FastQCFastQC Report
Mon 19 Dec 2016
MZM040324hpf_TAGCTT_L001_R1_001.fastq

Summary

[OK]Basic Statistics

MeasureValue
FilenameMZM040324hpf_TAGCTT_L001_R1_001.fastq
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences5404054
Sequences flagged as poor quality0
Sequence length50
%GC56

[OK]Per base sequence quality

Per base quality graph

[WARN]Per tile sequence quality

Per base quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[FAIL]Per base sequence content

Per base sequence content

[FAIL]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[OK]Sequence Length Distribution

Sequence length distribution

[FAIL]Sequence Duplication Levels

Duplication level graph

[FAIL]Overrepresented sequences

SequenceCountPercentagePossible Source
GTGCGCCGCGACCGACTCTGGATCGGCCAGGAAGGTGGAATTCTCGGGTG1943883.5970773052970975No Hit
GAGGTGTAGAATAAGTGGGAGGCCTTGGAATTCTCGGGTGCCAAGGAACT1836903.399114812694322RNA PCR Primer, Index 1 (100% over 25bp)
GGTGCGCCGCGACCGACTCTGGATCGGCCAGGAAGGTGGAATTCTCGGGT1367012.529600925527391No Hit
TGGGCTGGGGTGCGGCCGAATGATGGCTGCCCTGGAATTCTCGGGTGCCA1198012.2168727403538155No Hit
CGGTGCGGAGAGCCGTTCGTGACTGGAATTCTCGGGTGCCAAGGAACTCC1052591.9477784640938083RNA PCR Primer, Index 1 (100% over 27bp)
TGGTGCGCCGCGACCGACTCTGGATCGGCCAGGAAGGTGGAATTCTCGGG1026601.8996849402319074No Hit
TGGGCTGGGGTGCGGCCGAATGATGGCTGCCTGGAATTCTCGGGTGCCAA849841.572597165017226No Hit
CTCGGTTCTGGTGTCAAGCGCCTGGAATTCTCGGGTGCCAAGGAACTCCA783551.4499299969985497RNA PCR Primer, Index 1 (100% over 28bp)
CTCTCGGTTCTGGTGTCAAGCGCCTGGAATTCTCGGGTGCCAAGGAACTC707481.3091653044177576RNA PCR Primer, Index 1 (100% over 26bp)
CTTTGGTGACTCTAGATAACCTCGAGCCGATCGCTGGCCTGGAATTCTCG594061.0992858324509711No Hit
CTTCGGTTGGTCCCGGATAGCTGGCCTGGAATTCTCGGGTGCCAAGGAAC562471.0408297178377566RNA PCR Primer, Index 1 (100% over 24bp)
CAGGACGGTGGCCATGGAAGTCGGAATCCGCTAAGGAGTGTGTAACAACT549611.0170327683624183No Hit
TTACTTGGATAACTGTGGCAATTCTAGAGCTAATACATGCAAACTGGAAT503490.931689431674813No Hit
AATCTTCGGTTGGTCCCGGATAGCTGGCCTGGAATTCTCGGGTGCCAAGG466590.8634073604741922Illumina Small RNA Adapter 2 (100% over 21bp)
CTTTGGTGACTCTAGATAACCTCGAGCCGATCGCTGGCTGGAATTCTCGG343290.6352453176818736No Hit
CTTTGGTGACTCTAGATAACCTCGAGCCGATCGCTGGCCCTGGAATTCTC297490.5504941290372006No Hit
