FastQCFastQC Report
Mon 5 Dec 2016
JM82_3_AGTCAA_L007_R1_001.fastq

Summary

[OK]Basic Statistics

MeasureValue
FilenameJM82_3_AGTCAA_L007_R1_001.fastq
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences14965556
Sequences flagged as poor quality0
Sequence length50
%GC51

[OK]Per base sequence quality

Per base quality graph

[OK]Per tile sequence quality

Per base quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[FAIL]Per base sequence content

Per base sequence content

[FAIL]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[OK]Sequence Length Distribution

Sequence length distribution

[FAIL]Sequence Duplication Levels

Duplication level graph

[FAIL]Overrepresented sequences

SequenceCountPercentagePossible Source
TGGAATTCTCGGGTGCCAAGGAACTCCAGTCACAGTCAAATCTCGTATGC672327444.92498641547297RNA PCR Primer, Index 13 (100% over 50bp)
TGGAGTGTGACAATGGTGTTTGTGGAATTCTCGGGTGCCAAGGAACTCCA1646621.1002731873109157RNA PCR Primer, Index 1 (100% over 28bp)
TTCAAGTAATCCAGGATAGGCTTGGAATTCTCGGGTGCCAAGGAACTCCA1373150.917540250425711RNA PCR Primer, Index 1 (100% over 28bp)
ATGACCTATGAATTGACAGCCATGGAATTCTCGGGTGCCAAGGAACTCCA1057450.7065891838565838RNA PCR Primer, Index 1 (100% over 28bp)
AAGCTGCCAGCTGAAGAACTGTTGGAATTCTCGGGTGCCAAGGAACTCCA1042040.6962922059160381RNA PCR Primer, Index 1 (100% over 28bp)
ATGACCTATGAATTGACAGCCTGGAATTCTCGGGTGCCAAGGAACTCCAG964490.6444732156960957RNA PCR Primer, Index 1 (100% over 29bp)
GTTCTACAGTCCGACTGGAATTCTCGGGTGCCAAGGAACTCCAGTCACAG960590.641867231661824RNA PCR Primer, Index 2 (97% over 35bp)
TGAGGTAGTAGGTTGTATAGTTTGGAATTCTCGGGTGCCAAGGAACTCCA835490.5582752822547989RNA PCR Primer, Index 1 (100% over 28bp)
GCATTGGTGGTTCAGTGGTAGAATTCTCGCCTTGGAATTCTCGGGTGCCA795890.5318145212914241No Hit
GTTGGGCGCCATGGAATTCTCGGGTGCCAAGGAACTCCAGTCACAGTCAA793940.5305115292742882RNA PCR Primer, Index 13 (100% over 39bp)
TCCCTGGTGGTCTAGTGGTTAGGATTCGGCGCTCTGGAATTCTCGGGTGC770560.5148889890893462No Hit
GCCCGGCTAGCTCAGTCGGTAGAGCATGAGACTCTTAATCTTGGAATTCT721990.48243446484714636No Hit
TAGCTTATCAGACTGGTGTTGGCTGGAATTCTCGGGTGCCAAGGAACTCC688120.4598024958110477RNA PCR Primer, Index 1 (100% over 27bp)
CTACAGTCCGACGATCTGGAATTCTCGGGTGCCAAGGAACTCCAGTCACA665690.4448147466088129RNA PCR Primer, Index 1 (100% over 34bp)
ACCACGTTCCCGTGGTGGAATTCTCGGGTGCCAAGGAACTCCAGTCACAG664930.4443069138226471RNA PCR Primer, Index 2 (97% over 35bp)
