FastQCFastQC Report
Mon 5 Dec 2016
JM85_3_ATGTCA_L008_R1_001.fastq

Summary

[OK]Basic Statistics

MeasureValue
FilenameJM85_3_ATGTCA_L008_R1_001.fastq
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences18907229
Sequences flagged as poor quality0
Sequence length50
%GC50

[OK]Per base sequence quality

Per base quality graph

[OK]Per tile sequence quality

Per base quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[FAIL]Per base sequence content

Per base sequence content

[FAIL]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[OK]Sequence Length Distribution

Sequence length distribution

[FAIL]Sequence Duplication Levels

Duplication level graph

[FAIL]Overrepresented sequences

SequenceCountPercentagePossible Source
TGGAATTCTCGGGTGCCAAGGAACTCCAGTCACATGTCAATCTCGTATGC505049526.711978788642167RNA PCR Primer, Index 15 (100% over 50bp)
ATGACCTATGAATTGACAGCCTGGAATTCTCGGGTGCCAAGGAACTCCAG8343964.413105696239254RNA PCR Primer, Index 1 (100% over 29bp)
ATGACCTATGAATTGACAGCCATGGAATTCTCGGGTGCCAAGGAACTCCA7631624.036350329284106RNA PCR Primer, Index 1 (100% over 28bp)
TAGCTTATCAGACTGGTGTTGGCTGGAATTCTCGGGTGCCAAGGAACTCC4454292.355866108143081RNA PCR Primer, Index 1 (100% over 27bp)
TTCAAGTAATCCAGGATAGGCTTGGAATTCTCGGGTGCCAAGGAACTCCA3808902.0145204778553216RNA PCR Primer, Index 1 (100% over 28bp)
TGAGGTAGTAGGTTGTATAGTTTGGAATTCTCGGGTGCCAAGGAACTCCA3424191.8110480388215535RNA PCR Primer, Index 1 (100% over 28bp)
TATTGCACTTGTCCCGGCCTGTTGGAATTCTCGGGTGCCAAGGAACTCCA2737731.4479805581240912RNA PCR Primer, Index 1 (100% over 28bp)
AAGCTGCCAGCTGAAGAACTGTTGGAATTCTCGGGTGCCAAGGAACTCCA2552531.350028605460906RNA PCR Primer, Index 1 (100% over 28bp)
AACATTCAACGCTGTCGGTGAGTTGGAATTCTCGGGTGCCAAGGAACTCC2067691.0935975864046499RNA PCR Primer, Index 1 (100% over 27bp)
AACATTCAACGCTGTCGGTGAGTGGAATTCTCGGGTGCCAAGGAACTCCA1984741.0497254780169003RNA PCR Primer, Index 1 (100% over 28bp)
CCTGTCTGAGGGTCGCTTGGAATTCTCGGGTGCCAAGGAACTCCAGTCAC1935821.0238517764818948RNA PCR Primer, Index 1 (100% over 33bp)
CATGGAATTCTCGGGTGCCAAGGAACTCCAGTCACATGTCAATCTCGTAT1434680.7587997162355203RNA PCR Primer, Index 15 (100% over 48bp)
ACCACGTTCCCGTGGTGGAATTCTCGGGTGCCAAGGAACTCCAGTCACAT1238880.6552414423075956RNA PCR Primer, Index 1 (100% over 35bp)
TGAGATGAAGCACTGTAGCTCTTGGAATTCTCGGGTGCCAAGGAACTCCA1220020.6452664216422195RNA PCR Primer, Index 1 (100% over 28bp)
TAACGGAACCCATAATGCAGCTGTGGAATTCTCGGGTGCCAAGGAACTCC1199130.6342177375648225RNA PCR Primer, Index 1 (100% over 27bp)
