FastQCFastQC Report
Tue 20 Dec 2016
MZM040324hpf_TAGCTT_L001_R1_001_TRIMMED.fastq

Summary

[OK]Basic Statistics

MeasureValue
FilenameMZM040324hpf_TAGCTT_L001_R1_001_TRIMMED.fastq
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences2282133
Sequences flagged as poor quality0
Sequence length15-29
%GC56

[OK]Per base sequence quality

Per base quality graph

[WARN]Per tile sequence quality

Per base quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[FAIL]Per base sequence content

Per base sequence content

[FAIL]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[WARN]Sequence Length Distribution

Sequence length distribution

[FAIL]Sequence Duplication Levels

Duplication level graph

[FAIL]Overrepresented sequences

SequenceCountPercentagePossible Source
GAGGTGTAGAATAAGTGGGAGGCCT1882458.248642826688892No Hit
CGGTGCGGAGAGCCGTTCGTGAC1102374.8304371392903045No Hit
CTCGGTTCTGGTGTCAAGCGCC814753.570124966423955No Hit
CTCTCGGTTCTGGTGTCAAGCGCC731083.20349427487355No Hit
CTTCGGTTGGTCCCGGATAGCTGGCC579202.537976533357171No Hit
AATCTTCGGTTGGTCCCGGATAGCTGGCC475992.085724188730455No Hit
TCTCGGTTCTGGTGTCAAGCGCC306391.3425597894601233No Hit
TCTTCGGTTGGTCCCGGATAGCTGGCC221180.9691810249446461No Hit
AGGTGTAGAATAAGTGGGAGGCCT216990.9508210082409745No Hit
CGGTGCGGAGAGCCGTTCGTGACT216930.9505580963072704No Hit
AGGTGTAGAATAAGTGGGAGGCCTCACG174030.7625760637088198No Hit
CTCGGTTCTGGTGTCAAGCGC169170.7412801970787855No Hit
CTCTCGGTTCTGGTGTCAAGCGC154770.678181332989795No Hit
ACAACACTGAGACACGAGACGAACGCA154340.6762971307982488No Hit
AACTCCAGTCACTAGCT150690.6603033214979144Illumina PCR Primer Index 10 (100% over 17bp)
AACTCCAGTCACTAG147780.6475520927132643Illumina PCR Primer Index 10 (100% over 15bp)
ACTGGCGGGCGTGGGAAATGTGGCGTACA128360.5624562635043618No Hit
ACAACACTGAGACACGAGACGAACGC125690.5507566824545282No Hit
GCGCGCCGGCCGAGGTGGGATCCCGG119080.5217925510914571No Hit
GCTCTCGGTTCTGGTGTCAAGCGCC109250.4787188126195975No Hit
GAGGTGTAGAATAAGTGGGAGGCCG108170.47398639781292323No Hit
TTCGGTTGGTCCCGGATAGCTGGCC103770.4547061893412873No Hit
TCTCGGTTCTGGTGTCAAGCGC101100.4430066082914536No Hit
ACAACACTGAGACACGAGACGAACAC86130.377410080832274No Hit
TCGGTTCTGGTGTCAAGCGCC84040.3682519818082469No Hit
CACATGAGAGTCCACACTGGAGAGAAGCC84030.3682081631526296No Hit
CCGTGATCGTATAGTGGTTAGTACTCTGC82710.3624241006111388No Hit
ATCTTCGGTTGGTCCCGGATAGCTGGCC80060.35081215687253986No Hit
AACTCCAGTCACTAGC78530.3441079025630846Illumina PCR Primer Index 10 (100% over 16bp)
CGGTGCGGAGAGCCGTTCGTGACTGGGC77920.341434964570426No Hit
CTCGGGGGCCTGAGTCCT75650.3314881297452865No Hit
CGGTTGGTCCCGGATAGCTGGCC75210.3295601088981229No Hit
TCCAGTGCGGTAACGCAAACGAACTC74820.3278511813290461No Hit
GAGGTGTAGAATAAGTGGGAGGCC72990.31983236735107023No Hit
GGATTCAACTCGGCAGGTCAGGGAC67050.2938040859143617No Hit
GGAATACCAGGTGCTGTAAGCTT61810.27084311037086795No Hit
CTCGGGCCGGTGCGGAGAGCCGTTCGTG60610.2655848716967854No Hit
GCCGTGATCGTATAGTGGTTAGTACTCTG60440.2648399545512904No Hit
GGGATTCAACTCGGCAGGTCAGGGAC58920.25817951889745255No Hit
