FastQCFastQC Report
Mon 5 Dec 2016
JM97_3_TGACCA_L006_R1_001.fastq

Summary

[OK]Basic Statistics

MeasureValue
FilenameJM97_3_TGACCA_L006_R1_001.fastq
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences12040747
Sequences flagged as poor quality0
Sequence length50
%GC52

[OK]Per base sequence quality

Per base quality graph

[WARN]Per tile sequence quality

Per base quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[FAIL]Per base sequence content

Per base sequence content

[FAIL]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[OK]Sequence Length Distribution

Sequence length distribution

[FAIL]Sequence Duplication Levels

Duplication level graph

[FAIL]Overrepresented sequences

SequenceCountPercentagePossible Source
TGGAATTCTCGGGTGCCAAGGAACTCCAGTCACTGACCAATCTCGTATGC652805054.21632063193421RNA PCR Primer, Index 4 (100% over 50bp)
TGGAGTGTGACAATGGTGTTTGTGGAATTCTCGGGTGCCAAGGAACTCCA1599001.3279906969227075RNA PCR Primer, Index 1 (100% over 28bp)
GCATTGGTGGTTCAGTGGTAGAATTCTCGCCTTGGAATTCTCGGGTGCCA1349021.1203789930973551No Hit
CCGTCGAGCAGCATTCCGGGCTTCACATCGGAGGGCTCCAGCCGGCCCCG1056700.8776033579976392No Hit
TTGCGGCCCCGGGTTCCTCCCGGGGCTACGCCTGTCTGAGGGTCGCTTGG1036240.8606110567724744No Hit
AAGCTGCCAGCTGAAGAACTGTTGGAATTCTCGGGTGCCAAGGAACTCCA979880.8138033296439166RNA PCR Primer, Index 1 (100% over 28bp)
TTCAAGTAATCCAGGATAGGCTTGGAATTCTCGGGTGCCAAGGAACTCCA855620.7106037524083847RNA PCR Primer, Index 1 (100% over 28bp)
TCCCTGGTGGTCTAGTGGTTAGGATTCGGCGCTCTGGAATTCTCGGGTGC783640.6508234082154537No Hit
GTTTCCGTAGTGTAGTGGTTATCACGTTCGCCTTGGAATTCTCGGGTGCC769510.6390882559030598No Hit
CATGGAATTCTCGGGTGCCAAGGAACTCCAGTCACTGACCAATCTCGTAT766120.636272815963993RNA PCR Primer, Index 4 (100% over 48bp)
GTTCTACAGTCCGACTGGAATTCTCGGGTGCCAAGGAACTCCAGTCACTG716370.5949547814599875RNA PCR Primer, Index 2 (97% over 35bp)
TAGCTTATCAGACTGGTGTTGGCTGGAATTCTCGGGTGCCAAGGAACTCC605670.5030169639807232RNA PCR Primer, Index 1 (100% over 27bp)
TGGAGTGTGACAATGGTGTTTTGGAATTCTCGGGTGCCAAGGAACTCCAG590600.490501129207349RNA PCR Primer, Index 1 (100% over 29bp)
TGGAGTGTGACAATGGTGTTTGTTGGAATTCTCGGGTGCCAAGGAACTCC572980.47586748563025205RNA PCR Primer, Index 1 (100% over 27bp)
ACCACGTTCCCGTGGTGGAATTCTCGGGTGCCAAGGAACTCCAGTCACTG535330.4445986615282258RNA PCR Primer, Index 2 (97% over 35bp)
GCATTGGTGGTTCAGTGGTAGAATTCTCGCCTGGAATTCTCGGGTGCCAA517680.4299401025534379No Hit
ATGACCTATGAATTGACAGCCATGGAATTCTCGGGTGCCAAGGAACTCCA481110.39956823276828257RNA PCR Primer, Index 1 (100% over 28bp)
ATGACCTATGAATTGACAGCCTGGAATTCTCGGGTGCCAAGGAACTCCAG463410.3848681481306766RNA PCR Primer, Index 1 (100% over 29bp)