TAACACTGTCTGGTAACGATGTTGGAATTCTCGGGTGCCAAGGAACTCCA1173330.6205721631657394RNA PCR Primer, Index 1 (100% over 28bp)
TGTAACAGCAACTCCATGTGGATGGAATTCTCGGGTGCCAAGGAACTCCA1100350.5819731701562403RNA PCR Primer, Index 1 (100% over 28bp)
TGAGATGAAGCACTGTAGCTCTGGAATTCTCGGGTGCCAAGGAACTCCAG1076460.5693377913812754RNA PCR Primer, Index 1 (100% over 29bp)
TTCAAGTAATCCAGGATAGGTTTGGAATTCTCGGGTGCCAAGGAACTCCA1022280.540682085143201RNA PCR Primer, Index 1 (100% over 28bp)
TGGAGTGTGACAATGGTGTTTGTGGAATTCTCGGGTGCCAAGGAACTCCA1007380.5328015014786144RNA PCR Primer, Index 1 (100% over 28bp)
TGTAAACATCCTTGACTGGAAGCTTGGAATTCTCGGGTGCCAAGGAACTC977780.5171461137959454RNA PCR Primer, Index 1 (100% over 26bp)
TTGCGGCCCCGGGTTCCTCCCGGGGCTACGCCTGTCTGAGGGTCGCTTGG976400.5164162342350642No Hit
TGTAAACATCCTACACTCTCAGCTTGGAATTCTCGGGTGCCAAGGAACTC963080.5093713097778633RNA PCR Primer, Index 1 (100% over 26bp)
TCCCTGGTGGTCTAGTGGTTAGGATTCGGCGCTCTGGAATTCTCGGGTGC879390.46510781669804707No Hit
TACCCTGTAGATCCGGATTTGTTGGAATTCTCGGGTGCCAAGGAACTCCA799700.42295991654832127RNA PCR Primer, Index 1 (100% over 28bp)
GCATTGGTGGTTCAGTGGTAGAATTCTCGCCTTGGAATTCTCGGGTGCCA792320.41905664759230454No Hit
TAGCTTATCAGACTGGTGTTGGTGGAATTCTCGGGTGCCAAGGAACTCCA788740.41716319191987367RNA PCR Primer, Index 1 (100% over 28bp)
TGAGAACTGAATTCCATAGATGGTGGAATTCTCGGGTGCCAAGGAACTCC775520.4101711572859249RNA PCR Primer, Index 1 (100% over 27bp)
GTTCTACAGTCCGACTGGAATTCTCGGGTGCCAAGGAACTCCAGTCACAT664420.35141056365266427RNA PCR Primer, Index 1 (100% over 35bp)
TAACACTGTCTGGTAACGATGTGGAATTCTCGGGTGCCAAGGAACTCCAG657920.34797272514126737RNA PCR Primer, Index 1 (100% over 29bp)
CACCACGTTCCCGTGGTGGAATTCTCGGGTGCCAAGGAACTCCAGTCACA585920.3098920523996404RNA PCR Primer, Index 1 (100% over 34bp)
CTACAGTCCGACGATCTGGAATTCTCGGGTGCCAAGGAACTCCAGTCACA576980.30516370220088834RNA PCR Primer, Index 1 (100% over 34bp)
TACCCTGTAGATCCGGATTTGTGTGGAATTCTCGGGTGCCAAGGAACTCC561160.2967965321623809RNA PCR Primer, Index 1 (100% over 27bp)
TGAGGTAGTAGTTTGTATAGTTTGGAATTCTCGGGTGCCAAGGAACTCCA561060.2967436423391286RNA PCR Primer, Index 1 (100% over 28bp)
TATTGCACTTGTCCCGGCCTGTTTGGAATTCTCGGGTGCCAAGGAACTCC547790.28972516279355376RNA PCR Primer, Index 1 (100% over 27bp)
TCCCTGTGGTCTAGTGGTTAGGATTCGGCGCTCTGGAATTCTCGGGTGCC533450.28214076213917966No Hit
TAGCAGCACGTAAATATTGGAGTGGAATTCTCGGGTGCCAAGGAACTCCA526940.27869763464545755RNA PCR Primer, Index 1 (100% over 28bp)
TGGAGTGTGACAATGGTGTTTTGGAATTCTCGGGTGCCAAGGAACTCCAG457470.24195507443211273RNA PCR Primer, Index 1 (100% over 29bp)