TATTGCACTTGTCCCGGCCTGTTGGAATTCTCGGGTGCCAAGGAACTCCA637790.42617193774825335RNA PCR Primer, Index 1 (100% over 28bp)
TGGAGTGTGACAATGGTGTTTTGGAATTCTCGGGTGCCAAGGAACTCCAG616180.41173211339425014RNA PCR Primer, Index 1 (100% over 29bp)
TGGAGTGTGACAATGGTGTTTGTTGGAATTCTCGGGTGCCAAGGAACTCC568760.38004602034164314RNA PCR Primer, Index 1 (100% over 27bp)
GCATTGGTGGTTCAGTGGTAGAATTCTCGCCTGGAATTCTCGGGTGCCAA546870.36541909969799985No Hit
CCTGTCTGAGGGTCGCTTGGAATTCTCGGGTGCCAAGGAACTCCAGTCAC497780.3326171109178971RNA PCR Primer, Index 1 (100% over 33bp)
TCAGTAACTGGAATCTGTCCCTTGGAATTCTCGGGTGCCAAGGAACTCCA478030.3194201404879311RNA PCR Primer, Index 1 (100% over 28bp)
CACCACGTTCCCGTGGTGGAATTCTCGGGTGCCAAGGAACTCCAGTCACA477970.31938004842586537RNA PCR Primer, Index 1 (100% over 34bp)
TCCCTGTGGTCTAGTGGTTAGGATTCGGCGCTCTGGAATTCTCGGGTGCC474430.31701461676398796No Hit
AACATTCAACGCTGTCGGTGAGTTGGAATTCTCGGGTGCCAAGGAACTCC447990.2993473814136942RNA PCR Primer, Index 1 (100% over 27bp)
GTTTCCGTAGTGTAGTGGTTATCACGTTCGCCTTGGAATTCTCGGGTGCC447280.29887295867924984No Hit
TCTACAGTCCGACGATCTGGAATTCTCGGGTGCCAAGGAACTCCAGTCAC434360.2902398013144316RNA PCR Primer, Index 1 (100% over 33bp)
TAACGGAACCCATAATGCAGCTGTGGAATTCTCGGGTGCCAAGGAACTCC430150.287426674959487RNA PCR Primer, Index 1 (100% over 27bp)
AACATTCAACGCTGTCGGTGAGTGGAATTCTCGGGTGCCAAGGAACTCCA422020.28199420054958196RNA PCR Primer, Index 1 (100% over 28bp)
AGTTCTACAGTCCGACGATCTGGAATTCTCGGGTGCCAAGGAACTCCAGT418880.279896049301476RNA PCR Primer, Index 1 (100% over 30bp)
ACTGTATAAGGTACATATGGTTGAGTGTCGTATGGAATTCTCGGGTGCCA413750.276468177994857No Hit
TGAGATGAAGCACTGTAGCTCTTGGAATTCTCGGGTGCCAAGGAACTCCA409050.2733276331330423RNA PCR Primer, Index 1 (100% over 28bp)
GGACAACTCTTAGCGGTGGAATTCTCGGGTGCCAAGGAACTCCAGTCACA407690.2724188797262193RNA PCR Primer, Index 1 (100% over 34bp)
TTGCGGCCCCGGGTTCCTCCCGGGGCTACGCCTGTCTGAGGGTCGCTTGG404850.27052118878844195No Hit
GATCCATGATGACATTAAAACATAACGTGACTGTTGGATGAAGCTTGCGG389640.26035785105478204No Hit
TGAGATGAAGCACTGTAGCTCTGGAATTCTCGGGTGCCAAGGAACTCCAG370140.24732793088342325RNA PCR Primer, Index 1 (100% over 29bp)
ACAGTCCGACGATCTGGAATTCTCGGGTGCCAAGGAACTCCAGTCACAGT364820.24377310138026276RNA PCR Primer, Index 8 (97% over 36bp)
ATCCATGATGACATTAAAACATAACGTGACTGTTGGATGAAGCTTGCGGA363590.24295121410791554No Hit
TGGAATTCTCGGGTGCCAGGAACTCCAGTCACAGTCAAATCTCGTATGCC356710.2383539909910464RNA PCR Primer, Index 13 (97% over 35bp)
GCATTGGTGGTTCAGTGGTAGAATTCTCTGGAATTCTCGGGTGCCAAGGA349610.23360976364660294RNA PCR Primer, Index 1 (100% over 22bp)