GCATTGTGGTTCAGTGGTAGAATTCTCGCCTTGGAATTCTCGGGTGCCAA452590.37588199469684064No Hit
TGAGGTAGTAGGTTGTATAGTTTGGAATTCTCGGGTGCCAAGGAACTCCA437820.3636153139003751RNA PCR Primer, Index 1 (100% over 28bp)
TCCCTGTGGTCTAGTGGTTAGGATTCGGCGCTCTGGAATTCTCGGGTGCC433270.3598364785839284No Hit
AACATTCAACGCTGTCGGTGAGTTGGAATTCTCGGGTGCCAAGGAACTCC432420.35913054231602076RNA PCR Primer, Index 1 (100% over 27bp)
CCTGTCTGAGGGTCGCTTGGAATTCTCGGGTGCCAAGGAACTCCAGTCAC431700.3585325727714402RNA PCR Primer, Index 1 (100% over 33bp)
CTACAGTCCGACGATCTGGAATTCTCGGGTGCCAAGGAACTCCAGTCACT405530.33679804085244874RNA PCR Primer, Index 3 (100% over 34bp)
TATTGCACTTGTCCCGGCCTGTTGGAATTCTCGGGTGCCAAGGAACTCCA403260.3349127757605072RNA PCR Primer, Index 1 (100% over 28bp)
AACATTCAACGCTGTCGGTGAGTGGAATTCTCGGGTGCCAAGGAACTCCA372980.30976483435786833RNA PCR Primer, Index 1 (100% over 28bp)
CACCACGTTCCCGTGGTGGAATTCTCGGGTGCCAAGGAACTCCAGTCACT323810.26892849754255277RNA PCR Primer, Index 3 (100% over 34bp)
TCTACAGTCCGACGATCTGGAATTCTCGGGTGCCAAGGAACTCCAGTCAC318050.26414474118590814RNA PCR Primer, Index 1 (100% over 33bp)
AGTTCTACAGTCCGACGATCTGGAATTCTCGGGTGCCAAGGAACTCCAGT301530.2504246621908093RNA PCR Primer, Index 1 (100% over 30bp)
GTTTCCGTAGTGTAGTGGTTATCACGTTCGCCTGGAATTCTCGGGTGCCA290730.2414551190221005No Hit
TGGAATTCTCGGGTGCCAAGGAACTCCAGTCACTGTCCAATCTCGTATGC283210.2352096593342589RNA PCR Primer, Index 4 (98% over 50bp)
GATCCATGATGACATTAAAACATAACGTGACTGTTGGATGAAGCTTGCGG267470.22213738067912234No Hit
ACAGTCCGACGATCTGGAATTCTCGGGTGCCAAGGAACTCCAGTCACTGA266990.2217387343160686RNA PCR Primer, Index 2 (97% over 36bp)
CAGAGTTCTACAGTCCGACGATCTGGAATTCTCGGGTGCCAAGGAACTCC262680.21815922218114872RNA PCR Primer, Index 1 (100% over 27bp)
GGACAACTCTTAGCGGTGGAATTCTCGGGTGCCAAGGAACTCCAGTCACT240800.19998759213194994RNA PCR Primer, Index 3 (100% over 34bp)
TTCAAGTAATCCAGGATAGGTTTGGAATTCTCGGGTGCCAAGGAACTCCA236160.19613401062243066RNA PCR Primer, Index 1 (100% over 28bp)
TGTAAACATCCTACACTCTCAGCTTGGAATTCTCGGGTGCCAAGGAACTC235760.19580180531988586RNA PCR Primer, Index 1 (100% over 26bp)
TTCTACAGTCCGACGATCTGGAATTCTCGGGTGCCAAGGAACTCCAGTCA225220.18704819559783126RNA PCR Primer, Index 1 (100% over 32bp)
TGGACGTGATGAGCAGGTGTTACCGCCCCAGTCTGATGTTTGGTGACTGA215880.17929120178341093No Hit
TGTAAACATCCTTGACTGGAAGCTTGGAATTCTCGGGTGCCAAGGAACTC214290.1779706857057955RNA PCR Primer, Index 1 (100% over 26bp)
TGGAATTCTCGGGTGCCAAGGAACTCCAGTGACTGACCAATCTCGTATGC213220.17708203652148824RNA PCR Primer, Index 4 (98% over 50bp)
TACAGTCCGACGATCTGGAATTCTCGGGTGCCAAGGAACTCCAGTCACTG212920.17683288254457968RNA PCR Primer, Index 2 (97% over 35bp)