TCTCGGTTCTGGTGTCAAGCGCCTGGAATTCTCGGGTGCCAAGGAACTCC295590.5469782500322906RNA PCR Primer, Index 1 (100% over 27bp)
TACTTGGATAACTGTGGCAATTCTAGAGCTAATACATGCAAACTGGAATT287640.5322670720906933No Hit
TCCCTGATGGTCTAGTGGCTAGGATCCGACGCTTGGAATTCTCGGGTGCC285240.5278259617687018No Hit
GAAGAGTCGTTCGAGACCAGGACGTTGATAGGCTGGGTGTGGAATGGAAT255340.47249712900722307No Hit
CTTTGGTGACTCTAGATAACCTCGAGCCGATCGCTGGTGGAATTCTCGGG248900.4605801496432123No Hit
TCTTCGGTTGGTCCCGGATAGCTGGCCTGGAATTCTCGGGTGCCAAGGAA214360.3966651702592165RNA PCR Primer, Index 1 (100% over 23bp)
AGGTGTAGAATAAGTGGGAGGCCTTGGAATTCTCGGGTGCCAAGGAACTC209510.38769042648352514RNA PCR Primer, Index 1 (100% over 26bp)
CGGTGCGGAGAGCCGTTCGTGACTTGGAATTCTCGGGTGCCAAGGAACTC208870.38650613039766074RNA PCR Primer, Index 1 (100% over 26bp)
TGCTTTGGTGACTCTAGATAACCTCGAGCCGATCGCTGGCCTGGAATTCT201980.37375644284827647No Hit
TTTGGTGACTCTAGATAACCTCGAGCCGATCGCTGGCCTGGAATTCTCGG196940.3644301111720942No Hit
GGTGCGCCGCGACCGACTCTGGATCGGCCAGGAAGGGTGGAATTCTCGGG175480.3247191830429526No Hit
GTGCGCCGCGACCGACTCTGGATCGGCCAGGAAGGGTGGAATTCTCGGGT175350.3244786229005113No Hit
GTGGTGCGCCGCGACCGACTCTGGATCGGCCAGGAAGGTGGAATTCTCGG175000.32383096097855424No Hit
TGGTGCGCCGCGACCGACTCTGGATCGGCCAGGAAGGGTGGAATTCTCGG174560.32301675741952246No Hit
AGGTGTAGAATAAGTGGGAGGCCTCACGTGGAATTCTCGGGTGCCAAGGA169940.31446762004968865RNA PCR Primer, Index 1 (100% over 22bp)
GTGCGCCGCGACCGACTCTGGATCGGCCAGGAAGGGCTGGAATTCTCGGG167240.3094713709374481No Hit
GCTTTGGTGACTCTAGATAACCTCGAGCCGATCGCTGGCCTGGAATTCTC165510.3062700705803458No Hit
CTCGGTTCTGGTGTCAAGCGCTGGAATTCTCGGGTGCCAAGGAACTCCAG162270.30027457164565713RNA PCR Primer, Index 1 (100% over 29bp)
TGCGCCGCGACCGACTCTGGATCGGCCAGGAAGGTGGAATTCTCGGGTGC161780.2993678449549172No Hit
ACAACACTGAGACACGAGACGAACGCATGGAATTCTCGGGTGCCAAGGAA149840.27727332110300895RNA PCR Primer, Index 1 (100% over 23bp)
CTCTCGGTTCTGGTGTCAAGCGCTGGAATTCTCGGGTGCCAAGGAACTCC148870.2754783723478707RNA PCR Primer, Index 1 (100% over 27bp)
ACTGGCGGGCGTGGGAAATGTGGCGTACATGGAATTCTCGGGTGCCAAGG124670.23069717660112202Illumina Small RNA Adapter 2 (100% over 21bp)
ACAACACTGAGACACGAGACGAACGCTGGAATTCTCGGGTGCCAAGGAAC121730.22525681645668233RNA PCR Primer, Index 1 (100% over 24bp)
GGCGAAGCTACCATCTGTGGGATTATGACTGAACGCTGGAATTCTCGGGT116230.2150792719687849No Hit