TGGACAACTCTTAGCGGTGGAATTCTCGGGTGCCAAGGAACTCCAGTCAC339260.2266938829402663RNA PCR Primer, Index 1 (100% over 33bp)
GTTCTACAGTCCGACGTGGAATTCTCGGGTGCCAAGGAACTCCAGTCACA325910.21777339913064375RNA PCR Primer, Index 1 (100% over 34bp)
TCCCATATGGTCTAGCGGTTAGGATTCCTTGGAATTCTCGGGTGCCAAGG321670.21494022674466623Illumina Small RNA Adapter 2 (100% over 21bp)
CATGGAATTCTCGGGTGCCAAGGAACTCCAGTCACAGTCAAATCTCGTAT320870.2144056659171233RNA PCR Primer, Index 13 (100% over 48bp)
TTCAAGTAATCCAGGATAGGTTTGGAATTCTCGGGTGCCAAGGAACTCCA310870.2077236555728367RNA PCR Primer, Index 1 (100% over 28bp)
TTCAGTGATGTTTGACAAATGTCTGACCTGAACTGCAATGTGGACAGATC306120.2045497006593006No Hit
GTCTTTGCTGCGAGCCTGGAATTCTCGGGTGCCAAGGAACTCCAGTCACA305360.2040418678731348RNA PCR Primer, Index 1 (100% over 34bp)
TTCTACAGTCCGACGATCTGGAATTCTCGGGTGCCAAGGAACTCCAGTCA304250.203300164724919RNA PCR Primer, Index 1 (100% over 32bp)
TGGACGTGATGAGCAGGTGTTACCGCCCCAGTCTGATGTTTGGTGACTGA303050.2024983234836046No Hit
GCATTGTGGTTCAGTGGTAGAATTCTCGCCTTGGAATTCTCGGGTGCCAA292080.19516815813592225No Hit
TACAGTCCGACGATCTGGAATTCTCGGGTGCCAAGGAACTCCAGTCACAG287830.19232830373960044RNA PCR Primer, Index 2 (97% over 35bp)
CTCGTCGCCATGGAATTCTCGGGTGCCAAGGAACTCCAGTCACAGTCAAA281560.18813868325373279RNA PCR Primer, Index 13 (100% over 40bp)
TGTAAACATCCTACACTCTCAGCTTGGAATTCTCGGGTGCCAAGGAACTC279120.18650827272972686RNA PCR Primer, Index 1 (100% over 26bp)
TAGTTCTACAGTCCGACGATCTGGAATTCTCGGGTGCCAAGGAACTCCAG250510.16739104113472295RNA PCR Primer, Index 1 (100% over 29bp)
CAGAGTTCTACAGTCCGACGATCTGGAATTCTCGGGTGCCAAGGAACTCC237770.15887815995610188RNA PCR Primer, Index 1 (100% over 27bp)
TCAGTAACTGGAATCTGTCCCTGTGGAATTCTCGGGTGCCAAGGAACTCC226780.15153463058773092RNA PCR Primer, Index 1 (100% over 27bp)
GTTTCCGTAGTGTAGTGGTTATCACGTTCGCCTGACACGTGGAATTCTCG223300.14920929098791919No Hit
TGGAATTCTCGGGTGCCAAGGAAATCCAGTCACAGTCAAATCTCGTATGC222200.14847426985004766RNA PCR Primer, Index 13 (98% over 50bp)
AGAGATGATGACTTCTGTTACCGCCCCAGTCTGAGAAGTCATGACTGATC221330.14789293495009473No Hit
TAGCTTATCAGACTGGTGTTGGTGGAATTCTCGGGTGCCAAGGAACTCCA217590.14539386308133156RNA PCR Primer, Index 1 (100% over 28bp)
AGCCTGTGATGATACAAGTTATCCCTGTCTGAACTCTGGTGTGGAATTCT217090.14505976256411723No Hit
AGAGTTCTACAGTCCGACGATCTGGAATTCTCGGGTGCCAAGGAACTCCA215470.1439772768883428RNA PCR Primer, Index 1 (100% over 28bp)