CATTGCACTTGTCTCGGTCTGATGGAATTCTCGGGTGCCAAGGAACTCCA451310.23869706131977353RNA PCR Primer, Index 1 (100% over 28bp)
GGACAACTCTTAGCGGTGGAATTCTCGGGTGCCAAGGAACTCCAGTCACA443230.23442356360099093RNA PCR Primer, Index 1 (100% over 34bp)
TGAGGTAGTAGATTGAATAGTTTGGAATTCTCGGGTGCCAAGGAACTCCA443050.23432836191913686RNA PCR Primer, Index 1 (100% over 28bp)
AACATTCAACGCTGTCGGTGATGGAATTCTCGGGTGCCAAGGAACTCCAG438860.23211227832486717RNA PCR Primer, Index 1 (100% over 29bp)
CTGTCTGAGGGTCGCTTGGAATTCTCGGGTGCCAAGGAACTCCAGTCACA430900.2279022483939873RNA PCR Primer, Index 1 (100% over 34bp)
CATTATTACTTTTGGTACGCGTGGAATTCTCGGGTGCCAAGGAACTCCAG422750.22359172779892814RNA PCR Primer, Index 1 (100% over 29bp)
CTACGCCTGTCTGAGGGTCGCTTGGAATTCTCGGGTGCCAAGGAACTCCA411720.21775798029420387RNA PCR Primer, Index 1 (100% over 28bp)
TCTACAGTCCGACGATCTGGAATTCTCGGGTGCCAAGGAACTCCAGTCAC402960.21312483177730593RNA PCR Primer, Index 1 (100% over 33bp)
TGGAGTGTGACAATGGTGTTTGTTGGAATTCTCGGGTGCCAAGGAACTCC394070.20842292649018002RNA PCR Primer, Index 1 (100% over 27bp)
CCACGTTCCCGTGGTGGAATTCTCGGGTGCCAAGGAACTCCAGTCACATG393290.20801038586881238RNA PCR Primer, Index 15 (100% over 36bp)
TGTCTGAGGGTCGCTTGGAATTCTCGGGTGCCAAGGAACTCCAGTCACAT388390.20541878452945164RNA PCR Primer, Index 1 (100% over 35bp)
AGTTCTACAGTCCGACGATCTGGAATTCTCGGGTGCCAAGGAACTCCAGT387460.20492690917320566RNA PCR Primer, Index 1 (100% over 30bp)
TGGACAACTCTTAGCGGTGGAATTCTCGGGTGCCAAGGAACTCCAGTCAC378390.2001298022042257RNA PCR Primer, Index 1 (100% over 33bp)
TCAGTAACTGGAATCTGTCCCTTGGAATTCTCGGGTGCCAAGGAACTCCA369070.1952004706771151RNA PCR Primer, Index 1 (100% over 28bp)
TACCCTGTAGAACCGAATTTGTTGGAATTCTCGGGTGCCAAGGAACTCCA366240.19370368867907614RNA PCR Primer, Index 1 (100% over 28bp)
ATGACCTATGAATTGACAGCCATTGGAATTCTCGGGTGCCAAGGAACTCC364970.19303198792377244RNA PCR Primer, Index 1 (100% over 27bp)
ACAGTCCGACGATCTGGAATTCTCGGGTGCCAAGGAACTCCAGTCACATG359230.18999611206909273RNA PCR Primer, Index 15 (100% over 36bp)
TGAGGTAGTAGGTTGTATAGTTTTGGAATTCTCGGGTGCCAAGGAACTCC353530.18698139214371393RNA PCR Primer, Index 1 (100% over 27bp)
ATGACCTATGAATTGACAGCCTTGGAATTCTCGGGTGCCAAGGAACTCCA341240.1804812328660112RNA PCR Primer, Index 1 (100% over 28bp)
TGAGGTAGTAGGTTGTATAGTTGGAATTCTCGGGTGCCAAGGAACTCCAG337160.17832332807731902RNA PCR Primer, Index 1 (100% over 29bp)
TGAGGTAGTAGGTTGTGTGGTTTGGAATTCTCGGGTGCCAAGGAACTCCA330270.1746792192552383RNA PCR Primer, Index 1 (100% over 28bp)
TGTAACAGCAACTCCATGTGGAATGGAATTCTCGGGTGCCAAGGAACTCC324800.17178614592333968RNA PCR Primer, Index 1 (100% over 27bp)
