAACTCCA89790.13360012688961823RNA PCR Primer, Index 1 (100% over 28bp)
AGCTACATCTGGCTACTGGGTCTTGGAATTCTCGGGTGCCAAGGAACTCC89580.13328766418055465RNA PCR Primer, Index 1 (100% over 27bp)
TTGCGGCCCCGGGTTCCTCCCGGGGCTACGCCTGTCTGAGGGTCGCTTGG89490.13315375159095597No Hit
AGCTACATTGTCTGCTGGGTTTTGGAATTCTCGGGTGCCAAGGAACTCCA88760.13206757169754443RNA PCR Primer, Index 1 (100% over 28bp)
ACCATCGACCGTTGACTGTGCCTTGGAATTCTCGGGTGCCAAGGAACTCC88060.13102602933399912RNA PCR Primer, Index 1 (100% over 27bp)
TGAGGTAGTAGATTGAATAGTTTGGAATTCTCGGGTGCCAAGGAACTCCA87920.13081772086129007RNA PCR Primer, Index 1 (100% over 28bp)
ACCATCGACCGTTGACTGTACCTGGAATTCTCGGGTGCCAAGGAACTCCA87450.1301183995600525RNA PCR Primer, Index 1 (100% over 28bp)
TAAGGCACGCGGTGAATGCCTGGAATTCTCGGGTGCCAAGGAACTCCAGT87210.12976129932112268RNA PCR Primer, Index 1 (100% over 30bp)
TACCCTGTAGAACCGAATTTGTTGGAATTCTCGGGTGCCAAGGAACTCCA84150.1252082712747675RNA PCR Primer, Index 1 (100% over 28bp)
CTTTGGTTATCTAGCTGTATGATGGAATTCTCGGGTGCCAAGGAACTCCA84110.1251487545682792RNA PCR Primer, Index 1 (100% over 28bp)
AACAGTCAACGCTGTCGGTGATGGAATTCTCGGGTGCCAAGGAACTCCAG82770.12315494490092105RNA PCR Primer, Index 1 (100% over 29bp)
AGCAGCATTGTACAGGGCTATGATGGAATTCTCGGGTGCCAAGGAACTCC78120.11623612777165583RNA PCR Primer, Index 1 (100% over 27bp)
TAAAGCTAGAGAACCGAAAGTATTGGAATTCTCGGGTGCCAAGGAACTCC74810.11131112030974875RNA PCR Primer, Index 1 (100% over 27bp)
TGAGGTAGTTGGTTGTATAGTTGGAATTCTCGGGTGCCAAGGAACTCCAG73570.10946610240861135RNA PCR Primer, Index 1 (100% over 29bp)
TGTAAACATCCTTGACTGGAAGCTTGGAATTCTCGGGTGCCAAGGAACTC73410.10922803558265815RNA PCR Primer, Index 1 (100% over 26bp)
TGAGGTAGTAGTTTGTGCTGTTGGAATTCTCGGGTGCCAAGGAACTCCAG71070.10574630825309242RNA PCR Primer, Index 1 (100% over 29bp)
TGAGGTAGTTGTTTGTACAGTTTGGAATTCTCGGGTGCCAAGGAACTCCA67550.10050883808212176RNA PCR Primer, Index 1 (100% over 28bp)

[FAIL]Adapter Content

Adapter graph

[FAIL]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
TACTTCA1050.046.6308671
ACCATCG39100.046.6308671
CAACAAG205.903709E-446.6308671
TAGCCTA205.903709E-446.6308671
CGAGGTA404.980393E-946.6308671
TATTACA2600.046.6308671
CATAATC205.903709E-446.6308671
AGTAGAG5550.046.6308671
TCCCATA2750.046.6308671
TGTACCC359.168616E-846.6308671
AGCAGAG205.903709E-446.6308671
TACGTCC205.903709E-446.6308671
TAATATC253.1545715E-546.6308631
ACCGCGG253.1545715E-546.6308631
TCCCTAT253.1545715E-546.6308631
ACCGAGG452.7102942E-1046.6308631
TTCCGTT1950.046.6308631
TTCAAGC253.1545715E-546.6308631
TCAGGCG550.046.6308631
ACCTAGG900.046.6308631