TGAGGTAGTAGTTTGTATAGTTTGGAATTCTCGGGTGCCAAGGAACTCCA215190.1437901805987028RNA PCR Primer, Index 1 (100% over 28bp)
TGGAATTCTCGGTGCCAAGGAACTCCAGTCACAGTCAAATCTCGTATGCC210730.14081000398515098RNA PCR Primer, Index 13 (97% over 41bp)
GCATTGTGGTTCAGTGGTAGAATTCTCGCCTGGAATTCTCGGGTGCCAAG209160.13976092836109796No Hit
TCTGACACCATGGAATTCTCGGGTGCCAAGGAACTCCAGTCACAGTCAAA195580.1306867583135568RNA PCR Primer, Index 13 (100% over 40bp)
TGAGAACTGAATTCCATAGATGGTGGAATTCTCGGGTGCCAAGGAACTCC191980.12828123458961366RNA PCR Primer, Index 1 (100% over 27bp)
TGTAAACATCCTTGACTGGAAGCTTGGAATTCTCGGGTGCCAAGGAACTC189160.12639690767252484RNA PCR Primer, Index 1 (100% over 26bp)
GTTCTACAGTCCGACTGGAATTCTCGGGTGCCCAGGAACTCCAGTCACAG187600.12535451405881615RNA PCR Primer, Index 13 (97% over 35bp)
CCGTCGAGCAGCATTCCGGGCTTCACATCGGAGGGCTCCAGCCGGCCCCG184650.12338332100725158No Hit
TCGGGCGCCATGGAATTCTCGGGTGCCAAGGAACTCCAGTCACAGTCAAA181720.12142549197637562RNA PCR Primer, Index 13 (100% over 40bp)
CGGGCCACCATGGAATTCTCGGGTGCCAAGGAACTCCAGTCACAGTCAAA178540.11930061268689247RNA PCR Primer, Index 13 (100% over 40bp)
GTTTCCGTAGTGTAGTGGTTATCACGTTCGCCTCTGGAATTCTCGGGTGC176160.11771029422495227No Hit
TAACACTGTCTGGTAACGATGTTGGAATTCTCGGGTGCCAAGGAACTCCA164490.10991238815316985RNA PCR Primer, Index 1 (100% over 28bp)
TGGAATTCTCGGGTGCAAGGAACTCCAGTCACAGTCAAATCTCGTATGCC163870.10949810351182408RNA PCR Primer, Index 13 (100% over 35bp)
TGTAACAGCAACTCCATGTGGATGGAATTCTCGGGTGCCAAGGAACTCCA159590.10663820308446942RNA PCR Primer, Index 1 (100% over 28bp)
TGCCTGTGATGAGACTCTCGACGGGCGGACTGAATGGGTTTTCACCCTCC158960.10621723643277937No Hit
GCCCGGCTAGCTCAGTCGGTAGAGCATGAGACTCTGGAATTCTCGGGTGC158070.10562253751213786No Hit
TCCCTGGTGGTCTAGTGGTTAGGATTCGGCGCTTGGAATTCTCGGGTGCC151090.10095849429182585No Hit

[WARN]Adapter Content

Adapter graph

[FAIL]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
CTATACA2200.044.0502471
ACCCTGC207.815469E-444.0502471
GCATTGA408.240022E-944.0502471
TCGTACG302.525674E-644.0103543
ATAACTA3950.044.0016722
CTACTAT302.5292775E-644.00123617
CTAGGTA650.044.0010916
ATAGGCG600.044.00108716
ATAGATA1000.044.00108716
CGTTAGG950.044.00108716
GCCAGTA3250.044.00108716
ATCGCGT454.802132E-1044.0003540
AATCGCG408.3255145E-943.9993239
AAATCGC502.7284841E-1143.99785238
ACCTTCG950.043.99785224
GGCACTA207.8614097E-443.9978525
GCAACTT302.5306163E-643.9978524
CCATTCG302.5306163E-643.9978525
AGCAATT254.4468714E-543.9975614
ATATTAG408.3273335E-943.9975614