TGGACAACTCTTAGCGGTGGAATTCTCGGGTGCCAAGGAACTCCAGTCAC208340.17302913183044208RNA PCR Primer, Index 1 (100% over 33bp)
AGAGTTCTACAGTCCGACGATCTGGAATTCTCGGGTGCCAAGGAACTCCA204910.1701804713611207RNA PCR Primer, Index 1 (100% over 28bp)
TAGTTCTACAGTCCGACGATCTGGAATTCTCGGGTGCCAAGGAACTCCAG196390.16310449841691715RNA PCR Primer, Index 1 (100% over 29bp)
GTTCTACAGTCCGACGTGGAATTCTCGGGTGCCAAGGAACTCCAGTCACT196040.16281381877719048RNA PCR Primer, Index 3 (100% over 34bp)
GTTTCCGTAGTGTAGTGGTTATCACGTTCGCCTCTGGAATTCTCGGGTGC194360.16141855650650247No Hit
TGAGGTAGTAGTTTGTATAGTTTGGAATTCTCGGGTGCCAAGGAACTCCA193520.16072092537115845RNA PCR Primer, Index 1 (100% over 28bp)
AGAGATGATGACTTCTGTTACCGCCCCAGTCTGAGAAGTCATGACTGATC185700.15422631170640824No Hit
TCCCTGGTGGTCTAGTGGTTAGGATTCGGCGCTTGGAATTCTCGGGTGCC184930.15358681649900957No Hit
GCATTGGTGGTTCAGTGGTAGAATTCTCGCCTGCCACGCGGGAGGCCCGG164750.13682705898562605No Hit
GCATTGTGGTTCAGTGGTAGAATTCTCGCCTGGAATTCTCGGGTGCCAAG163150.13549823777544698No Hit
TGAATTCTCGGGTGCCAAGGAACTCCAGTCACTGACCAATCTCGTATGCC158780.1318688948451454RNA PCR Primer, Index 4 (98% over 50bp)
TTCAGTGATGTTTGACAAATGTCTGACCTGAACTGCAATGTGGACAGATC144430.11995102961635189No Hit
ATGGAATTCTCGGGTGCCAAGGAACTCCAGTCACTGACCAATCTCGTATG137830.11446964212436321RNA PCR Primer, Index 4 (100% over 49bp)
GTTCCTGTAGTGTAGTGGTTATCACGTTCGCCTTGGAATTCTCGGGTGCC137530.11422048814745463No Hit
ATCCATGATGACATTAAAACATAACGTGACTGTTGGATGAAGCTTGCGGA135180.11226878199500413No Hit
CACCGTCGAGCAGCATTCCGGGCTTCACATCGGAGGGCTCCAGCCGGCCC128530.10674586884019738No Hit
TGTCTGAGGGTCGCTTGGAATTCTCGGGTGCCAAGGAACTCCAGTCACTG127120.10557484514872707RNA PCR Primer, Index 2 (97% over 35bp)
TTGCGGCCCCGGGTTCCTCCCGGGGCTACGCCTGTCTGAGGGTCGCTTTG125770.10445365225263847No Hit
TGGAATTCTCGGGTGCCAAGGAAATCCAGTCACTGACCAATCTCGTATGC124200.10314974644015026RNA PCR Primer, Index 4 (98% over 50bp)

[OK]Adapter Content

Adapter graph

[WARN]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
TTTAGAG254.4189732E-544.0444031
TTCTAAA302.512228E-644.0444031
TACTTAA2750.044.0444031
TAGACGG351.4361831E-744.0444031
TATTGAA600.044.0444031
TGCATAT2150.044.0444031
GTTAACG351.4361831E-744.0444031
TGTTCTA254.4189732E-544.0444031
CGCTAAA302.512228E-644.0444031
GCTAGTT351.4361831E-744.0444031
AGTATGC1000.044.03844
GCATGCC254.42277E-544.03843
CATGCCG207.8261236E-444.03799444
TCGTACG800.044.03799443
CGATTGC302.5147456E-644.0379943
GCGTCCC454.765752E-1044.03506542
TCTTCGA207.841195E-444.0207941
AATCGCA254.4411427E-544.0070839
AACATTC115450.044.0062521
CAATCTA950.043.99940538