FastQCFastQC Report
Mon 5 Dec 2016
JM98_3_ACAGTG_L008_R1_001.fastq

Summary

[OK]Basic Statistics

MeasureValue
FilenameJM98_3_ACAGTG_L008_R1_001.fastq
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences13029620
Sequences flagged as poor quality0
Sequence length50
%GC52

[OK]Per base sequence quality

Per base quality graph

[OK]Per tile sequence quality

Per base quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[FAIL]Per base sequence content

Per base sequence content

[FAIL]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[OK]Sequence Length Distribution

Sequence length distribution

[FAIL]Sequence Duplication Levels

Duplication level graph

[FAIL]Overrepresented sequences

SequenceCountPercentagePossible Source
TGGAATTCTCGGGTGCCAAGGAACTCCAGTCACACAGTGATCTCGTATGC650560749.92936862318318RNA PCR Primer, Index 5 (100% over 50bp)
TGGAGTGTGACAATGGTGTTTGTGGAATTCTCGGGTGCCAAGGAACTCCA2086521.6013667321073062RNA PCR Primer, Index 1 (100% over 28bp)
GCATTGGTGGTTCAGTGGTAGAATTCTCGCCTTGGAATTCTCGGGTGCCA1644371.2620245256576936No Hit
AAGCTGCCAGCTGAAGAACTGTTGGAATTCTCGGGTGCCAAGGAACTCCA1087270.8344602528699994RNA PCR Primer, Index 1 (100% over 28bp)
ACCACGTTCCCGTGGTGGAATTCTCGGGTGCCAAGGAACTCCAGTCACAC953820.7320397678520172RNA PCR Primer, Index 5 (100% over 35bp)
TCCCTGGTGGTCTAGTGGTTAGGATTCGGCGCTCTGGAATTCTCGGGTGC877730.6736420555626335No Hit
CCTGTCTGAGGGTCGCTTGGAATTCTCGGGTGCCAAGGAACTCCAGTCAC852580.6543398809788774RNA PCR Primer, Index 1 (100% over 33bp)
TTCAAGTAATCCAGGATAGGCTTGGAATTCTCGGGTGCCAAGGAACTCCA847580.6505024705248502RNA PCR Primer, Index 1 (100% over 28bp)
GTTCTACAGTCCGACTGGAATTCTCGGGTGCCAAGGAACTCCAGTCACAC804700.6175928384711143RNA PCR Primer, Index 5 (100% over 35bp)
TAGCTTATCAGACTGGTGTTGGCTGGAATTCTCGGGTGCCAAGGAACTCC796900.611606478162832RNA PCR Primer, Index 1 (100% over 27bp)
CATGGAATTCTCGGGTGCCAAGGAACTCCAGTCACACAGTGATCTCGTAT788750.605351499122768RNA PCR Primer, Index 5 (100% over 48bp)
TTGCGGCCCCGGGTTCCTCCCGGGGCTACGCCTGTCTGAGGGTCGCTTGG730470.5606226428706287No Hit
AACATTCAACGCTGTCGGTGAGTTGGAATTCTCGGGTGCCAAGGAACTCC701590.5384577600881684RNA PCR Primer, Index 1 (100% over 27bp)
CTACAGTCCGACGATCTGGAATTCTCGGGTGCCAAGGAACTCCAGTCACA691460.5306831665083095RNA PCR Primer, Index 1 (100% over 34bp)
TGGAGTGTGACAATGGTGTTTTGGAATTCTCGGGTGCCAAGGAACTCCAG648610.4977965589172977RNA PCR Primer, Index 1 (100% over 29bp)
ATGACCTATGAATTGACAGCCATGGAATTCTCGGGTGCCAAGGAACTCCA626340.48070473275506115RNA PCR Primer, Index 1 (100% over 28bp)
TATTGCACTTGTCCCGGCCTGTTGGAATTCTCGGGTGCCAAGGAACTCCA615410.472316153502558RNA PCR Primer, Index 1 (100% over 28bp)
TGGAGTGTGACAATGGTGTTTGTTGGAATTCTCGGGTGCCAAGGAACTCC566580.43484000300852976RNA PCR Primer, Index 1 (100% over 27bp)
CACCACGTTCCCGTGGTGGAATTCTCGGGTGCCAAGGAACTCCAGTCACA564100.4329366474233324RNA PCR Primer, Index 1 (100% over 34bp)
TCTACAGTCCGACGATCTGGAATTCTCGGGTGCCAAGGAACTCCAGTCAC516580.39646589846825925RNA PCR Primer, Index 1 (100% over 33bp)
TCCCTGGTGGTCTAGTGGTTAGGATTCGGCGCTTGGAATTCTCGGGTGCC515940.39597470993014383No Hit