TTCTACAGTCCGACGATCTGGAATTCTCGGGTGCCAAGGAACTCCAGTCA312760.16541821120376762RNA PCR Primer, Index 1 (100% over 32bp)
TGTAAACATCCTACACTCAGCTTGGAATTCTCGGGTGCCAAGGAACTCCA310700.16432868084477106RNA PCR Primer, Index 1 (100% over 28bp)
TGAGAACTGAATTCCATAGATGTGGAATTCTCGGGTGCCAAGGAACTCCA308610.16322328353879884RNA PCR Primer, Index 1 (100% over 28bp)
GCATTGTGGTTCAGTGGTAGAATTCTCGCCTTGGAATTCTCGGGTGCCAA299150.15821990625913507No Hit
TAACACTGTCTGGTAACGATGTTTGGAATTCTCGGGTGCCAAGGAACTCC295490.15628413872810235RNA PCR Primer, Index 1 (100% over 27bp)
TACAGTCCGACGATCTGGAATTCTCGGGTGCCAAGGAACTCCAGTCACAT283150.1497575345387735RNA PCR Primer, Index 1 (100% over 35bp)
TGTAAACATCCTTGACTGGAAGCTGGAATTCTCGGGTGCCAAGGAACTCC281460.1488636965258103RNA PCR Primer, Index 1 (100% over 27bp)
TATTGCACTTGTCCCGGCCTGTATGGAATTCTCGGGTGCCAAGGAACTCC280440.14832422032863726RNA PCR Primer, Index 1 (100% over 27bp)
TGAGATGAAGCACTGTAGCTTGGAATTCTCGGGTGCCAAGGAACTCCAGT277850.14695437390640373RNA PCR Primer, Index 1 (100% over 30bp)
ATGACCTATGAATTGACAGCTGGAATTCTCGGGTGCCAAGGAACTCCAGT274180.14501331739304582RNA PCR Primer, Index 1 (100% over 30bp)
TCACAGTGAACCGGTCTCTTTTGGAATTCTCGGGTGCCAAGGAACTCCAG271980.1438497412814961RNA PCR Primer, Index 1 (100% over 29bp)
TAGTTCTACAGTCCGACGATCTGGAATTCTCGGGTGCCAAGGAACTCCAG271440.1435641362359339RNA PCR Primer, Index 1 (100% over 29bp)
TTCACAGTGGTTAAGTTCTGTGGAATTCTCGGGTGCCAAGGAACTCCAGT264410.13984598166130002RNA PCR Primer, Index 1 (100% over 30bp)
AGCCTGTGATGATACAAGTTATCCCTGTCTGAACTCTGGTGTGGAATTCT256210.13550901615461472No Hit
TGGAATTCTCGGGTGCCAAGGAACTCCAGTCACATGGCAATCTCGTATGC253110.13386943163379467RNA PCR Primer, Index 15 (98% over 50bp)
TCGTACCGTGAGTAATAATGCATGGAATTCTCGGGTGCCAAGGAACTCCA249880.1321610903427467RNA PCR Primer, Index 1 (100% over 28bp)
ACAGTAGTCTGCACATTGGTTTGGAATTCTCGGGTGCCAAGGAACTCCAG245690.12994500674847698RNA PCR Primer, Index 1 (100% over 29bp)
TTCACAGTGGCTAAGTTCTGTGGAATTCTCGGGTGCCAAGGAACTCCAGT243960.1290300128062129RNA PCR Primer, Index 1 (100% over 30bp)
GTTCTACAGTCCGACGTGGAATTCTCGGGTGCCAAGGAACTCCAGTCACA237520.12562390818876737RNA PCR Primer, Index 1 (100% over 34bp)
CAGAGTTCTACAGTCCGACGATCTGGAATTCTCGGGTGCCAAGGAACTCC236590.12513203283252136RNA PCR Primer, Index 1 (100% over 27bp)
TTCCAGTGATGACAGCCTATAATCTGACTTGGAATTCTCGGGTGCCAAGG231080.12221780357132184Illumina Small RNA Adapter 2 (100% over 21bp)
TATTGCACTTGTCCCGGCCTGTTTTGGAATTCTCGGGTGCCAAGGAACTC230710.12202211122528848RNA PCR Primer, Index 1 (100% over 26bp)