CCGTGATCGTATAGTGGTTAGTACTCTG57070.25007306760824194No Hit
GCGCGCCGGCCGAGGTGGGATCCCGGGC53740.23548145528766287No Hit
AACTCCAGTCACTAGCTTA50470.221152754900788Illumina PCR Primer Index 10 (100% over 19bp)
TGGACAACTCTTAGCGG50360.2206707496889971No Hit
ATCGGAAGTGGTTCCAAGAAAAGCCT50270.2202763817884409No Hit
CTCGGTTCTGGTGTCAAGCGCCCGGC45440.19911197112525866No Hit
TCGGTTGGTCCCGGATAGCTGGCC45380.19884905919155454No Hit
AACTCCAGTCACTAGCTT45250.19827941666852897Illumina PCR Primer Index 10 (100% over 18bp)
GTAGAATAAGTGGGAGGCCT43270.18960332285629278No Hit
GGCAGGTCAGGGACGGCCGCTCGGCGCGG42820.18763148335351185No Hit
CTGGGATAATAGAACGGAATGGAAAGTCC41650.18250470064628135No Hit
AACTCCAGTCACTAGCTTATCTCGTATGC39970.17514316650256578Illumina PCR Primer Index 10 (100% over 29bp)
GGGCCGGTGCGGAGAGCCGTTCGTGAC37400.16388177200890572No Hit
CACTGAGACACGAGACGAACGCA36570.1602448235926653No Hit
CGGGCCGGTGCGGAGAGCCGTTCGTGAC35140.15397875583938359No Hit
CGGGATAAGGATTGGCTCAAAGGGCTG35110.15384729987253154No Hit
TCTCGGTTCTGGTGTCAAGCGCCCGGC33280.14582848589455566No Hit
TCGGTTCTGGTGTCAAGCGC32840.14390046504739207No Hit
CATCTGTGGGATTATGACTGAACGC32300.14153425764405494No Hit
CGGGGGCCTGAGTCCTCCTGATCGAGGCT32160.14092079646541195No Hit
ATTCGGTCGGGAACTCTAGGGAGACTGCC31900.13978151141936074No Hit
CACTGAGACACGAGACGAACGC31550.13824785847275334No Hit
GGTGCGGAGAGCCGTTCGTGAC30700.1345232727452782No Hit
AGGTGTAGAATAAGTGGGAGGCCTC30620.13417272350033937No Hit
GTGCGCCGCGACCGACTCTGGATC30570.1339536302222526No Hit
AGGTGTAGAATAAGTGGGAGGCCTCAC30000.1314559668520634No Hit
GGGTGCGGCGGCGACTCTGGACGCGCGCC29230.1280819303695271No Hit
GGTGCGCCGCGACCGACTCTGGATCG29200.12795047440267504No Hit
CGCGCGCCGGCCGAGGTGGGATCCCGG28920.12672355204538913No Hit
GTGCGCCGCGACCGACTCTGGAT28400.12444498195328668No Hit
TTGGGAATACCAGGTGCTGTAAGCTT27450.12028220966963801No Hit
GTCCAGTGCGGTAACGCAAACGAACTC27300.11962492983537769No Hit
GCTTACGGCCATACCACCCTGAAC27210.11923056193482151No Hit
GATTCAACTCGGCAGGTCAGGGAC26290.11519924561802489No Hit
GATGGTTTAGTGAGGTCCTCGGATCGGCC25130.11011628156641178No Hit
ACAACACTGAGACACGAGACGAACACA24810.10871408458665643No Hit
CGTGATCGTATAGTGGTTAGTACTCTGCG23960.1049894988591813No Hit
CGTGATCGTATAGTGGTTAGTACTCTGC23700.10385021381313009No Hit
ACCGCGTCGCGCCGCCCGGGCGGGGAC23680.10376257650189537No Hit
ACAACACTGAGACACGAGACGAACGCAC23320.1021851048996706No Hit
GTGAGGTCCTCGGATCGGCC22900.10034472136374172No Hit

[OK]Adapter Content

Adapter graph

[FAIL]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
GGCGCGG3950.0134.126923
CGTATGC4900.0127.1172523
AGAAGCC10450.0124.69137623
AAAGTCC5150.0116.7759323
TGCTATC1150.0105.8357523
CTCTGCG4200.0100.573623
TCGGAAC1500.0100.2326723
GAGCGCA1600.098.4428123
GAGTCCC1450.093.8138323
GCGTACA20250.092.9848123
GCGCATC406.58134E-789.4934623
TCAGGCT4300.088.2447223
AAAGGCC1350.084.8530523
GAGCACC6250.082.4771723
ACTCTGC16850.081.1549123
ACACGCC5350.078.9549823
AAGTGTG1300.077.10206623
ACACGGC950.075.36291523
TAACTGA2200.074.84907523
ACGCACT3300.073.76430523