GCGCGCCGGCCGAGGTGGGATCCCGGTGGAATTCTCGGGTGCCAAGGAAC115530.2137839481248707RNA PCR Primer, Index 1 (100% over 24bp)
TGGGCTGGGGTGCGGCCGAATGATGGCTGCTGGAATTCTCGGGTGCCAAG112320.20784396306920694No Hit
GGTGCGCCGCGACCGACTCTGGATCGGCCAGGAAGGGCTCGGGGTGGAAT111860.2069927502574919No Hit
GACTGGCGGGCGTGGGAAATGTGGCGTACATGGAATTCTCGGGTGCCAAG107760.1994058534574229No Hit
GCTCTCGGTTCTGGTGTCAAGCGCCTGGAATTCTCGGGTGCCAAGGAACT106150.19642660861642017RNA PCR Primer, Index 1 (100% over 25bp)
GAGGTGTAGAATAAGTGGGAGGCCGTGGAATTCTCGGGTGCCAAGGAACT105380.19500175238811457RNA PCR Primer, Index 1 (100% over 25bp)
ACTTGGATAACTGTGGCAATTCTAGAGCTAATACATGCAAACTGGAATTC104040.1925221324583359No Hit
TGGTGCGCCGCGACCGACTCTGGATCGGCCAGGAAGGGCTGGAATTCTCG103930.19231858156857795No Hit
TTCGGTTGGTCCCGGATAGCTGGCCTGGAATTCTCGGGTGCCAAGGAACT100720.1863785965129142RNA PCR Primer, Index 1 (100% over 25bp)
TTTGGTGACTCTAGATAACCTCGAGCCGATCGCTGGCCCTGGAATTCTCG98570.18240010184946337No Hit
TCTCGGTTCTGGTGTCAAGCGCTGGAATTCTCGGGTGCCAAGGAACTCCA97410.18025356519383412RNA PCR Primer, Index 1 (100% over 28bp)
GTGCGCCGCGACCGACTCTGGATCGGCCAGGAAGGGCTCGGGGTGGAATT96790.17910627836065293No Hit
ATTGATCATCGACACTTCGAACGCACCTTGCGGCCCCGGGTGGAATTCTC95540.176793200067949No Hit
GCTTTGGTGACTCTAGATAACCTCGAGCCGATCGCTGGTGGAATTCTCGG95280.17631207978306657No Hit
CCCCGTCGCGCCTGGAATTCTCGGGTGCCAAGGAACTCCAGTCACTAGCT94560.17497974668646907RNA PCR Primer, Index 10 (100% over 38bp)
GGCCGTGATCGTATAGTGGTTAGTACTCTGTGGAATTCTCGGGTGCCAAG93320.17268517302010675No Hit
GCTTACGGCCATACCACCCTGAACACGCCCGATCTGGAATTCTCGGGTGC92560.17127882141814274No Hit
TTGCTGCAGTTAAAAAGCTCGTAGTTGGATCTCGGGATGGAATTCTCGGG90850.16811453031372373No Hit
GAAGAGTCGTTCGAGACCAGGACGTTGATAGGCTGGGTGTGGAATTCTCG89070.1648207068249133No Hit
CGTAATGGTGGGAACTCAAGGGAGACTGCCTGGAATTCTCGGGTGCCAAG89000.16469117444052186No Hit
TGACTCTAGATAACCTCGAGCCGATCGCTGGCCTGGAATTCTCGGGTGCC87330.16160090184146939No Hit
TGACTCTAGATAACCTCGAGCCGATCGCTGGCCCTGGAATTCTCGGGTGC87060.16110127693024534No Hit
GAATCTTCGGTTGGTCCCGGATAGCTGGCCTGGAATTCTCGGGTGCCAAG86920.1608422121614625No Hit
ATTGATCATCGACACTTCGAACGCACCTTGCGGCCCCGTGGAATTCTCGG86330.15975043920730622No Hit
TTGCTTTGGTGACTCTAGATAACCTCGAGCCGATCGCTGGCCTGGAATTC84500.15636409258678763No Hit