AGTTCTACAGTCCGACGATCTGGAATTCTCGGGTGCCAAGGAACTCCAGT513380.39400995577768194RNA PCR Primer, Index 1 (100% over 30bp)
ATGACCTATGAATTGACAGCCTGGAATTCTCGGGTGCCAAGGAACTCCAG512770.39354179170229064RNA PCR Primer, Index 1 (100% over 29bp)
GCATTGTGGTTCAGTGGTAGAATTCTCGCCTTGGAATTCTCGGGTGCCAA504320.38705656803498495No Hit
AACATTCAACGCTGTCGGTGAGTGGAATTCTCGGGTGCCAAGGAACTCCA497980.3821907315792786RNA PCR Primer, Index 1 (100% over 28bp)
ACAGTCCGACGATCTGGAATTCTCGGGTGCCAAGGAACTCCAGTCACACA495870.3805713443676792RNA PCR Primer, Index 5 (100% over 36bp)
GCATTGGTGGTTCAGTGGTAGAATTCTCGCCTGGAATTCTCGGGTGCCAA489890.3759818014646628No Hit
TGAGGTAGTAGGTTGTATAGTTTGGAATTCTCGGGTGCCAAGGAACTCCA473010.3630267037718675RNA PCR Primer, Index 1 (100% over 28bp)
TCCCTGTGGTCTAGTGGTTAGGATTCGGCGCTCTGGAATTCTCGGGTGCC440920.3383982034779218No Hit
TAGTTCTACAGTCCGACGATCTGGAATTCTCGGGTGCCAAGGAACTCCAG416980.3200246822240403RNA PCR Primer, Index 1 (100% over 29bp)
GTTTCCGTAGTGTAGTGGTTATCACGTTCGCCTTGGAATTCTCGGGTGCC408120.3132247908995044No Hit
TTCTACAGTCCGACGATCTGGAATTCTCGGGTGCCAAGGAACTCCAGTCA377590.2897935626672152RNA PCR Primer, Index 1 (100% over 32bp)
GGACAACTCTTAGCGGTGGAATTCTCGGGTGCCAAGGAACTCCAGTCACA370380.2842600167925082RNA PCR Primer, Index 1 (100% over 34bp)
TGGACAACTCTTAGCGGTGGAATTCTCGGGTGCCAAGGAACTCCAGTCAC354590.2721414745786907RNA PCR Primer, Index 1 (100% over 33bp)
CAGAGTTCTACAGTCCGACGATCTGGAATTCTCGGGTGCCAAGGAACTCC336800.2584879681832625RNA PCR Primer, Index 1 (100% over 27bp)
TACAGTCCGACGATCTGGAATTCTCGGGTGCCAAGGAACTCCAGTCACAC310060.23796549707512576RNA PCR Primer, Index 5 (100% over 35bp)
AGAGTTCTACAGTCCGACGATCTGGAATTCTCGGGTGCCAAGGAACTCCA293340.22513319651685926RNA PCR Primer, Index 1 (100% over 28bp)
GTTCTACAGTCCGACGTGGAATTCTCGGGTGCCAAGGAACTCCAGTCACA290090.22263887972174168RNA PCR Primer, Index 1 (100% over 34bp)
TGTAAACATCCTTGACTGGAAGCTTGGAATTCTCGGGTGCCAAGGAACTC288780.22163347818278661RNA PCR Primer, Index 1 (100% over 26bp)
TGGAATTCTCGGGTGCCAAGGAACTCCAGTCACACAGCGATCTCGTATGC286530.2199066434784744RNA PCR Primer, Index 5 (98% over 50bp)
TCCCTGTGGTCTAGTGGTTAGGATTCGGCGCTTGGAATTCTCGGGTGCCA271530.20839441211639326No Hit
TGTAAACATCCTACACTCTCAGCTTGGAATTCTCGGGTGCCAAGGAACTC271210.20814881784733552RNA PCR Primer, Index 1 (100% over 26bp)
TTCAAGTAATCCAGGATAGGTTTGGAATTCTCGGGTGCCAAGGAACTCCA268620.20616103923214954RNA PCR Primer, Index 1 (100% over 28bp)
GCATCGATGGTTCAGTGGTAGAATGCTCGCCTTGGAATTCTCGGGTGCCA266730.2047104980805273No Hit
GCCCGGCTAGCTCAGTCGGTAGAGCATGAGACTCTGGAATTCTCGGGTGC262410.20139497544824791No Hit
TGAGGTAGTAGTTTGTATAGTTTGGAATTCTCGGGTGCCAAGGAACTCCA258760.19859366581680815RNA PCR Primer, Index 1 (100% over 28bp)
GCATTGGTGGTTCAGTGGTAGAATTCTCGCCTGCTGGAATTCTCGGGTGC251670.1931522177929978No Hit
GTTTCCGTAGTGTAGTGGTTATCACGTTCGCCTCTGGAATTCTCGGGTGC223380.17144014944411273No Hit
GCCCGGCTAGCTCAGTCGGTAGAGCATGAGACTCTTAATCTTGGAATTCT207580.15931393240938724No Hit
TGTCTGAGGGTCGCTTGGAATTCTCGGGTGCCAAGGAACTCCAGTCACAC201370.1545478686254856RNA PCR Primer, Index 5 (100% over 35bp)