GTTGGGCGCCATGGAATTCTCGGGTGCCAAGGAACTCCAGTCACATGTCA230320.12181584091460466RNA PCR Primer, Index 15 (100% over 39bp)
TGTAAACATCCTACACTCTCAGCTGGAATTCTCGGGTGCCAAGGAACTCC224710.1188487218301529RNA PCR Primer, Index 1 (100% over 27bp)
TTCAAGTAATCCAGGATAGGTGGAATTCTCGGGTGCCAAGGAACTCCAGT223290.11809768633997081RNA PCR Primer, Index 1 (100% over 30bp)
TGTAAACATCCCCGACTGGAAGCTGGAATTCTCGGGTGCCAAGGAACTCC218680.11565946548804164RNA PCR Primer, Index 1 (100% over 27bp)
CTGGACAACTCTTAGCGGTGGAATTCTCGGGTGCCAAGGAACTCCAGTCA217210.11488198508623343RNA PCR Primer, Index 1 (100% over 32bp)
TGGAATTCTCGGGTGCCAGGAACTCCAGTCACATGTCAATCTCGTATGCC216440.11447473344719103RNA PCR Primer, Index 15 (97% over 35bp)
TTCACAGTGGCTAAGTTCTGCTGGAATTCTCGGGTGCCAAGGAACTCCAG215070.11375014286863507RNA PCR Primer, Index 1 (100% over 29bp)
TGTAAACATCCCCGACTGGAAGCTTGGAATTCTCGGGTGCCAAGGAACTC210890.11153934825669061RNA PCR Primer, Index 1 (100% over 26bp)
AGAGTTCTACAGTCCGACGATCTGGAATTCTCGGGTGCCAAGGAACTCCA209290.11069311108465445RNA PCR Primer, Index 1 (100% over 28bp)
TCCTCCCGGGGCTACGCCTGTCTGAGGGTCGCTTGGAATTCTCGGGTGCC209260.11067724413767878No Hit
TAATACTGTCTGGTAATGCCGTGGAATTCTCGGGTGCCAAGGAACTCCAG208660.11035990519816521RNA PCR Primer, Index 1 (100% over 29bp)
TTCACAGTGGTTAAGTTCTGCCTGGAATTCTCGGGTGCCAAGGAACTCCA202570.1071389149621026RNA PCR Primer, Index 1 (100% over 28bp)
TCCAGTGATGACAGCCTATAATCTGACTTGGAATTCTCGGGTGCCAAGGA197780.10460549242831935RNA PCR Primer, Index 1 (100% over 22bp)
TATTGCACTTGTCCCGGCCTGTATTGGAATTCTCGGGTGCCAAGGAACTC193780.10248989949822895RNA PCR Primer, Index 1 (100% over 26bp)
TCGTACCGTGAGTAATAATGCTGGAATTCTCGGGTGCCAAGGAACTCCAG192080.10159077250294053RNA PCR Primer, Index 1 (100% over 29bp)
TTCAAGTAATCCAGGATAGGCTGGAATTCTCGGGTGCCAAGGAACTCCAG190740.10088204887136026RNA PCR Primer, Index 1 (100% over 29bp)
TTCAAGTAATCCAGGATAGGCTTTGGAATTCTCGGGTGCCAAGGAACTCC189910.10044306333836651RNA PCR Primer, Index 1 (100% over 27bp)

[FAIL]Adapter Content

Adapter graph

[WARN]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
TTGTAAG207.8224443E-444.0423281
CGTACGC551.8189894E-1244.01972644
AACATTC548500.044.0102121
CTATAGG9100.044.0012112
ATTTGAG650.044.0012113
TACGCGA1400.044.001116
TATAGTA1750.044.001116
ATAGATA4100.044.00109516
TAGGCAA1050.044.00109517
CGACCTA408.3291525E-943.9974862
GATATGT1300.043.9974862
CATGCGA4250.043.99667425
ATCTACT302.5312565E-643.9963268
GTACATA207.862808E-443.99632311
GATATAT1050.043.99632311
AATCGAC254.4476525E-543.99632311
TATCCTA254.4476525E-543.9963239
CATAGTC1200.043.9962124
GGAGTAG1200.043.9962125
CATACCG850.043.99621220