ACAACACTGAGACACGAGACGAACACTGGAATTCTCGGGTGCCAAGGAAC83790.15505026411653178RNA PCR Primer, Index 1 (100% over 24bp)
CACATGAGAGTCCACACTGGAGAGAAGCCTGGAATTCTCGGGTGCCAAGG82770.15316279222968535Illumina Small RNA Adapter 2 (100% over 21bp)
GCTTACGGCCATACCACCCTGAACACGCCCGATCTCGTGGAATTCTCGGG82760.1531442876033437No Hit
CCGTGATCGTATAGTGGTTAGTACTCTGCTGGAATTCTCGGGTGCCAAGG81170.15020205201502426Illumina Small RNA Adapter 2 (100% over 21bp)
TTTGGTGACTCTAGATAACCTCGAGCCGATCGCTGGCTGGAATTCTCGGG81070.15001700575160798No Hit
TCGGTTCTGGTGTCAAGCGCCTGGAATTCTCGGGTGCCAAGGAACTCCAG80820.14955439009306717RNA PCR Primer, Index 1 (100% over 29bp)
ATCTTCGGTTGGTCCCGGATAGCTGGCCTGGAATTCTCGGGTGCCAAGGA77990.14431758083838542RNA PCR Primer, Index 1 (100% over 22bp)
CGGTGCGGAGAGCCGTTCGTGACTGGGCTGGAATTCTCGGGTGCCAAGGA75820.14030207692225133RNA PCR Primer, Index 1 (100% over 22bp)
AATCTTCGGTTGGTCCCGGATAGCTGGCCCTCGGGCTGGAATTCTCGGGT74420.1377114292344229No Hit
TCCAGTGCGGTAACGCAAACGAACTCTGGAATTCTCGGGTGCCAAGGAAC72810.1347321843934202RNA PCR Primer, Index 1 (100% over 24bp)
CGGTTGGTCCCGGATAGCTGGCCTGGAATTCTCGGGTGCCAAGGAACTCC72360.13389947620804676RNA PCR Primer, Index 1 (100% over 27bp)
CTCGGGGGCCTGAGTCCTTGGAATTCTCGGGTGCCAAGGAACTCCAGTCA72090.13339985129682272RNA PCR Primer, Index 1 (100% over 32bp)
ACATTGATCATCGACACTTCGAACGCACCTTGCGGCCCCGTGGAATTCTC71560.13241910610071625No Hit
GAGGTGTAGAATAAGTGGGAGGCCTGGAATTCTCGGGTGCCAAGGAACTC70460.13038359720313678RNA PCR Primer, Index 1 (100% over 26bp)
TGGTGCGCCGCGACCGACTCTGGATCGGCCAGGAAGGGCTCGGGGTGGAA70320.1301245324343539No Hit
ATTGATCATCGACACTTCGAACGCACCTTGCGGCCCTGGAATTCTCGGGT69700.12897724560117274No Hit
CGAATCTTCGGTTGGTCCCGGATAGCTGGCCTGGAATTCTCGGGTGCCAA68930.12755238937286711No Hit
TTTGGTGACTCTAGATAACCTCGAGCCGATCGCTGGTGGAATTCTCGGGT68430.12662715805578553No Hit
TGAAGAGTCGTTCGAGACCAGGACGTTGATAGGCTGGGTGTGGAATGGAA65830.1218159552069613No Hit
GGATTCAACTCGGCAGGTCAGGGACTGGAATTCTCGGGTGCCAAGGAACT64280.11894773812400837RNA PCR Primer, Index 1 (100% over 25bp)
ATTGATCATCGACACTTCGAACGCACCTTGCGGCCCCTGGAATTCTCGGG64020.11846661783912597No Hit
CATTGATCATCGACACTTCGAACGCACCTTGCGGCCCCGGGTGGAATTCT63120.1168012014683791No Hit
GCTTACGGCCATACCACCCTGAACACGCCCGATGGAATTCTCGGGTGCCA62120.11495073883421593No Hit
CCGTGATCGTATAGTGGTTAGTACTCTGCGTGGAATTCTCGGGTGCCAAG61690.11415503990152577No Hit