CCACGTTCCCGTGGTGGAATTCTCGGGTGCCAAGGAACTCCAGTCACACA199840.15337362102655336RNA PCR Primer, Index 5 (100% over 36bp)
GCCCGGCTAGCTCAGTCGGTAGAGCATGAGACTTGGAATTCTCGGGTGCC195640.15015019624517062No Hit
TAGCAGCACGTAAATATTGGAGTGGAATTCTCGGGTGCCAAGGAACTCCA187080.1435805495478763RNA PCR Primer, Index 1 (100% over 28bp)
GCATTGGTGGTTCAGTGGTAGAATTCTCGCCTGTGGAATTCTCGGGTGCC184710.14176161699266748No Hit
CTGTCTGAGGGTCGCTTGGAATTCTCGGGTGCCAAGGAACTCCAGTCACA174080.13360328236740596RNA PCR Primer, Index 1 (100% over 34bp)
TGAGATGAAGCACTGTAGCTCTGGAATTCTCGGGTGCCAAGGAACTCCAG173460.1331274434711066RNA PCR Primer, Index 1 (100% over 29bp)
CTACGCCTGTCTGAGGGTCGCTTGGAATTCTCGGGTGCCAAGGAACTCCA166790.1280083379254345RNA PCR Primer, Index 1 (100% over 28bp)
CTGGACAACTCTTAGCGGTGGAATTCTCGGGTGCCAAGGAACTCCAGTCA159150.12214477475168117RNA PCR Primer, Index 1 (100% over 32bp)
GCATTGTGGTTCAGTGGTAGAATTCTCGCCTGGAATTCTCGGGTGCCAAG155970.11970418170291995No Hit
TGAGGTAGTAGTTTGTGCTGTTTGGAATTCTCGGGTGCCAAGGAACTCCA153890.11810781895404471RNA PCR Primer, Index 1 (100% over 28bp)
CCTGTCTGAGGGTCGCTTTGGAATTCTCGGGTGCCAAGGAACTCCAGTCA150550.11554442877075465RNA PCR Primer, Index 1 (100% over 32bp)
TTCACAGTGGTTAAGTTCTGCCTGGAATTCTCGGGTGCCAAGGAACTCCA150270.11532953378532913RNA PCR Primer, Index 1 (100% over 28bp)
TAACGGAACCCATAATGCAGCTGTGGAATTCTCGGGTGCCAAGGAACTCC145660.11179144134671617RNA PCR Primer, Index 1 (100% over 27bp)
TGGAATTCTCGGGTGCCAAGGAACTCCAGTCACACAGTGATCGTATGCCG144960.1112542038831524RNA PCR Primer, Index 5 (97% over 42bp)
TCCCTGGTGGTCTAGTGGTTAGGATTCGGCGCTCTTGGAATTCTCGGGTG143260.10994948432878318No Hit
TGAGAACTGAATTCCATAGATGGTGGAATTCTCGGGTGCCAAGGAACTCC141240.10839917050535625RNA PCR Primer, Index 1 (100% over 27bp)
CAGTCCGACGATCTGGAATTCTCGGGTGCCAAGGAACTCCAGTCACACAG135780.1042087182895587RNA PCR Primer, Index 5 (100% over 37bp)
CCGTCGAGCAGCATTCCGGGCTTCACATCGGAGGGCTCCAGCCGGCCCCG135130.10370985493053521No Hit
GTTGGGCGCCATGGAATTCTCGGGTGCCAAGGAACTCCAGTCACACAGTG134570.10328006495968417RNA PCR Primer, Index 5 (100% over 39bp)
TGAATTCTCGGGTGCCAAGGAACTCCAGTCACACAGTGATCTCGTATGCC131100.10061690210458939RNA PCR Primer, Index 5 (98% over 50bp)
CATTATTACTTTTGGTACGCGTGGAATTCTCGGGTGCCAAGGAACTCCAG130480.10014106320829004RNA PCR Primer, Index 1 (100% over 29bp)

[OK]Adapter Content

Adapter graph

[FAIL]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
CGTTCTA302.5111094E-644.0472951
AACAGTA1500.044.0472951
TATGCCC502.7284841E-1144.01482844
CGTACGC502.7284841E-1144.01482844
CTTAAGC454.802132E-1044.000317
ATAGGCA850.044.000316
TTAAGCG454.802132E-1044.000318
ACTACTA408.3236955E-944.000316
GGTCCAT302.529623E-644.00029817
ACCTATC1750.044.00029816
CGAATAT502.7284841E-1144.00029816
CCAAAAG302.529623E-644.00029816
TTATAAT207.8593666E-444.00013414
TTGCATT254.4453056E-544.0001312
ACGAATA502.7284841E-1144.0001315
GATATGT408.3273335E-943.9981042
GACCTAC454.802132E-1043.9981042
AATCTAA408.3291525E-943.99709326
TTCGCTG207.86204E-443.99709327
CCGTTTA254.4471184E-543.9970925