TTGGTGACTCTAGATAACCTCGAGCCGATCGCTGGTGGAATTCTCGGGTG61370.11356289185859357No Hit
TGCTTTGGTGACTCTAGATAACCTCGAGCCGATCGCTGGCCCTGGAATTC61220.11328532246346909No Hit
GTTGCTTTGGTGACTCTAGATAACCTCGAGCCGATCGCTGGCCTGGAATT60910.11271167904687851No Hit
GTGACTCTAGATAACCTCGAGCCGATCGCTGGCCTGGAATTCTCGGGTGC60480.11191598011418835No Hit
ACATTGATCATCGACACTTCGAACGCACCTTGCGGCCCCGGGTGGAATTC59910.11086121641271535No Hit
CACATGAGAGTCCACACTGGAGAGAAGCCTTGGAATTCTCGGGTGCCAAG59820.11069467477564067No Hit
GGAATACCAGGTGCTGTAAGCTTTGGAATTCTCGGGTGCCAAGGAACTCC59700.11047261925954109RNA PCR Primer, Index 1 (100% over 27bp)
GCCGTGATCGTATAGTGGTTAGTACTCTGTGGAATTCTCGGGTGCCAAGG59430.10997299434831703Illumina Small RNA Adapter 2 (100% over 21bp)
CTCGGGCCGGTGCGGAGAGCCGTTCGTGTGGAATTCTCGGGTGCCAAGGA59270.1096769203268509RNA PCR Primer, Index 1 (100% over 22bp)
CGGTGCGGAGAGCCGTTCGTGACTGGGCTGGGGTGCGGCCGAATGATGGC58890.10897374452586892No Hit
GTGACTCTAGATAACCTCGAGCCGATCGCTGGCCCTGGAATTCTCGGGTG58060.10743786053951349No Hit
GTGCGCCGCGACCGACTCTGGATCGGCCAGGAAGGGGGAATTCTCGGGTG57880.1071047772653641No Hit
GGTGCGCCGCGACCGACTCTGGATCGGCCAGGAAGTGGAATTCTCGGGTG57470.10634608758535721No Hit
GGGATTCAACTCGGCAGGTCAGGGACTGGAATTCTCGGGTGCCAAGGAAC56810.10512478224680953RNA PCR Primer, Index 1 (100% over 24bp)
CCGTGATCGTATAGTGGTTAGTACTCTGTGGAATTCTCGGGTGCCAAGGA55940.10351487975508757RNA PCR Primer, Index 1 (100% over 22bp)
GTTGCTGCAGTTAAAAAGCTCGTAGTTGGATCTCGGGATGGAATTCTCGG55820.10329282423898799No Hit
GTGCGCCGCGACCGACTCTGGATCGGCCAGGATGGAATTCTCGGGTGCCA55100.1019604911423905No Hit
GCATTGGTGGTCCAGTGGTAGGATTCTCGCCTTGGAATTCTCGGGTGCCA54560.10096124131994239No Hit

[WARN]Adapter Content

Adapter graph

[WARN]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
TCCCATA254.42343E-544.036331
TTATTAT302.5300833E-643.99843621
GCTATAC207.8625977E-443.99599518
GGCTATA700.043.993963
TCCCTGA43900.043.0833781
GCTTACG78000.042.963651
GCTGCCC133750.042.7961526
TGGCTGC235400.042.79128624
GATGGCT236200.042.7131322
TGCCCTG132550.042.46916628
CTTACGG79450.042.449012
TTACGGC79600.042.363533
GGCTGCC225400.042.32789625
ACGGCCA80750.041.9508935
TACGGCC80850.041.899014
GCCATAC84050.041.7693988
CATTGGT14300.041.6919822
CGAATGA241200.041.68857217
ATGGCTG241950.041.6874123
CATACCA84150.041.6674810